Home
GeneCards Guide
Suite
- MalaCards
- GeneALaCart
- GeneDecks
- GeneIP
- GeneLoc
Terms and Conditions
- Terms of Use
- 3rd Party Notice
About Us
- GeneCards Team
- Our Publications
- Citing GeneCards
- Licensing Agreement
- Weizmann Institute
- LifeMap Sciences Inc
User Feedback
Mirror sites

Set Analyses:

Generates a file of GeneCards annotations for your list of genes

Advanced Search

Search By

Section (entire)

for

All GeneCards Within gene subset (to enable gene prioritization):
or upload a file of gene symbols

Category Symbol Source: HGNC EntrezGene Ensembl GeneCards RNA genes CroW21

GIFtS
-

NOS1 Gene

protein-coding GIFtS: 72
GCID: GC12M117636

Nitric Oxide Synthase 1 (Neuronal)

(Previous symbol: NOS)

Microbiology & Infectious Diseases Congress

158 related diseases
at

MalaCards

(According to ¹HGNC, ²Entrez Gene,
³UniProtKB/Swiss-Prot, ⁴UniProtKB/TrEMBL, ⁵OMIM, ⁶GeneLoc, ⁷Ensembl, ⁸DME, ⁹miRBase, ¹⁰fRNAdb, ¹²H-InvDB, ¹³NCBI, ¹⁴NONCODE, and/or ¹⁵RNAdb)
About This Section

Aliases
Nitric Oxide Synthase 1 (Neuronal)¹ ²		bNOS² ³
NOS¹ ²		nNOS² ³
Constitutive NOS² ³		NOS Type I² ³
Neuronal NOS² ³		EC 1.14.13.39³ ⁸
Peptidyl-Cysteine S-Nitrosylase NOS1² ³		IHPS1²
N-NOS² ³		Nitric Oxide Synthase, Brain²
NC-NOS² ³

External Ids:	HGNC: 7872¹	Entrez Gene: 4842²	Ensembl: ENSG00000089250⁷	OMIM: 163731⁵	UniProtKB: P29475³

Export aliases for NOS1 gene to outside databases

Previous GC identifers: GC12M116666 GC12M117169 GC12M117431 GC12M116060 GC12M116111 GC12M114660

(According to Entrez Gene, Tocris Bioscience, Wikipedia's Gene Wiki, PharmGKB,
UniProtKB/Swiss-Prot, and/or UniProtKB/TrEMBL)
About This Section

Entrez Gene summary for NOS1 Gene:

The protein encoded by this gene belongs to the family of nitric oxide synthases, which synthesize nitric oxide

from L-arginine. Nitric oxide is a reactive free radical, which acts as a biologic mediator in several processes,

including neurotransmission, and antimicrobial and antitumoral activities. In the brain and peripheral nervous

system, nitric oxide displays many properties of a neurotransmitter, and has been implicated in neurotoxicity

associated with stroke and neurodegenerative diseases, neural regulation of smooth muscle, including peristalsis,

and penile erection. This protein is ubiquitously expressed, with high level of expression in skeletal muscle.

Multiple transcript variants that differ in the 5' UTR have been described for this gene but the full-length

nature of these transcripts is not known. Additionally, alternatively spliced transcript variants encoding

different isoforms (some testis-specific) have been found for this gene.(provided by RefSeq, Feb 2011)

GeneCards Summary for NOS1 Gene:

NOS1 (nitric oxide synthase 1 (neuronal)) is a protein-coding gene. Diseases associated with NOS1 include pyloric stenosis, and hypertrophic pyloric stenosis, and among its related super-pathways are Parkinson's disease and cGMP effects. GO annotations related to this gene include calmodulin binding and heme binding. An important paralog of this gene is NOS3.

UniProtKB/Swiss-Prot: NOS1_HUMAN, P29475

Function: Produces nitric oxide (NO) which is a messenger molecule with diverse functions throughout the body. In

the brain and peripheral nervous system, NO displays many properties of a neurotransmitter. Probably has

nitrosylase activity and mediates cysteine S-nitrosylation of cytoplasmic target proteins such SRR

summary for NOS1 Gene:

Neuronal nitric oxide synthase (nNOS), along with inducible nitric oxide synthase (iNOS) and endothelial

nitric oxide synthase (eNOS), catalyze the generation of nitric oxide and L-citrulline from L-arginine and

molecular oxygen. It is activated at concentrations of calcium greater than 100 nM and requires co-factors

of tetrahydrobiopterin, flavin adenine dinucleotide, flavin mononucleotide and NADPH for catalytic activity.

Transcriptional regulation of nNOS is very complex and the nNOS gene produces multiple mRNA transcripts

using alternate promoters, alternative splicing, cassette insertions/deletions, and varied sites for 3'-UTR

cleavage and polyadenylation. Some of these alterations lead to variation in amino acid sequence,

translating into nNOS isoforms with altered structural and functional properties. nNOS has been implicated

in a wide variety of physiological and pathological processes, including neurotransmission, neurotoxicity,

skeletal muscle contraction, sexual function, body fluid homeostasis and atherosclerosis. Consistent with

such wide involvement, nNOS is expressed in numerous tissues. The human gene encoding nNOS is localized to

chromosome 12q14.

Gene Wiki entry for NOS1 Gene

(According to GeneLoc and/or HGNC, and/or
Entrez Gene (NCBI build 37),
and/or miRBase,
Genomic Views according to UCSC (hg19) and Ensembl (release 73), Regulatory elements and Epigenetics data according to QIAGEN, SABiosciences, and/or SwitchGear Genomics)
About This Section

RefSeq DNA sequence:

NC_000012.11 NT_009775.17 NC_018923.2

Regulatory elements:

SABiosciences Regulatory transcription factor binding sites in the NOS1 gene promoter:
CREB AP-1 ATF-2 deltaCREB c-Jun STAT5A Nkx2-5
Other transcription factors

SwitchGear Promoter luciferase reporter plasmid: NOS1 promoter sequence

Search SABiosciences Chromatin IP Primers for NOS1

Epigenetics:

QIAGEN PyroMark CpG Assay predesigned Pyrosequencing DNA Methylation assays in human, mouse, rat NOS1

Genomic Location:
Genomic View: UCSC Golden Path with GeneCards custom track

Entrez Gene cytogenetic band: 12q24.22 Ensembl cytogenetic band: 12q24.22 HGNC cytogenetic band: 12q24.22

NOS1 Gene in genomic location: bands according to Ensembl, locations according to (and/or Entrez Gene and/or Ensembl if different)
NOS1 gene location

GeneLoc information about chromosome 12 GeneLoc Exon Structure

GeneLoc location for GC12M117636: view genomic region (about GC identifiers)

Start:	117,645,947 bp from pter	End:	117,889,975 bp from pter
Size:	244,029 bases	Orientation:	minus strand

(According to UniProtKB, HORDE, neXtProt, Ensembl, and/or Reactome, Modification sites according to PhosphoSitePlus, Specific Peptides from DME, Protein expression images according to data from SPIRE ¹MOPED, ²PaxDb, and ³MAXQB RefSeq according to NCBI, PDB rendering according to OCA and/or Proteopedia, Recombinant Proteins from EMD Millipore, R&D Systems, GenScript, Enzo Life Sciences, OriGene, Novus Biologicals, Sino Biological, ProSpec, and/or Cloud-Clone Corp.,
Biochemical Assays by EMD Millipore, R&D Systems, OriGene, GenScript, Cell Signaling Technology, Enzo Life Sciences, and/or Cloud-Clone Corp., Ontologies according to Gene Ontology Consortium 01 Oct 2013 and Entrez Gene, Antibodies by EMD Millipore, R&D Systems, GenScript, Cell Signaling Technology, OriGene, Novus Biologicals, Thermo Fisher Scientific, LSBio, Abcam, and/or Cloud-Clone Corp.)
About This Section

UniProtKB/Swiss-Prot: NOS1_HUMAN, P29475 (See protein sequence)

Recommended Name: Nitric oxide synthase, brain

Size: 1434 amino acids; 160970 Da

Cofactor: Heme group

Cofactor: Binds 1 FAD

Cofactor: Binds 1 FMN

Cofactor: Tetrahydrobiopterin (BH4). May stabilize the dimeric form of the enzyme

Subunit: Homodimer. Interacts with DLG4; the interaction possibly being prevented by the association between NOS1

and CAPON. Forms a ternary complex with CAPON and RASD1. Forms a ternary complex with CAPON and SYN1. Interacts

with ZDHHC23. Interacts with NOSIP; which may impair its synaptic location (By similarity). Interacts with HTR4.

Interacts with VAC14 (By similarity). Interacts with SLC6A4 (By similarity)

Subcellular location: Cell membrane, sarcolemma; Peripheral membrane protein. Cell projection, dendritic spine (By

similarity). Note=In skeletal muscle, it is localized beneath the sarcolemma of fast-twitch muscle fiber by

associating with the dystrophin glycoprotein complex. In neurons, enriched in dendritic spines (By similarity)

Secondary accessions: E9PH30 O75713

Alternative splicing: 5 isoforms: P29475-1 P29475-2 P29475-3 P29475-4 P29475-5

Explore the universe of human proteins at neXtProt for NOS1: NX_P29475

Explore proteomics data for NOS1 at MOPED

Post-translational modifications:

UniProtKB: Ubiquitinated; mediated by STUB1/CHIP in the presence of Hsp70 and Hsp40 (in vitro) (By similarity)

View modification sites using PhosphoSitePlus

View neXtProt modification sites for NX_P29475

4/38 DME Specific Peptides for NOS1 (P29475) (see all 38)

VLEEFPS

GWYMGTE

LDITTPP

VFGLGSR

NOS1 Protein expression data from MOPED¹, PaxDb² and MAXQB³ : About this image

REFSEQ proteins (4 alternative transcripts):

NP_000611.1 NP_001191142.1 NP_001191143.1 NP_001191147.1

ENSEMBL proteins:

ENSP00000320758 ENSP00000337459 ENSP00000339862

Reactome Protein details: P29475
Human Recombinant Protein Products for NOS1:

	Browse Purified and Recombinant Proteins at EMD Millipore
	Browse R&D Systems for human recombinant proteins
	Enzo Life Sciences proteins for NOS1
	OriGene Purified Protein for NOS1 OriGene Protein Over-expression Lysate for NOS1 OriGene MassSpec for NOS1 OriGene Custom Protein Services for NOS1
	GenScript Custom Purified and Recombinant Proteins Services for NOS1
	Novus Biologicals NOS1 Proteins Novus Biologicals NOS1 Lysate
	Browse Sino Biological Recombinant Proteins Browse Sino Biological Cell Lysates
	Browse ProSpec Recombinant Proteins
	Cloud-Clone Corp. Proteins for NOS1

Gene Ontology (GO): 5/10 cellular component terms (GO ID links to tree view) (see all 10): About this table

GO ID	Qualified GO term	Evidence	PubMed IDs
GO:0001917	photoreceptor inner segment	ISS	17027776
GO:0005737	cytoplasm	TAS	17892502
GO:0005829	cytosol	TAS	--
GO:0005856	cytoskeleton	ISS	7545544
GO:0016529	sarcoplasmic reticulum	IDA	9892689

NOS1 for ontologies About GeneDecksing

NOS1 Antibody Products:

	EMD Millipore Mono- and Polyclonal Antibodies for the study of NOS1
	R&D Systems Antibodies for NOS1 (nNOS)
	Cell Signaling Technology (CST) Antibodies for NOS1 (nNOS)
	OriGene Antibodies for NOS1 OriGene Custom Antibody Services for NOS1
	GenScript Custom Superior Antibodies Services for NOS1
	Novus Biologicals NOS1 Antibodies
	Abcam antibodies for NOS1
	Cloud-Clone Corp. Antibodies for NOS1
	ThermoFisher Antibody for NOS1
	LSBio Antibodies in human, mouse, rat for NOS1

Assay Products for NOS1:

	Browse Kits and Assays available from EMD Millipore
	OriGene Custom Assay Services for NOS1
	Browse R&D Systems for biochemical assays
	GenScript Custom Assay Services for NOS1
	Enzo Life Sciences assays for NOS1
	Cloud-Clone Corp. ELISAs for NOS1 Cloud-Clone Corp. CLIAs for NOS1

(According to HGNC, IUPHAR, InterPro, ProtoNet, UniProtKB, and/or BLOCKS, Sets of similar genes according to GeneDecks)
About This Section

IUPHAR Guide to PHARMACOLOGY protein family classification: Neuronal NOS

Nitric oxide synthases

5/12 InterPro protein domains (see all 12):

IPR026009 NOS

IPR017927 Fd_Rdtase_FAD-bd

IPR001094 Flavdoxin

IPR008254 Flavodoxin/NO_synth

IPR001433 OxRdtase_FAD/NAD-bd

Graphical View of Domain Structure for InterPro Entry P29475

ProtoNet protein and cluster: P29475

5/6 Blocks protein domains (see all 6):

IPB001094 Flavodoxin signature

IPB001433 Oxidoreductase FAD/NAD(P)-binding

IPB001478 PDZ/DHR/GLGF domain

IPB001709 Flavoprotein pyridine nucleotide cytochrome reductase signature

IPB003097 FAD-binding

UniProtKB/Swiss-Prot: NOS1_HUMAN, P29475

Domain: The PDZ domain in the N-terminal part of the neuronal isoform participates in protein-protein interaction,

and is responsible for targeting nNos to synaptic membranes in muscles. Mediates interaction with VAC14 (By

similarity)

Similarity: Belongs to the NOS family

Similarity: Contains 1 FAD-binding FR-type domain

Similarity: Contains 1 flavodoxin-like domain

Similarity: Contains 1 PDZ (DHR) domain

NOS1 for domains About GeneDecksing

(According to ¹UniProtKB, Genatlas, LifeMap Discovery™, IUBMB, and/or ²DME, Human phenotypes from GenomeRNAi, Animal models from MGI Mar 06 2013, inGenious Targeting Laboratory, genOway,
bound targets from SABiosciences, miRNA Gene Targets from miRTarBase, shRNA from OriGene, RNAi from EMD Millipore, siRNAs from OriGene, QIAGEN, microRNA from QIAGEN, Gene Editing from DNA2.0, Sirion Biotech, Clones from EMD Millipore, OriGene, SwitchGear Genomics, GenScript, Sino Biological, DNA2.0, Vector BioLabs, and Sirion Biotech, Cell Lines from GenScript, LifeMap BioReagents, In Situ Hybridization Assays from Advanced Cell Diagnostics, Ontologies according to Gene Ontology Consortium 01 Oct 2013 via Entrez Gene.)
About This Section

Molecular Function:

UniProtKB/Swiss-Prot Summary: NOS1_HUMAN, P29475

Function: Produces nitric oxide (NO) which is a messenger molecule with diverse functions throughout the body. In

the brain and peripheral nervous system, NO displays many properties of a neurotransmitter. Probably has

nitrosylase activity and mediates cysteine S-nitrosylation of cytoplasmic target proteins such SRR

Catalytic activity: 2 L-arginine + 3 NADPH + 4 O(2) = 2 L-citrulline + 2 nitric oxide + 3 NADP(+) + 4 H(2)O

Enzyme regulation: Stimulated by calcium/calmodulin. Inhibited by n-Nos-inhibiting protein (PIN) which may prevent

the dimerization of the protein. Inhibited by NOSIP

Genatlas biochemistry entry for NOS1:

nitric oxide synthase 1,constitutive by expressed,neuronal,putative susceptibility gene for infantile pyloric

stenosis,widely expressed with a high expression in skeletal muscle

Enzyme Number (IUBMB): EC 1.14.13.39¹ ²

Gene Ontology (GO): 5/16 molecular function terms (GO ID links to tree view) (see all 16): About this table

GO ID	Qualified GO term	Evidence	PubMed IDs
GO:0003958	NADPH-hemoprotein reductase activity	IBA	--
GO:0004517	nitric-oxide synthase activity	ISS	--
GO:0005506	iron ion binding	IEA	--
GO:0005515	protein binding	IPI	11149895
GO:0005516	calmodulin binding	IEA	--

NOS1 for ontologies About GeneDecksing

Phenotypes:
1 GenomeRNAi human phenotype for NOS1:

Decreased viability after Chla

15/21 MGI mutant phenotypes (inferred from 5 alleles) (MGI details for Nos1) (see all 21):

adipose tissue	behavior/neurological	cardiovascular system	cellular	digestive/alimentary
endocrine/exocrine gland	growth/size	hematopoietic system	homeostasis/metabolism	immune system
liver/biliary system	mortality/aging	muscle	nervous system	normal

NOS1 for phenotypes About GeneDecksing

Animal Models:
MGI mouse knock-outs for NOS1: Nos1^tm1Plh Nos1^tm1Enik Nos1^tm2Plh

inGenious Targeting Laboratory - Custom generated mouse model solutions for NOS1

inGenious Targeting Laboratory - Custom generated inducible mouse model solutions for NOS1

genOway customized KO model: permanent, tissue-specific or time-controlled inactivation for NOS1

genOway customized Knockin model: humanization, point mutation, expression monitoring, etc. for NOS1

miRNA Products:		QIAGEN Custom miScript Target Protector blocks miRNA-binding site of human, mouse, rat NOS1
		8/74 QIAGEN miScript miRNA Assays for microRNAs that regulate NOS1 (see all 74):
		hsa-miR-4254 hsa-miR-146a hsa-miR-15a hsa-miR-938 hsa-miR-371-5p hsa-miR-502-3p hsa-miR-149 hsa-miR-3116

		SwitchGear 3'UTR luciferase reporter plasmid: NOS1 3' UTR sequence

Inhib. RNA Products:		Browse for Gene Knock-down Tools from EMD Millipore
		OriGene RNAi products in human, mouse, rat for NOS1
		QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat NOS1

Gene Editing Products:			DNA2.0 Custom Protein Engineering Service for NOS1
			Sirion Biotech Customized adenovirus for overexpression of NOS1

Clone Products:		Browse Clones for the Expression of Recombinant Proteins Available from EMD Millipore
		OriGene clones in human, mouse for NOS1 (see all 7) OriGene ORF clones in mouse, rat for NOS1 OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
		GenScript: all cDNA clones in your preferred vector (see all 4): NOS1 (NM_000620)
		Browse Sino Biological Human cDNA Clones
		DNA2.0 Custom Codon Optimized Gene Synthesis Service for NOS1
		Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat NOS1
		Sirion Biotech Customized lentivirus for stable overexpression of NOS1 Customized lentivirus expression plasmids for stable overexpression of NOS1

Cell Line Products:		GenScript Custom overexpressing Cell Line Services for NOS1
		Search LifeMap BioReagents cell lines for NOS1

In Situ Assay
Products:

Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for NOS1

(Pathways according to EMD Millipore, R&D Systems, Cell Signaling Technology, KEGG, PharmGKB, BioSystems, Sino Biological, Reactome, Tocris Bioscience, GeneGo (Thomson Reuters), QIAGEN, and/or UniProtKB, Sets of similar genes according to GeneDecks, Interaction Networks according to SABiosciences, and/or STRING, Interactions according to ¹UniProtKB, ²MINT, ³I2D, and/or ⁴STRING, with links to IntAct and Ensembl, Ontologies according to Gene Ontology Consortium 01 Oct 2013 via Entrez Gene).
About This Section

SuperPaths for NOS1 About (see all 33)

See pathways by source

SuperPath

Contained pathways About

Respiratory electron transport, ATP synthesis by chemiosmotic coupling, and heat production by uncoupling proteins.

Alzheimer's disease

0.46

Alzheimers Disease

0.44

Nitric oxide stimulates guanylate cyclase

Nitric oxide stimulates guanylate cyclase

0.75

Platelet homeostasis

0.34

Insulin receptor recycling

Latent infection of Homo sapiens with Mycobacterium tuberculosis

0.64

Phagosomal maturation (early endosomal stage)

0.64

glutamine degradation I

superpathway of citrulline metabolism

0.50

citrulline-nitric oxide cycle

0.43

Apoptosis and survival Anti-apoptotic action of nuclear ESR1 and ESR2

Apoptosis and survival Anti-apoptotic action of nuclear ESR1 and ESR2

1.00

Pathways by source See SuperPaths
Show all pathways

1 EMD Millipore Pathway for NOS1

Apoptosis and survival Anti-apoptotic action of nuclear ESR1 and ESR2

5/9 Downloadable PowerPoint Slides of QIAGEN Pathway Central Maps for NOS1 (see all 9)

	Cellular Effects of Sildenafil
	Muscular Dystrophies and Dystrophin-Glycoprotein Complex
	Neuropathic Pain-Signaling in Dorsal Horn Neurons
	Sertoli-Sertoli Cell Junction Dynamics
	Endothelin-1 Signaling Pathway

2 Cell Signaling Technology (CST) Pathways for NOS1

	Neuroscience
	PI3K / Akt Signaling

3 GeneGo (Thomson Reuters) Pathways for NOS1

	Mechanisms of CFTR activation by S-nitrosoglutathione (normal and CF)
	Apoptosis and survival Anti-apoptotic action of nuclear ESR1 and ESR2
	NO-dependent CFTR activation (normal and CF)

5/6 BioSystems Pathways for NOS1 (see all 6)

	Myometrial Relaxation and Contraction Pathways
	Spinal Cord Injury
	Monoamine Transport
	Alzheimers Disease
	citrulline-nitric oxide cycle

5/6 Reactome Pathways for NOS1 (see all 6)

	Hemostasis
	Phagosomal maturation (early endosomal stage)
	Latent infection of Homo sapiens with Mycobacterium tuberculosis
	Platelet homeostasis
	Nitric oxide stimulates guanylate cyclase

2 PharmGKB Pathways for NOS1

	Doxorubicin Pathway (Cardiomyocyte Cell), Pharmacodynamics
	Doxorubicin Pathway, Pharmacokinetics

5/9 Kegg Pathways (Kegg details for NOS1) (see all 9):

	Arginine and proline metabolism
	Metabolic pathways
	Calcium signaling pathway
	Phagosome
	Circadian entrainment

NOS1 for pathways About GeneDecksing

Interactions:

SABiosciences Gene Network Central^TM Interacting Genes and Proteins Network for NOS1

STRING Interaction Network Preview (showing 5 interactants - click image to see 25)

5/63 Interacting proteins for NOS1 (P29475^{2, 3} ENSP00000320758⁴) via UniProtKB, MINT, STRING, and/or I2D (see all 63)

Interactant		Interaction Details
GeneCard	External ID(s)	Interaction Details
VAC14	Q08AM6²^,³, ENSP00000261776⁴	MINT-3999924 MINT-3999953 MINT-3999982 MINT-3999902 MINT-3999876 I2D: score=3 STRING: ENSP00000261776
CALM1	P62158³, ENSP00000349467⁴	I2D: score=1 STRING: ENSP00000349467
CALM2	P62158³	I2D: score=1
CALM3	P62158³	I2D: score=1
ADRA1A	P35348³, ENSP00000369960⁴	I2D: score=2 STRING: ENSP00000369960

About this table

Gene Ontology (GO): 5/30 biological process terms (GO ID links to tree view) (see all 30): About this table

GO ID	Qualified GO term	Evidence	PubMed IDs
GO:0001666	response to hypoxia	IEP	16276418
GO:0002028	regulation of sodium ion transport	--	--
GO:0006527	arginine catabolic process	IC	7545544
GO:0006809	nitric oxide biosynthetic process	ISS	7545544
GO:0006941	striated muscle contraction	IEA	--

NOS1 for ontologies About GeneDecksing

(Chemical Compounds according to UniProtKB, Enzo Life Sciences, EMD Millipore, Tocris Bioscience HMDB, BitterDB, and/or Novoseek, Ligands according to IUPHAR, and Drugs according to DrugBank, Enzo Life Sciences, and/or PharmGKB, with drugs/clinical trials/news search links to CenterWatch)
About This Section

NOS1 for compounds About GeneDecksing

EMD Millipore small molecules for NOS1:
Small Molecule - inhibitor

Enzo Life Sciences drugs & compounds for NOS1

Compounds for NOS1 available from Tocris Bioscience About this table

Compound	Action	CAS #
3-Bromo-7-nitroindazole	Selective nNOS inhibitor	[74209-34-0]
Nomega-Propyl-L-arginine hydrochloride	Highly selective inhibitor of nNOS	[137361-05-8]
ARL 17477 dihydrochloride	Selective nNOS inhibitor	[180983-17-9]

14 HMDB Compounds for NOS1 (see first 10) About this table

Compound	Synonyms	CAS #	PubMed Ids
Dihydrobiopterin	(S-(R,S))-2-amino-6-(1,2-dihydroxypropyl)-7,8-dihydro-4(1H)-Pteridinone (see all 15)	6779-87-9	16804678
Tetrahydrobiopterin	(1R,2S)-(2-Amino-3,4,5,6,7,8-hexahydro-4-oxo-6-pteridinyl)-1,2-propandiol (see all 11)	17528-72-2	16216381
Calcium	Ca (see all 2)	7440-70-2	--
Citrulline	(2S)-2-amino-5-(carbamoylamino)pentanoic acid (see all 55)	372-75-8	--
FAD	1H-Purin-6-amine flavin dinucleotide (see all 21)	146-14-5	--
Flavin Mononucleotide	FMN (see all 19)	146-17-8	--
Heme	(protoporphyrinato)iron (see all 19)	14875-96-8	--
L-Arginine	(S)-2-Amino-5-[(aminoiminomethyl)amino]pentanoate (see all 14)	74-79-3	--
N-(o)-Hydroxyarginine	N-(G)-Hydroxyarginine (see all 2)	--	--
NADP	Adenine-nicotinamide dinucleotide phosphate (see all 18)	53-59-8	--
NADPH	2'-(dihydrogen phosphate) 5'-(trihydrogen pyrophosphate) Adenosine 5'-ester with 1,4-dihydro-1-b-D-ribofuranosylnicotinamide (see all 23)	53-57-6	--
Nitric oxide	Mononitrogen monoxide (see all 9)	10102-43-9	--
Oxygen	Oxygen (see all 5)	7782-44-7	--
Water	Dihydrogen oxide (see all 2)	7732-18-5	--

10/26 DrugBank Compounds for NOS1 (see all 26) About this table

Compound	Synonyms	CAS #	Type	Actions	PubMed Ids
L-Citrulline	2-Amino-5-uredovaleric acid (see all 8)	372-75-8	target	--	10681601 10502685 10962148 10945985 10799481
(6r,1'r,2's)-5,6,7,8 Tetrahydrobiopterin	--	--	target	--	17139284 17016423 10592235
2'-Monophosphoadenosine 5'-Diphosphoribose	--	--	target	--	17139284 17016423 10592235
3-Bromo-7-Nitroindazole	--	--	target	--	17139284 17016423 10592235
5-N-Allyl-Arginine	--	--	target	--	17139284 17016423 10592235
Alpha-D-Mannose	--	3458-28-4	target	--	17139284 17016423 10592235
Flavin-Adenine Dinucleotide	--	146-14-5	target	--	17139284 17016423 10592235
Heme	--	--	target	--	17139284 17016423 10592235
L-N(Omega)-Nitroarginine-(4r)-Amino-L-Proline Amide	--	--	target	--	17139284 17016423 10592235
L-N(Omega)-Nitroarginine-2,4-L-Diaminobutyric Amide	--	--	target	--	17139284 17016423 10592235

2 IUPHAR Ligands for NOS1 (Neuronal NOS) About this table

Ligand	Type	Action	Affinity	Pubmed IDs
3-bromo-7NI	Inhibitor	Inhibition	6.1 - 6.5	7544863
7NI	Inhibitor	Inhibition	5.3	7693279

10/127 Novoseek inferred chemical compound relationships for NOS1 gene (see all 127) About this table

Compound	-log (P-Val)	Hits	PubMed IDs for Articles with Shared Sentences (# sentences)
nitric oxide	94.2	3522	18580182 (7), 16581191 (7), 17320763 (6), 7524095 (6) (see all 99)
tetrahydrobiopterin	92.1	193	16216381 (6), 7691806 (5), 9858648 (4), 7514193 (2) (see all 99)
citrulline	87.1	144	12586539 (4), 14725962 (3), 17110176 (3), 8962079 (2) (see all 91)
7-nitroindazole	85.1	167	7542758 (3), 11448483 (3), 12322787 (3), 15138761 (2) (see all 70)
arginine	84.3	472	7519607 (9), 14602725 (5), 15007014 (5), 8955074 (4) (see all 99)
n(g)-hydroxy-l-arginine	81.7	27	9398165 (4), 19128180 (3), 11481035 (2), 9735327 (1) (see all 12)
nadph	81.2	265	10847600 (6), 7528212 (5), 12429187 (4), 8690302 (4) (see all 99)
dihydrobiopterin	78.6	14	8626754 (3), 16804678 (1), 15476407 (1), 16118486 (1) (see all 6)
peroxynitrite	75.9	47	8839053 (4), 11085318 (3), 12208472 (2), 9398256 (2) (see all 28)
n-omega-propyl-l-arginine	75	21	15160393 (2), 16423462 (1), 17572695 (1), 19019012 (1) (see all 8)

Search CenterWatch for drugs/clinical trials and news about NOS1

(Secondary structures according to fRNAdb,
GenBank/EMBL/DDBJ Accessions according to
Unigene (Build 236 Homo sapiens; Apr 25 2013) or GenBank,
RefSeq according to Entrez Gene,
DOTS (version 10), and/or AceView, transcript ids from Ensembl with links to UCSC,
Conferences by KenesGroup, exon structure from GeneLoc, alternative splicing isoforms according to ASD and/or ECgene,
RNAi Products from EMD Millipore,
siRNAs from OriGene, QIAGEN, shRNA from OriGene, microRNA from QIAGEN,
Tagged/untagged cDNA clones from OriGene, SwitchGear Genomics, GenScript, DNA2.0, Vector BioLabs, Sirion Biotech, Primers from OriGene, SABiosciences, and/or QIAGEN )
About This Section

REFSEQ mRNAs for NOS1 gene (4 alternative transcripts):

NM_000620.4 NM_001204213.1 NM_001204214.1 NM_001204218.1

Unigene Clusters for NOS1:

Nitric oxide synthase 1 (neuronal)

Hs.654410 [show with all ESTs], Hs.684465 , Hs.684466 , Hs.684467 , Hs.735734 [show with all ESTs]

Unigene Representative Sequences: NM_001204218, AF446137, AF446133, AF446132, DA522461

5 Ensembl transcripts including schematic representations, and UCSC links where relevant:

ENST00000317775(uc021ren.1 uc021reo.1 uc001twn.2 uc001twm.2)

ENST00000338101 ENST00000549189 ENST00000477584 ENST00000344089

Congresses - knowledge worth sharing:
European Congress of Clinical Microbiology and Infectious Diseases (ECCMID) 10 - 13 May 2014

miRNA Products:		QIAGEN Custom miScript Target Protector blocks miRNA-binding site of human, mouse, rat NOS1
		8/74 QIAGEN miScript miRNA Assays for microRNAs that regulate NOS1 (see all 74):
		hsa-miR-4254 hsa-miR-146a hsa-miR-15a hsa-miR-938 hsa-miR-371-5p hsa-miR-502-3p hsa-miR-149 hsa-miR-3116

		SwitchGear 3'UTR luciferase reporter plasmid: NOS1 3' UTR sequence

Inhib. RNA Products:		Browse for Gene Knock-down Tools from EMD Millipore
		OriGene RNAi products in human, mouse, rat for NOS1
		QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat NOS1

Clone Products:		OriGene clones in human, mouse for NOS1 (see all 7) OriGene ORF clones in mouse, rat for NOS1 OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
		GenScript: all cDNA clones in your preferred vector (see all 4): NOS1 (NM_000620)
		DNA2.0 Custom Codon Optimized Gene Synthesis Service for NOS1
		Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat NOS1
		Sirion Biotech Customized lentivirus for stable overexpression of NOS1 Customized lentivirus expression plasmids for stable overexpression of NOS1

Primer Products:		OriGene qSTAR qPCR primer pairs in human, mouse for NOS1
		SABiosciences RT² qPCR Primer Assay in human, mouse, rat NOS1
		QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat NOS1
		QIAGEN QuantiFast Probe-based Assays in human, mouse, rat NOS1

Additional mRNA sequence: AF446131.1

7 DOTS entries:

DT.209591 DT.430999 DT.40118528 DT.91668000 DT.121200078 DT.87046327 DT.91658756

24/49 AceView cDNA sequences (see all 49):

U17327 AI914145 BX105805 NM_000620 BE744153 BX115063 AJ004918 BC010126

AF446131 AI299150 AI793292 AA935529 AA923118 BF447723 BF433556 BE669690

AI302351 BM549127 BF095488 BI115269 CD609198 Z28891 AI791677 U31466

GeneLoc Exon Structure

(RNA expression data according to H-InvDB, NONCODE, miRBase, and RNAdb, Expression images according to data from BioGPS, Illumina Human BodyMap, and CGAP SAGE, Sets of similar genes according to GeneDecks, in vivo and in vitro expression data from LifeMap Discovery™, plus additional links to Genevestigator, and/or SOURCE, and/or BioGPS, and/or UniProtKB,
PCR Arrays from SABiosciences, Primers from OriGene, SABiosciences, and/or QIAGEN, In Situ Hybridization Assays from Advanced Cell Diagnostics)
About This Section

NOS1 expression in normal human tissues (normalized intensities) NOS1 embryonic expression: see
See probesets specificity/sensitivity at GeneAnnot
About this imageBioGPS <intensity>^2/3
CGAP TAG: ATGGGCTTCT

About this image

NOS1 expression in embryonic tissues and stem cells About this table

Data from LifeMap, the Embryonic Development and Stem Cells Database

5/15 selected tissues (see all 15) fully expand


Brain (Nervous System) fully expand to see all 28 entries
Mature Choroid Plexus Cells Choroid Plexus
Thalamus
Septum

Neural Tube (Nervous System) fully expand to see all 6 entries
Telencephalon
brain/midbrain/lateral wall

Lower Urinary Tract (Urinary System) fully expand to see all 2 entries
Ureter
visceral organ

Gut Tube (Gastrointestinal Tract) fully expand to see all 2 entries
Midgut

Skeletal Muscle (Muscoskeletal System)
gastrocnemius

See NOS1 Protein Expression from SPIRE MOPED and PaxDB
Genevestigator expression for NOS1

SOURCE GeneReport for Unigene clusters: Hs.654410 Hs.684465 Hs.684466 Hs.684467 Hs.735734

UniProtKB/Swiss-Prot: NOS1_HUMAN, P29475

Tissue specificity: Isoform 1 is ubiquitously expressed: detected in skeletal muscle and brain, also in testis,

lung and kidney, and at low levels in heart, adrenal gland and retina. Not detected in the platelets. Isoform 3

is expressed only in testis. Isoform 4 is detected in testis, skeletal muscle, lung, and kidney, at low levels in

the brain, but not in the heart and adrenal gland

SABiosciences Expression via Pathway-Focused PCR Arrays including NOS1:

Nitric Oxide Signaling Pathway in human mouse rat

Synaptic Plasticity in human mouse rat

Primer Products:		OriGene qSTAR qPCR primer pairs in human, mouse for NOS1
		SABiosciences RT² qPCR Primer Assay in human, mouse, rat NOS1
		QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat NOS1
		QIAGEN QuantiFast Probe-based Assays in human, mouse, rat NOS1

In Situ
Assay Products:

Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for NOS1

(Orthologs according to ^1,2HomoloGene (²older version, for species not in ¹newer version), ³euGenes, ⁴SGD , ⁵MGI Mar 06 2013, with possible further links to Flybase and/or WormBase, and/or ⁶Ensembl pan taxonomic compara , Gene Trees according to Ensembl and TreeFam)
About This Section

This gene was present in the common ancestor of animals and fungi.

Orthologs for NOS1 gene from 7/16 species (see all 16) About this table

Organism	Taxonomic classification	Gene	Description	Human Similarity	Orthology Type	Details
mouse (Mus musculus)	Mammalia	Nos1^{1 , 5}	nitric oxide synthase 1, neuronal^{1, 5}	87.05(n)¹ 94.05(a)¹		5 (57.29 cM)⁵ 18125¹ NM_008712.2¹ NP_032738.1¹ 117781032⁵
chicken (Gallus gallus)	Aves	NOS1¹	nitric oxide synthase 1 (neuronal)	79.98(n) 84.32(a)		427721 XM_425296.2 XP_425296.2
lizard (Anolis carolinensis)	Reptilia	NOS1⁶	nitric oxide synthase 1 (neuronal)	81(a)	1 ↔ 1	LGb(2413952-2463375)
African clawed frog (Xenopus laevis)	Amphibia	nos1-A²	neuronal nitric oxide synthase 1	76.45(n)		AF053935.2
zebrafish (Danio rerio)	Actinopterygii	nos1²	nitric oxide synthase 1 (neuronal)	74.9(n)		60658 AY211528.1
fruit fly (Drosophila melanogaster)	Insecta	Nos^{1 , 3}	imaginal disc development calmodulin binding³ Nitric oxide synthase¹	49(a)³ 53.9(n)¹ 48.33(a)¹		2 32B1³ 34495¹ NM_078817.3¹ NP_523541.2¹
baker's yeast (Saccharomyces cerevisiae)	Saccharomycetes	NCP1⁶	NADP-cytochrome P450 reductase; involved in ergost...	23(a)	1 → many	VIII(190543-192618)

ENSEMBL Gene Tree for NOS1 (if available)
TreeFam Gene Tree for NOS1 (if available)

(Paralogs according to ¹HomoloGene,
²Ensembl, and ³SIMAP, Pseudogenes according to ⁴Pseudogene.org Build 68)
About This Section

Paralogs for NOS1 gene

NOS3² POR² NOS2² MTRR²

2 SIMAP similar genes for NOS1 using alignment to 5 protein entries: NOS1_HUMAN (see all proteins):

NOS3 NOS2

NOS1 for paralogs About GeneDecksing

(SNPs/Variants according to the ¹NCBI SNP Database, ²Ensembl, ³PupaSUITE, ⁴UniProtKB, and DNA2.0, Linkage Disequilibrium by HapMap, Structural Variations(CNVs/InDels/Inversions) from the Database of Genomic Variants, Mutations from the Human Gene Mutation Database (HGMD) and the Locus Specific Mutation Databases (LSDB), Blood group antigen gene mutations by BGMUT, Resequencing Primers from QIAGEN, Cancer Mutation PCR Arrays and Assays and Copy Number PCR Arrays from SABiosciences)
About This Section

SNP ID	Valid	Clinical significance	Chr 12 pos	Sequence	#	AA Chg	Type	More	#	Allele freq	Pop	Total sample	More
Genomic Data					Transcription Related Data				Allele Frequencies
				--	--	--		--	--
rs149551400^1,2		--	114654634(+)	`TTCCCC/TTCCCC`	4	--	ds500¹		0	--	--	--	--
rs77934895^1,2	C,F	--	114654681(+)	`TCTTTT/CCCTCT`	4	--	ds500¹		1		EA	120
rs73206086^1,2	C,F	--	114654699(+)	`CTTTCC/TCTCCT`	4	--	ds500¹		1		NA	120
rs187869116^1,2		--	114654871(+)	`CCTCCC/TCTCTC`	4	--	ds500¹		0	--	--	--	--
rs56055739^1,2	C	--	114655039(+)	`TCTGGA/GGCACC`	4	--	ds500¹		0	--	--	--	--
rs71444610^1,2	C	--	114655364(+)	`ACAGC-/GT/GTG TGTGTGTGTGTGTG`	8	--	ut3¹ cds¹		1		NA	2
rs66886445^1,2	C	--	114655365(+)	`CAGCG-/GT/GTGTG TGTGTGTGTGTTGTGT`	8	--	ut3¹		0	--	--	--	--
rs58714999^1,2	C	--	114655395(+)	`GTGTG-/TGT/TGTGT/TGTGTGTGT GTGT/TGTGTGTGTGTGTGTGGTGAG`	16	--	cds¹ ut3¹		0	--	--	--	--
rs191867506^1,2		--	114655723(+)	`ACAGGG/TTCTCA`	4	--	ut3¹		0	--	--	--	--
rs7308150^1,2	C,F,A	--	114655764(+)	`CATCTC/TGGCTC`	4	--	ut3¹		2		WA CSA	4

HapMap Linkage Disequilibrium report for NOS1 (117645947 - 117889975 bp)

Structural Variations
Database of Genomic Variants (DGV) 7 variations for NOS1: About this table

Variant ID	Type	Subtype	PubMed ID
esv2746436	CNV	Deletion	23290073
esv2746435	CNV	Deletion	23290073
nsv901	CNV	Insertion	18451855
nsv509478	CNV	Insertion	20534489
nsv832526	CNV	Loss	17160897
nsv53465	CNV	Loss	16902084
nsv510592	CNV	Loss	20534489

Human Gene Mutation Database (HGMD): NOS1

Locus Specific Mutation Databases (LSDB): NOS1

1 SABiosciences Cancer Mutation PCR Assay for NOS1:

Cosmic Id	AA Change
110337	p.S771L

QIAGEN SeqTarget long-range PCR primers in human, mouse, rat for resequencing NOS1

DNA2.0 Custom Variant and Variant Library Synthesis for NOS1

(in which this Gene is Involved, According to MalaCards, OMIM, UniProtKB, the University of Copenhagen DISEASES database, Conferences by KenesGroup, Novoseek, Genatlas, GeneTests, GAD, HuGE Navigator, and/or TGDB.)
About This Section

OMIM gene information: 163731 OMIM disorders: --

20/158 diseases for NOS1 (see all 158): About MalaCards

pyloric stenosis hypertrophic pyloric stenosis factitious disorder achalasia

intestinal perforation sepiapterin reductase deficiency cerebral hypoxia psychotic disorder

mood disorder impotence gastroparesis schizoaffective disorder

childhood-onset schizophrenia neuronitis scoliosis gastroschisis

brain injury brain ischemia hyperphenylalaninemia tetrahydrobiopterin deficiency

1 disease from the University of Copenhagen DISEASES database for NOS1:

Vascular disease

NOS1 for disorders About GeneDecksing

Congresses - knowledge worth sharing:
Alzheimer's & Parkinson's Diseases Congress (ADPD) 18 - 22 March 2015

10/92 Novoseek inferred disease relationships for NOS1 gene (see all 92) About this table

Disease	-log (P-Val)	Hits	PubMed IDs for Articles with Shared Sentences (# sentences)
pyloric stenosis	59	21	11283889 (3), 14757827 (2), 9354728 (1), 15361336 (1) (see all 14)
diabetic gastroparesis	54	6	12768383 (1), 17161551 (1), 17160518 (1), 20185690 (1) (see all 5)
muscular dystrophy duchenne	51.2	20	17313973 (2), 11745948 (2), 9536265 (1), 9398448 (1) (see all 16)
pyloric stenosis, infantile	50.5	4	8571963 (2)
neurodegenerative diseases	49.3	23	7523410 (2), 19268602 (1), 20337441 (1), 9847056 (1) (see all 13)
erectile dysfunction	47.9	4	9284206 (1), 9631946 (1), 7588327 (1), 8562693 (1)
schizophrenia	45.5	85	19513863 (6), 12140778 (4), 19200422 (4), 18544180 (3) (see all 46)
brain ischemia	43.5	3	16141535 (1), 10320673 (1)
schizoaffective disorder	42.7	12	9988837 (1), 17665305 (1), 8483645 (1), 17267179 (1) (see all 11)
neurodegeneration	41.9	15	15579064 (1), 16095570 (1), 16179512 (1), 18805011 (1) (see all 11)

Genetic Association Database (GAD): NOS1
Human Genome Epidemiology (HuGE) Navigator: NOS1 (103 documents)

Export disorders for NOS1 gene to outside databases

(in PubMed. Associations of this gene to articles via ¹Entrez Gene, ²UniProtKB/Swiss-Prot, ³HGNC, ⁴GAD, ⁵PharmGKB, ⁶HMDB, ⁷DrugBank, ⁸UniProtKB/TrEMBL, ⁹ Novoseek, and/or ¹⁰fRNAdb)
About This Section

PubMed articles for NOS1 gene, integrated from 9 sources (see all 1616):
(articles sorted by number of sources associating them with NOS1)

Utopia: connect your pdf to the dynamic
world of online information

Genetic association analysis of functional polymorphi sms in neuronal nitric oxide synthase 1 gene (NOS1) and mood disorders and fluv oxamine response in major depressive disorder in the Japanese population. (PubMed id 20016223)^{1, 4, 9} Okumura T....Iwata N. (2010)
Nasal nitric oxide levels in cystic fibrosis patients are associated with a neuronal NO synthase (NOS1) gene polymorphism. (PubMed id 11890749)^{1, 4, 9} Grasemann H....Ratjen F. (2002)
Variants in the neuronal nitric oxide synthase (nNOS, NOS1) gene are associated with restless legs syndrome. (PubMed id 18058820)^{1, 4, 9} Winkelmann J....Muller-Myhsok B. (2008)
Single-nucleotide promoter polymorphism alters transcription of neuronal nitric oxide synthase exon 1c in infantile hypertrophic pyloric stenosis. (PubMed id 14757827)^{1, 4, 9} Saur D....Allescher H.-D. (2004)
Expression of two types of nitric oxide synthase mRNA in human neuroblastoma cell lines. (PubMed id 7515942)^{1, 2, 9} Fujisawa H....Esumi H. (1994)
Association between achalasia and nitric oxide synthase gene polymorphisms. (PubMed id 16848803)^{1, 4, 9} Mearin F....Lanas A. (2006)
Effects of sex and of gene variants in constitutive nitric oxide synthases on exhaled nitric oxide. (PubMed id 12531780)^{1, 4, 9} Grasemann H....Ratjen F. (2003)
Allelic association of the neuronal nitric oxide synthase (NOS1) gene with schizophrenia. (PubMed id 12140778)^{1, 4, 9} Shinkai T....Nakamura J. (2002)
Influence of NOS1 on verbal intelligence and working memory in both patients with schizophrenia and healthy control subjects. (PubMed id 19805695)^{1, 4, 9} Donohoe G....Corvin A. (2009)
Environmental exposures, nitric oxide synthase genes, and exhaled nitric oxide in asthmatic children. (PubMed id 19603529)^{1, 4, 9} Spanier A.J....Lanphear B.P. (2009)

(in PubMed, OMIM, and NCBI Bookshelf)
About This Section

		AND	OR
Aliases
Disorders
Free Text

Query String		PubMed OMIM NCBI Bookshelf
	(Note: In FireFox, select the above section and copy using Ctrl-C)

(According to Entrez Gene, HGNC, AceView, euGenes, Ensembl, miRBase, ECgene, Kegg, and/or H-InvDB)
About This Section

Entrez Gene: 4842	HGNC: 7872	AceView: NOS1	Ensembl:ENSG00000089250	euGenes: HUgn4842
ECgene: NOS1	Kegg: 4842	H-InvDB: NOS1

(According to HUGE)
About This Section

(According to PharmGKB, ATLAS, HORDE, IMGT, LEIDEN, UniProtKB/Swiss-Prot, and/or UniProtKB/TrEMBL,
Wikipedia and/or GeneReviews via UniProtKB/Swiss-Prot)
About This Section

Name	Description
PharmGKB entry for NOS1	Pharmacogenomics, SNPs, Pathways
NIEHS-SNPs	http://egp.gs.washington.edu/data/nos1/
Wikipedia	http://en.wikipedia.org/wiki/Nitric_oxide_synthase

Intellectual Property for NOS1 gene
(Patent information from GeneIP, Licensable technologies from WIS Yeda, Salk, Tufts, IP news from LifeMap Sciences, Inc.)

About This Section

Patent Information for NOS1 gene:
Search GeneIP for patents involving NOS1

GeneCards and IP:
Japan Patent Office Licenses GeneCards European Patent Office Licenses GeneCards Improving the IP Search

(Antibodies, recombinant proteins, and assays from EMD Millipore, R&D Systems, OriGene, QIAGEN, GenScript, Cell Signaling Technology, SABiosciences, Novus Biologicals, Sino Biological, Enzo Life Sciences, Abcam, ProSpec, Cloud-Clone Corp., Thermo Fisher Scientific, LSBio, Gene Editing from DNA2.0 and Sirion Biotech, Clones from EMD Millipore, OriGene, GenScript, Sino Biological, DNA2.0, SwitchGear Genomics, Vector BioLabs, Sirion Biotech, Cell lines from GenScript, and LifeMap BioReagents, PCR Arrays from SABiosciences, Drugs and/or compounds from EMD Millipore, Tocris Bioscience, and/or Enzo Life Sciences, In Situ Hybridization Assays from
Advanced Cell Diagnostics, Animal models from inGenious Targeting Laboratory, genOway)
About This Section

	Browse Clones for the Expression of Recombinant Proteins Available from EMD Millipore
	Browse for Gene Knock-down Tools from EMD Millipore
	Browse Kits and Assays available from EMD Millipore
	Browse Purified and Recombinant Proteins at EMD Millipore
	EMD Millipore small molecules (inhibitor) for NOS1
	EMD Millipore Mono- and Polyclonal Antibodies for the study of NOS1

	EMD Millipore Custom Antibody & Bulk Services
	EMD Millipore Preclinical / Clinical Development Services
	EMD Millipore Immunoassay Services
	EMD Millipore Target Screening & Profiling Services

	Antibodies for NOS1 (nNOS)		Browse Cell Culture Products
	Browse ELISAs		Browse Flow Cytometry Kits
	Browse Primer Pairs		Browse Kinase Activity Assays/Reagents
	Browse ELISpot Kits/Development Modules		Browse TFB/Immunoprecipitation Assays
	Browse Apoptosis Detection Kits/Reagents		Browse Ubiquitin Proteasome Pathway (UPP) Assay Kits/Reagents
	Browse DNA Damage/Repair Kits/Reagents		Browse Multiplex/Array Assay Kits/Reagents
	Browse Cell Selection/Detection Kits/Reagents		Browse Secondary Antibodies/Controls/Staining Reagents
	Browse Protease Activity Assays and Reagents		Browse Recombinant/Natural Proteins
	Browse Stem Cell Products		Browse Tocris Biochemicals & Compounds
	Browse cDNA Clones		Browse Proteome Profiler Antibody Arrays

	OriGene Antibodies for NOS1		OriGene RNAi products in human, mouse, rat for NOS1
	Browse OriGene qPCR primer pairs and template standards		OriGene Protein Over-expression Lysate for NOS1
	OriGene MassSpec something-or-other for NOS1		OriGene clones in human, mouse for NOS1
	OriGene qSTAR qPCR primer pairs in human, mouse for NOS1		OriGene Purified Protein for NOS1
	OriGene ORF clones in mouse, rat for NOS1		OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
	OriGene Custom Antibody Services for NOS1		OriGene Custom Protein Services for NOS1

	QIAGEN Custom miScript Target Protector blocks miRNA-binding site of in human, mouse, rat NOS1
	QIAGEN SeqTarget long-range PCR primers in human, mouse, rat for resequencing NOS1
	QIAGEN PyroMark CpG Assay predesigned Pyrosequencing DNA Methylation assays in human, mouse, rat NOS1
	QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat NOS1
	QIAGEN QuantiFast Probe-based Assays in human, mouse, rat NOS1
	QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat NOS1

	GenScript Custom Purified and Recombinant Proteins Services for NOS1		GenScript cDNA clones with any tag delivered in your preferred vector for NOS1
	GenScript Custom Assay Services for NOS1		GenScript Custom Superior Antibodies Services for NOS1
	GenScript Custom overexpressing Cell Line Services for NOS1		CloneReady with Over 120,000 Genes
	Gene Synthesis: Any Gene in Any Vector		Vector-based siRNA and miRNA, Ready for Transfection
	Gene Mutant Library, Variants up to 10^11		Plasmid Preparation
	Custom Peptide Services

Antibodies & Assays for NOS1 (nNOS)

	Regulatory tfbs in NOS1 promoter
	Search Chromatin IP Primers for NOS1
	RT² qPCR Primer Assay in human, mouse, rat NOS1
	GNC Network for NOS1
	SABiosciences PCR Arrays including human, mouse, rat NOS1

Tocris compounds for NOS1

	Browse Sino Biological Proteins and Antibodies
	Browse Sino Biological Cell Lysates
	Browse Sino Biological cDNA Clones
	4000+ Proteins
	Search Sino Biological for antibodies, proteins & pathways
	Protein Production Services
	Transfection Reagents
	Protein A/G/L resins
	Isotyping reagents

	Assays/Drugs/Proteins for NOS1
	Search www.enzolifesciences.com for proteins, assays, substrates, inhibitors & antibodies

	Novus Tissue Slides
	NOS1 antibodies
	NOS1 proteins
	NOS1 lysates

	Antibodies for NOS1
	See all of Abcam's Antibodies, Kits and Proteins for NOS1
	Custom Antibody / Protein Production Service
	Bulk Purchasing
	Advantages of Rabbit Monoclonal antibodies
	Abcam protocols and scientific support

Browse ProSpec Recombinant Proteins

	Proteins for NOS1
	Antibodies for NOS1
	ELISAs for NOS1
	CLIAs for NOS1

Search LifeMap BioReagents cell lines for NOS1

	Gene Synthesis
	Protein Engineering
	Variant Library Synthesis
	Codon Optimization
	Protein Production and Purification

Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for NOS1

	SwitchGear 3'UTR luciferase reporter plasmids for NOS1
	SwitchGear Promoter luciferase reporter plasmids for NOS1

ThermoFisher Antibody for NOS1

Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat NOS1

	inGenious Targeting Laboratory - Custom generated mouse model solutions for NOS1
	inGenious Targeting Laboratory - Custom generated inducible mouse model solutions for NOS1

Customized:

	lentivirus for stable overexpression of NOS1
	lentivirus expression plasmids for stable overexpression of NOS1
	adenovirus for overexpression of NOS1

LSBio Antibodies in human, mouse, rat for NOS1

Customized transgenic rodents for:

	Humanization
	Biomarker expression
	Off-target effect monitoring
	Translational medicine
	Tissue-specific gene expresssion
	Time-controlled gene expresssion

GeneCards Homepage - Last full update: 23 Oct 2013 - Incrementals: 3 Nov 2013 , 7 Nov 2013 , 23 Jan 2014

View Random Gene

Category			TGFB1 (GIFtS: 73) transforming growth factor, beta 1
GIFtS Group

The GeneCards human gene database gene index: 1 3 5 6 A B C D E F G H I J K L M N O P Q R S T U V W X Y Z

The GeneCards Human Gene Database

Developed at the Crown Human Genome Center, Department of Molecular Genetics, the Weizmann Institute of Science

Hot genes Disease genes NOS1 gene at Home site.

hostname: 356977-web1.xennexinc.com index build: 106 solr: 1.4

Advanced Search

Export list of displayed genes

NOS1 Gene

Nitric Oxide Synthase 1 (Neuronal)

Aliases
for NOS1 gene

Summaries
for NOS1 gene

Genomic Views
for NOS1 gene

Proteins
for NOS1 gene

Protein Domains /
Families
for NOS1 gene

Function
for NOS1 gene

Pathways & Interactions
for NOS1 gene

Drugs & Compounds
for NOS1 gene

Transcripts
for NOS1 gene

Expression
for NOS1 gene

Orthologs
for NOS1 gene

Paralogs
for NOS1 gene

Genomic Variants
for NOS1 gene

Disorders / Diseases
for NOS1 gene

Publications
for NOS1 gene

External Searches for NOS1 gene

Genome Databases showing NOS1 gene

Other Databases showing NOS1 gene

Specialized Databases showing NOS1 gene

Intellectual Property
for NOS1 gene

Products
for NOS1 gene

View Random Gene

Limb girdle
Dementia
Astrocytosis
Hyperphenylalaninemia
Scoliosis idiopathic
Acute myocardial infarction
Schizoaffective Disorder
Colitis Ulcerative
allergy
Atherosclerosis
Ischemia
Breast Cancer
NSCLC
PYLORIC STENOSIS, INFANTILE
Schizophrenia
Brain Ischemia
Asthma
Adenocarcinoma
Hyperalgesia
cell damage
disability
Cancer
Obstruction
Mood Disorders
Cardiomyopathy
Carcinoma Non-Small Cell Lung
Pathological Processes
MUSCLE DEGENERATION
motility disorder
Epilepsy
Muscular Dystrophy Becker
Inflammation
AFFECTIVE DISORDER MAJOR
Muscular Dystrophy Duchenne
Pyloric Stenosis
immunodeficiency
Anemia
Hypertrophy
Neuroepithelioma
bipolar schizoaffective disorders
Bipolar Disorder
Renal Failure
Pneumonia
Impotence
Tumors
Depressive disorder
Metastasis
OCULAR DOMINANCE
Necrosis
achalasia
Asthma allergic
virus infection
Psychosis Brief Reactive
Preeclampsia
Huntington Disease
major depression
Neurodegenerative Diseases
Melanoma
ATYPICAL PSYCHOSIS
Neurological Disorders
Parkinson Disease
Affective psychosis
Hyperplasia
Muscular Dystrophies
Hirschsprung Disease
Hepatic Encephalopathy
Bacterial Infections
Carcinoma
INFARCT
Alzheimers Disease
Erectile Dysfunction
Heart Failure Congestive
Mood Disorders Psychotic
neurodegeneration
Myopathy
DIABETIC GASTROPARESIS
Amyotrophic Lateral Sclerosis
Cancer Lung
Ischemic Brain Injury
Influenza
Myocardial Infarction
Coronary Artery Disease
Adenoma
stasis
Bleeding
Cerebral Hypoxia
Cerebral Vasospasm
OBESITY
Disruptive Behavior Disorder
Cerebral Ischemia
Brain Diseases
Psychotic

Advanced Search

Export list of displayed genes

NOS1 Gene

Nitric Oxide Synthase 1 (Neuronal)

Aliasesfor NOS1 gene

Summariesfor NOS1 gene

Genomic Viewsfor NOS1 gene

Proteinsfor NOS1 gene

Protein Domains /Familiesfor NOS1 gene

Functionfor NOS1 gene

Pathways & Interactionsfor NOS1 gene

Drugs & Compoundsfor NOS1 gene

Transcriptsfor NOS1 gene

Expression for NOS1 gene

Orthologsfor NOS1 gene

Paralogsfor NOS1 gene

Genomic Variantsfor NOS1 gene

Disorders / Diseasesfor NOS1 gene

Publicationsfor NOS1 gene

External Searches for NOS1 gene

Genome Databases showing NOS1 gene

Other Databases showing NOS1 gene

Specialized Databases showing NOS1 gene

Intellectual Propertyfor NOS1 gene

Productsfor NOS1 gene

View Random Gene

Aliases
for NOS1 gene

Summaries
for NOS1 gene

Genomic Views
for NOS1 gene

Proteins
for NOS1 gene

Protein Domains /
Families
for NOS1 gene

Function
for NOS1 gene

Pathways & Interactions
for NOS1 gene

Drugs & Compounds
for NOS1 gene

Transcripts
for NOS1 gene

Expression
for NOS1 gene

Orthologs
for NOS1 gene

Paralogs
for NOS1 gene

Genomic Variants
for NOS1 gene

Disorders / Diseases
for NOS1 gene

Publications
for NOS1 gene

Intellectual Property
for NOS1 gene

Products
for NOS1 gene