Free for academic non-profit institutions. Other users need a Commercial license

Aliases for NECAB2 Gene

Aliases for NECAB2 Gene

  • N-Terminal EF-Hand Calcium Binding Protein 2 2 3 5
  • Synaptotagmin-Interacting Protein 2 3 4
  • Neuronal Calcium-Binding Protein 2 3 4
  • EF-Hand Calcium-Binding Protein 2 3 4
  • Stip-2 3 4
  • EFCBP2 3 4
  • N-Terminal EF-Hand Calcium-Binding Protein 2 3
  • EF-Hand Calcium Binding Protein 2 2
  • Neuronal Calcium Binding 2 3

External Ids for NECAB2 Gene

Previous HGNC Symbols for NECAB2 Gene

  • EFCBP2

Previous GeneCards Identifiers for NECAB2 Gene

  • GC16P083744
  • GC16P082560
  • GC16P069754

Summaries for NECAB2 Gene

Entrez Gene Summary for NECAB2 Gene

  • The protein encoded by this gene is a neuronal calcium-binding protein that binds to and modulates the function of at least two receptors, adenosine A(2A) receptor and metabotropic glutamate receptor type 5. [provided by RefSeq, Jul 2016]

GeneCards Summary for NECAB2 Gene

NECAB2 (N-Terminal EF-Hand Calcium Binding Protein 2) is a Protein Coding gene. GO annotations related to this gene include calcium ion binding. An important paralog of this gene is NECAB1.

Gene Wiki entry for NECAB2 Gene

No data available for UniProtKB/Swiss-Prot , Tocris Summary , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for NECAB2 Gene

Genomics for NECAB2 Gene

Regulatory Elements for NECAB2 Gene

Enhancers for NECAB2 Gene
GeneHancer Identifier Enhancer Score Enhancer Sources Gene-Enhancer Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor Binding Sites within enhancer Gene Targets for Enhancer
- Elite enhancer/Elite enhancer-gene association

Enhancers around NECAB2 on UCSC Golden Path with GeneCards custom track

Genomic Location for NECAB2 Gene

83,965,185 bp from pter
84,002,776 bp from pter
37,592 bases
Plus strand

Genomic View for NECAB2 Gene

Genes around NECAB2 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
NECAB2 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for NECAB2 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for NECAB2 Gene

Proteins for NECAB2 Gene

  • Protein details for NECAB2 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Recommended name:
    N-terminal EF-hand calcium-binding protein 2
    Protein Accession:
    Secondary Accessions:
    • A2RRG3
    • O75547
    • Q6ZSK0

    Protein attributes for NECAB2 Gene

    386 amino acids
    Molecular mass:
    43194 Da
    Quaternary structure:
    No Data Available
    • Sequence=AAI31616.1; Type=Erroneous initiation; Evidence={ECO:0000305}; Sequence=BAC86948.1; Type=Erroneous initiation; Evidence={ECO:0000305};

neXtProt entry for NECAB2 Gene

Post-translational modifications for NECAB2 Gene

  • Modification sites at PhosphoSitePlus
  • Modification sites at neXtProt

Other Protein References for NECAB2 Gene

No data available for DME Specific Peptides for NECAB2 Gene

Domains & Families for NECAB2 Gene

Suggested Antigen Peptide Sequences for NECAB2 Gene

GenScript: Design optimal peptide antigens:

Graphical View of Domain Structure for InterPro Entry



  • Contains 1 ABM domain.
  • Contains 1 ABM domain.
  • Contains 2 EF-hand domains.
genes like me logo Genes that share domains with NECAB2: view

Function for NECAB2 Gene

Gene Ontology (GO) - Molecular Function for NECAB2 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005509 calcium ion binding IEA --
GO:0005515 protein binding IPI 17689978
genes like me logo Genes that share ontologies with NECAB2: view
genes like me logo Genes that share phenotypes with NECAB2: view

Animal Model Products

CRISPR Products

Inhibitory RNA Products

Clone Products

Flow Cytometry Products

No data available for Molecular function , Enzyme Numbers (IUBMB) , Human Phenotype Ontology , Animal Models , miRNA , Transcription Factor Targets and HOMER Transcription for NECAB2 Gene

Localization for NECAB2 Gene

Subcellular locations from UniProtKB/Swiss-Prot for NECAB2 Gene


Subcellular locations from

Jensen Localization Image for NECAB2 Gene COMPARTMENTS Subcellular localization image for NECAB2 gene
Compartment Confidence
cytosol 2
mitochondrion 2
nucleus 2
lysosome 1
vacuole 1

Gene Ontology (GO) - Cellular Components for NECAB2 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005737 cytoplasm IEA --
genes like me logo Genes that share ontologies with NECAB2: view

Pathways & Interactions for NECAB2 Gene

SuperPathways for NECAB2 Gene

No Data Available

Gene Ontology (GO) - Biological Process for NECAB2 Gene


No data available for Pathways by source and SIGNOR curated interactions for NECAB2 Gene

Drugs & Compounds for NECAB2 Gene

No Compound Related Data Available

Transcripts for NECAB2 Gene

Unigene Clusters for NECAB2 Gene

N-terminal EF-hand calcium binding protein 2:
Representative Sequences:

CRISPR Products

Inhibitory RNA Products

Clone Products

Flow Cytometry Products

Alternative Splicing Database (ASD) splice patterns (SP) for NECAB2 Gene

No ASD Table

Relevant External Links for NECAB2 Gene

GeneLoc Exon Structure for
ECgene alternative splicing isoforms for

Expression for NECAB2 Gene

mRNA expression in normal human tissues for NECAB2 Gene

mRNA expression in embryonic tissues and stem cells from LifeMap Discovery

mRNA differential expression in normal tissues according to GTEx for NECAB2 Gene

This gene is overexpressed in Brain - Nucleus accumbens (basal ganglia) (x7.9), Brain - Amygdala (x7.0), Brain - Caudate (basal ganglia) (x6.5), Brain - Putamen (basal ganglia) (x5.7), Brain - Anterior cingulate cortex (BA24) (x4.9), and Brain - Hypothalamus (x4.1).

Protein differential expression in normal tissues from HIPED for NECAB2 Gene

This gene is overexpressed in Fetal Brain (24.4), Brain (21.2), and Frontal cortex (7.3).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, PaxDb, and MOPED for NECAB2 Gene

NURSA nuclear receptor signaling pathways regulating expression of NECAB2 Gene:


SOURCE GeneReport for Unigene cluster for NECAB2 Gene:


mRNA Expression by UniProt/SwissProt for NECAB2 Gene:

Tissue specificity: Expressed in brain.
genes like me logo Genes that share expression patterns with NECAB2: view

Primer Products

No data available for Protein tissue co-expression partners for NECAB2 Gene

Orthologs for NECAB2 Gene

This gene was present in the common ancestor of chordates.

Orthologs for NECAB2 Gene

Organism Taxonomy Gene Similarity Type Details
(Bos Taurus)
Mammalia NECAB2 34
  • 85.77 (n)
  • 85.77 (a)
  • 85 (a)
(Canis familiaris)
Mammalia NECAB2 34
  • 84.23 (n)
  • 83.33 (a)
(Mus musculus)
Mammalia Necab2 34
  • 83.68 (n)
  • 85.49 (a)
Necab2 16
Necab2 35
  • 75 (a)
(Pan troglodytes)
Mammalia NECAB2 34
  • 98.53 (n)
  • 98.45 (a)
  • 97 (a)
(Rattus norvegicus)
Mammalia Necab2 34
  • 81.85 (n)
  • 82.52 (a)
(Monodelphis domestica)
Mammalia NECAB2 35
  • 66 (a)
(Ornithorhynchus anatinus)
Mammalia NECAB2 35
  • 60 (a)
(Gallus gallus)
Aves NECAB2 34
  • 71.87 (n)
  • 66.15 (a)
  • 58 (a)
(Anolis carolinensis)
Reptilia NECAB2 35
  • 85 (a)
tropical clawed frog
(Silurana tropicalis)
Amphibia LOC101731915 34
  • 70.85 (n)
  • 69.85 (a)
(Danio rerio)
Actinopterygii necab2 34
  • 67.86 (n)
  • 66.82 (a)
necab2 35
  • 50 (a)
Species where no ortholog for NECAB2 was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • fruit fly (Drosophila melanogaster)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea squirt (Ciona intestinalis)
  • sea squirt (Ciona savignyi)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)
  • worm (Caenorhabditis elegans)

Evolution for NECAB2 Gene

Gene Tree for NECAB2 (if available)
Gene Tree for NECAB2 (if available)

Paralogs for NECAB2 Gene

Paralogs for NECAB2 Gene

(2) SIMAP similar genes for NECAB2 Gene using alignment to 5 proteins:

genes like me logo Genes that share paralogs with NECAB2: view

Variants for NECAB2 Gene

Sequence variations from dbSNP and Humsavar for NECAB2 Gene

SNP ID Clin Chr 16 pos Sequence Context AA Info Type
rs2292323 - 83,994,402(+) AACAA(A/G)GCAAG reference, missense
rs2292324 - 83,994,409(+) CAAGA(C/G)CCTTC reference, missense
rs2292329 - 83,998,279(+) CGCCA(C/G)TATCT reference, missense
rs2271298 - 84,001,841(+) GCCCC(C/G)TGTGT reference, missense
rs3215187 -- 84,001,666(+) CTCCC(-/TGGGCACCCCCTCACCTTCC)CACAA intron-variant

Structural Variations from Database of Genomic Variants (DGV) for NECAB2 Gene

Variant ID Type Subtype PubMed ID
dgv3056n100 CNV loss 25217958
dgv357n27 CNV loss 19166990
dgv5259n54 CNV loss 21841781
dgv5260n54 CNV loss 21841781
esv28321 CNV loss 19812545
esv3572242 CNV gain 25503493
esv3639405 CNV loss 21293372
nsv1065790 CNV loss 25217958
nsv1067050 CNV loss 25217958
nsv1070361 CNV deletion 25765185
nsv1126437 CNV deletion 24896259
nsv1136220 CNV deletion 24896259
nsv457591 CNV loss 19166990
nsv457594 CNV loss 19166990
nsv471106 CNV gain 18288195
nsv517566 CNV gain+loss 19592680
nsv528396 CNV loss 19592680
nsv573409 CNV loss 21841781
nsv573413 CNV loss 21841781
nsv573415 CNV loss 21841781
nsv573417 CNV loss 21841781
nsv573418 CNV loss 21841781
nsv827780 CNV loss 20364138

Variation tolerance for NECAB2 Gene

Residual Variation Intolerance Score: 31.3% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 10.05; 90.12% of all genes are more intolerant (likely to be disease-causing)

Relevant External Links for NECAB2 Gene

SNPedia medical, phenotypic, and genealogical associations of SNPs for

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for NECAB2 Gene

Disorders for NECAB2 Gene

Relevant External Links for NECAB2

Genetic Association Database (GAD)
Human Genome Epidemiology (HuGE) Navigator
Atlas of Genetics and Cytogenetics in Oncology and Haematology:

No disorders were found for NECAB2 Gene.

No data available for MalaCards , UniProtKB/Swiss-Prot and Genatlas for NECAB2 Gene

Publications for NECAB2 Gene

  1. NECABs: a family of neuronal Ca(2+)-binding proteins with an unusual domain structure and a restricted expression pattern. (PMID: 12044471) Sugita S. … Suedhof T.C. (Neuroscience 2002) 2 3 4 65
  2. Personalized smoking cessation: interactions between nicotine dose, dependence and quit-success genotype score. (PMID: 20379614) Rose J.E. … Uhl G.R. (Mol. Med. 2010) 3 46 65
  3. Molecular genetics of successful smoking cessation: convergent genome-wide association study results. (PMID: 18519826) Uhl G.R. … Lerman C. (Arch. Gen. Psychiatry 2008) 3 46 65
  4. Complete sequencing and characterization of 21,243 full-length human cDNAs. (PMID: 14702039) Ota T. … Sugano S. (Nat. Genet. 2004) 3 4 65
  5. The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). (PMID: 15489334) Gerhard D.S. … Malek J. (Genome Res. 2004) 3 4 65

Products for NECAB2 Gene

Sources for NECAB2 Gene

Loading form....