Free for academic non-profit institutions. Other users need a Commercial license

Aliases for MYCNOS Gene

Subcategory (RNA class) for MYCNOS Gene

non-coding RNA

Quality Score for this RNA gene is


Aliases for MYCNOS Gene

  • MYCN Opposite Strand 2 3 5
  • MYCN Opposite Strand/Antisense RNA (Non-Protein Coding) 2 3
  • N-Myc Opposite Strand 3 4
  • MYCN Antisense RNA 1 2 3
  • NCYM 3 4
  • V-Myc Myelocytomatosis Viral Related Oncogene, Neuroblastoma Derived (Avian) Opposite Strand 2
  • V-Myc Myelocytomatosis Viral Related Oncogene, Neuroblastoma Derived Opposite Strand 3
  • DNA-Binding Transcriptional Activator NCYM 3
  • DNA Binding Transcriptional Activator 2
  • MYCN Opposite Strand/Antisense RNA 2
  • N-Cym Protein 3
  • MYCN-AS1 3
  • N-CYM 3
  • NYCM 3
  • CYMN 4

External Ids for MYCNOS Gene

Previous GeneCards Identifiers for MYCNOS Gene

  • GC02M016101
  • GC02M016026
  • GC02U900920
  • GC02M015998
  • GC02M016061

Summaries for MYCNOS Gene

Entrez Gene Summary for MYCNOS Gene

  • This gene is transcribed in antisense to the v-myc avian myelocytomatosis viral oncogene neuroblastoma derived homolog gene (MYCN). It is thought to encode a small, novel protein that stabilizes MYCN, prevents apoptosis, and promotes cell proliferation. Transcripts at this locus may also act directly as functional RNAs to recruit transcriptional regulators to the promoter of MYCN and stimulate transcription of this oncogene. This gene therefore functions through both RNA and protein products. [provided by RefSeq, Aug 2016]

GeneCards Summary for MYCNOS Gene

MYCNOS (MYCN Opposite Strand) is an RNA Gene, and is affiliated with the non-coding RNA class. Diseases associated with MYCNOS include Neuroblastoma and Autonomic Nervous System Neoplasm.

UniProtKB/Swiss-Prot for MYCNOS Gene

  • Regulates stability of MYCN in neuroblastoma cells by inhibiting GSK3B-mediated MYCN phosphorylation. Inhibits GSK3B activity by promoting its phosphorylation at Ser-9 (PubMed:24391509).

No data available for CIViC summary , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for MYCNOS Gene

Genomics for MYCNOS Gene

Regulatory Elements for MYCNOS Gene

Enhancers for MYCNOS Gene
GeneHancer Identifier Enhancer Score Enhancer Sources Gene-Enhancer Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor Binding Sites within enhancer Gene Targets for Enhancer
GH02G015911 1.3 FANTOM5 Ensembl ENCODE 12 +29.3 29316 1.4 TBP ESRRA JUN MAX RFX5 ZNF664 E2F1 GATA3 FOSL2 PRDM10 MYCN MYCNOS RN7SL104P NBAS ENSG00000238371 MYCNUT
GH02G015964 1.1 Ensembl ENCODE dbSUPER 11.9 -23.7 -23661 0.9 RFX1 RBBP5 CHD7 REST RAD21 POLR2A HDAC2 ZSCAN29 ZNF652 EZH2 MYCN MYCNOS RN7SL104P GACAT3
GH02G015982 0.6 FANTOM5 11.6 -41.0 -40982 0.7 GATA3 SMARCA4 ATF2 MYCN RN7SL104P MYCNOS NBAS GACAT3
GH02G015984 0.5 FANTOM5 11.6 -42.7 -42728 0.1 MXI1 RFX1 EP300 NBAS MYCN RN7SL104P MYCNOS DDX1 GACAT3
- Elite enhancer and/or Elite enhancer-gene association Download GeneHancer data dump

Enhancers around MYCNOS on UCSC Golden Path with GeneCards custom track

Promoters for MYCNOS Gene
Ensembl Regulatory Elements (ENSRs) TSS Distance (bp) Size (bp) Binding Sites for Transcription Factors within promoters
ENSR00000289888 -477 1601 CTCF MXI1 RAD21 ZFHX2 GLIS2 POLR2A PATZ1 PRDM10 EZH2 RNF2
ENSR00000289887 1123 801 CTCF MXI1 MAX RBBP5 ZNF2 E2F1 GLIS2 POLR2A PATZ1 EZH2

Genomic Location for MYCNOS Gene

15,936,265 bp from pter
15,941,723 bp from pter
5,459 bases
Minus strand

Genomic View for MYCNOS Gene

Genes around MYCNOS on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
MYCNOS Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for MYCNOS Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for MYCNOS Gene

Proteins for MYCNOS Gene

  • Protein details for MYCNOS Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Recommended name:
    N-cym protein
    Protein Accession:
    Secondary Accessions:
    • Q53TD4

    Protein attributes for MYCNOS Gene

    109 amino acids
    Molecular mass:
    11733 Da
    Quaternary structure:
    • Interacts with MYCN and GSK3B.

neXtProt entry for MYCNOS Gene

Post-translational modifications for MYCNOS Gene

No Post-translational modifications

Other Protein References for MYCNOS Gene

ENSEMBL proteins:
REFSEQ proteins:

No data available for DME Specific Peptides for MYCNOS Gene

Domains & Families for MYCNOS Gene

Gene Families for MYCNOS Gene

Protein Domains for MYCNOS Gene


Suggested Antigen Peptide Sequences for MYCNOS Gene

GenScript: Design optimal peptide antigens:

Graphical View of Domain Structure for InterPro Entry

genes like me logo Genes that share domains with MYCNOS: view

No data available for UniProtKB/Swiss-Prot for MYCNOS Gene

Function for MYCNOS Gene

Molecular function for MYCNOS Gene

UniProtKB/Swiss-Prot Function:
Regulates stability of MYCN in neuroblastoma cells by inhibiting GSK3B-mediated MYCN phosphorylation. Inhibits GSK3B activity by promoting its phosphorylation at Ser-9 (PubMed:24391509).

Gene Ontology (GO) - Molecular Function for MYCNOS Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005515 protein binding IPI 24391509
genes like me logo Genes that share ontologies with MYCNOS: view

Phenotypes for MYCNOS Gene

genes like me logo Genes that share phenotypes with MYCNOS: view

Animal Model Products

No data available for Enzyme Numbers (IUBMB) , Human Phenotype Ontology , Animal Models , miRNA , Transcription Factor Targets and HOMER Transcription for MYCNOS Gene

Localization for MYCNOS Gene

Subcellular locations from UniProtKB/Swiss-Prot for MYCNOS Gene

Cytoplasm. Nucleus.

Gene Ontology (GO) - Cellular Components for MYCNOS Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005634 nucleus IDA 24391509
GO:0005737 cytoplasm IDA 24391509
genes like me logo Genes that share ontologies with MYCNOS: view

No data available for Subcellular locations from COMPARTMENTS for MYCNOS Gene

Pathways & Interactions for MYCNOS Gene

SuperPathways for MYCNOS Gene

No Data Available

Interacting Proteins for MYCNOS Gene

Gene Ontology (GO) - Biological Process for MYCNOS Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0007275 multicellular organism development TAS 1419902
GO:0008284 positive regulation of cell proliferation IMP 24391509
GO:0031647 regulation of protein stability IMP 24391509
GO:0033673 negative regulation of kinase activity IDA 24391509
GO:0043066 negative regulation of apoptotic process IMP 24391509
genes like me logo Genes that share ontologies with MYCNOS: view

No data available for Pathways by source and SIGNOR curated interactions for MYCNOS Gene

Drugs & Compounds for MYCNOS Gene

(1) Drugs for MYCNOS Gene - From: Novoseek

Name Status Disease Links Group Role Mechanism of Action Clinical Trials
genes like me logo Genes that share compounds with MYCNOS: view

Transcripts for MYCNOS Gene


(2) REFSEQ mRNAs :
(3) Additional mRNA sequences :
(10) Selected AceView cDNA sequences:
(1) Ensembl transcripts including schematic representations, and UCSC links where relevant :

Unigene Clusters for MYCNOS Gene

MYCN opposite strand/antisense RNA:
Representative Sequences:

Alternative Splicing Database (ASD) splice patterns (SP) for MYCNOS Gene

No ASD Table

Relevant External Links for MYCNOS Gene

GeneLoc Exon Structure for
ECgene alternative splicing isoforms for

Expression for MYCNOS Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for MYCNOS Gene

mRNA differential expression in normal tissues according to GTEx for MYCNOS Gene

This gene is overexpressed in Testis (x11.9).

NURSA nuclear receptor signaling pathways regulating expression of MYCNOS Gene:


SOURCE GeneReport for Unigene cluster for MYCNOS Gene:


mRNA Expression by UniProt/SwissProt for MYCNOS Gene:

Tissue specificity: Expressed in the neuronal cells of the cerebrum and cerebellum, spermatocytes of the testis, pancreatic cells and also the heart. Expressed in both primary and metastatic neuroblastomas and in thyroid tumors (at protein level). Expression is associated with poor prognosis in neuroblastoma. Expressed in the fetal brain, lung, liver and kidney at varying low levels.
genes like me logo Genes that share expression patterns with MYCNOS: view

Primer Products

No data available for mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , Protein differential expression in normal tissues , Protein expression , Protein tissue co-expression partners , Evidence on tissue expression from TISSUES and Phenotype-based relationships between genes and organs from Gene ORGANizer for MYCNOS Gene

Orthologs for MYCNOS Gene

Evolution for MYCNOS Gene

Gene Tree for MYCNOS (if available)
Gene Tree for MYCNOS (if available)

No data available for Orthologs for MYCNOS Gene

Paralogs for MYCNOS Gene

No data available for Paralogs for MYCNOS Gene

Variants for MYCNOS Gene

Sequence variations from dbSNP and Humsavar for MYCNOS Gene

SNP ID Clin Chr 02 pos Sequence Context AA Info Type
rs113994115 Pathogenic 15,942,281(+) GCTCC(G/T)AGCCC intron-variant, upstream-variant-2KB, reference, utr-variant-3-prime, stop-gained
rs121913667 Pathogenic 15,942,295(+) AGCTG(A/G)GTCAC intron-variant, upstream-variant-2KB, reference, utr-variant-3-prime, stop-gained
rs886039427 Pathogenic 15,942,575(+) GCCGC(-/GCCGGGGCCGCCCTGCCCGCCGAGCTCGCCCACCCGGCCGC)CGAGT intron-variant, upstream-variant-2KB, reference, utr-variant-3-prime, frameshift-variant
rs886041290 Pathogenic 15,942,137(+) CGCTA(C/T)AGCCC intron-variant, upstream-variant-2KB, reference, utr-variant-3-prime, stop-gained
rs886041801 Pathogenic 15,942,506(+) CCGCC(-/C)AGTCC intron-variant, upstream-variant-2KB, reference, utr-variant-3-prime, frameshift-variant

Structural Variations from Database of Genomic Variants (DGV) for MYCNOS Gene

Variant ID Type Subtype PubMed ID
dgv1102e212 CNV loss 25503493

Relevant External Links for MYCNOS Gene

SNPedia medical, phenotypic, and genealogical associations of SNPs for

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot and Variation tolerance for MYCNOS Gene

Disorders for MYCNOS Gene

MalaCards: The human disease database

(2) MalaCards diseases for MYCNOS Gene - From: DISEASES and GeneCards

Disorder Aliases PubMed IDs
  • neuroblastoma 1
autonomic nervous system neoplasm
  • tumor of autonomic nervous system
- elite association - COSMIC cancer census association via MalaCards

Relevant External Links for MYCNOS

Atlas of Genetics and Cytogenetics in Oncology and Haematology:
genes like me logo Genes that share disorders with MYCNOS: view

No data available for UniProtKB/Swiss-Prot and Genatlas for MYCNOS Gene

Publications for MYCNOS Gene

  1. Isolation and characterization of complementary DNA for N-cym, a gene encoded by the DNA strand opposite to N-myc. (PMID: 1419902) Armstrong B.C. … Krystal G.W. (Cell Growth Differ. 1992) 2 3 4 22 64
  2. NCYM, a Cis-antisense gene of MYCN, encodes a de novo evolved protein that inhibits GSK3I^ resulting in the stabilization of MYCN in human neuroblastomas. (PMID: 24391509) Suenaga Y. … Nakagawara A. (PLoS Genet. 2014) 2 3 4 64
  3. MYCNOS functions as an antisense RNA regulating MYCN. (PMID: 26156430) Vadie N. … Morris K.V. (RNA Biol 2015) 2 3 64
  4. NCYM is upregulated by lncUSMycN and modulates N-Myc expression. (PMID: 27748806) Liu P.Y. … Liu T. (Int. J. Oncol. 2016) 3 64
  5. CTCF cooperates with noncoding RNA MYCNOS to promote neuroblastoma progression through facilitating MYCN expression. (PMID: 26549029) Zhao X. … Tong Q. (Oncogene 2015) 3 64

Products for MYCNOS Gene

Sources for MYCNOS Gene

Loading form....