Free for academic non-profit institutions. Other users need a Commercial license

Aliases for MXRA8 Gene

Aliases for MXRA8 Gene

  • Matrix Remodeling Associated 8 2 3 5
  • Limitrin 2 3 4
  • Matrix-Remodelling Associated 8 2 3
  • Matrix Remodeling-Associated Protein 8 3
  • Matrix-Remodeling-Associated Protein 8 3
  • ASP3 3

External Ids for MXRA8 Gene

Previous GeneCards Identifiers for MXRA8 Gene

  • GC00U990744
  • GC01U901165
  • GC01M001278
  • GC01M000561

Summaries for MXRA8 Gene

GeneCards Summary for MXRA8 Gene

MXRA8 (Matrix Remodeling Associated 8) is a Protein Coding gene.

UniProtKB/Swiss-Prot for MXRA8 Gene

  • May play a role in the maturation and maintenance of blood-brain barrier.

Additional gene information for MXRA8 Gene

No data available for Entrez Gene Summary , CIViC summary , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for MXRA8 Gene

Genomics for MXRA8 Gene

GeneHancer (GH) Regulatory Elements for MXRA8 Gene

Promoters and enhancers for MXRA8 Gene
GeneHancer (GH) Identifier GH Type GH
Score
GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites
Gene Targets
GH01I001356 Promoter/Enhancer 2.5 EPDnew FANTOM5 Ensembl ENCODE dbSUPER 553.5 +4.2 4170 6.5 HDGF ARNT ARID4B YBX1 DMAP1 ZNF2 FOS SP5 NFYC ZHX2 MXRA8 SLC35E2 LOC100129381 ANKRD65 CCNL2 LOC100288379 SDF4 ENSG00000272455 INTS11 ENSG00000240731
GH01I001373 Promoter/Enhancer 2.1 EPDnew Ensembl ENCODE 16.1 -11.6 -11582 3.9 CLOCK MLX ZFP64 FEZF1 DMAP1 YBX1 YY1 SLC30A9 ZNF213 E2F8 AURKAIP1 GC01M001374 CDK11A ENSG00000230092 ATAD3B LOC100288379 ENSG00000237094 LINC01786 LOC100288069 CCNL2
GH01I001204 Promoter/Enhancer 2.2 EPDnew FANTOM5 Ensembl ENCODE dbSUPER 13.8 +156.3 156275 4.8 HDGF ARNT ZNF133 GLIS2 FOS RUNX3 YY2 REST TSHZ1 ZNF623 TNFRSF18 CCNL2 ENSG00000240731 LOC100288379 MXRA8 SLC35E2 ANKRD65 ENSG00000230092 VWA1 LOC100129381
GH01I001745 Promoter/Enhancer 2.2 EPDnew Ensembl ENCODE dbSUPER 13.8 -382.6 -382560 2.2 PKNOX1 CLOCK ARNT ARID4B SIN3A DMAP1 ZNF766 E2F8 ZNF207 ZNF143 SLC35E2 LOC100288379 CCNL2 ENSG00000230092 RER1 SDF4 CDK11A INTS11 LOC100129381 MXRA8
GH01I001303 Promoter/Enhancer 2.3 EPDnew Ensembl ENCODE dbSUPER 12.4 +56.3 56336 6.9 PKNOX1 CLOCK MLX ARNT ARID4B SIN3A DMAP1 ZNF2 YY1 ZNF766 PUSL1 ACAP3 ATAD3B CCNL2 ANKRD65 SCNN1D ENSG00000240731 INTS11 ENSG00000272455 LOC100288379
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data dump

GeneHancers around MXRA8 on UCSC Golden Path with GeneCards custom track

Top Transcription factor binding sites by QIAGEN in the MXRA8 gene promoter:

Genomic Locations for MXRA8 Gene

Genomic Locations for MXRA8 Gene
chr1:1,352,689-1,363,541
(GRCh38/hg38)
Size:
10,853 bases
Orientation:
Minus strand
chr1:1,288,069-1,297,157
(GRCh37/hg19)

Genomic View for MXRA8 Gene

Genes around MXRA8 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
MXRA8 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for MXRA8 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for MXRA8 Gene

Proteins for MXRA8 Gene

  • Protein details for MXRA8 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Q9BRK3-MXRA8_HUMAN
    Recommended name:
    Matrix remodeling-associated protein 8
    Protein Accession:
    Q9BRK3
    Secondary Accessions:
    • B3KTR6
    • B4DE34
    • Q5TA39
    • Q96KC3

    Protein attributes for MXRA8 Gene

    Size:
    442 amino acids
    Molecular mass:
    49132 Da
    Quaternary structure:
    No Data Available

    Alternative splice isoforms for MXRA8 Gene

    UniProtKB/Swiss-Prot:

neXtProt entry for MXRA8 Gene

Post-translational modifications for MXRA8 Gene

  • Glycosylation at isoforms=2, 3119 and isoforms=2, 3, 4306

No data available for DME Specific Peptides for MXRA8 Gene

Domains & Families for MXRA8 Gene

Gene Families for MXRA8 Gene

HGNC:
Human Protein Atlas (HPA):
  • Predicted membrane proteins

Protein Domains for MXRA8 Gene

Graphical View of Domain Structure for InterPro Entry

genes like me logo Genes that share domains with MXRA8: view

No data available for UniProtKB/Swiss-Prot for MXRA8 Gene

Function for MXRA8 Gene

Molecular function for MXRA8 Gene

UniProtKB/Swiss-Prot Function:
May play a role in the maturation and maintenance of blood-brain barrier.

Phenotypes From GWAS Catalog for MXRA8 Gene

Gene Ontology (GO) - Molecular Function for MXRA8 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0003674 molecular_function ND --
genes like me logo Genes that share ontologies with MXRA8: view

Phenotypes for MXRA8 Gene

genes like me logo Genes that share phenotypes with MXRA8: view

Clone Products

No data available for Enzyme Numbers (IUBMB) , Human Phenotype Ontology , Animal Models , Transcription Factor Targets and HOMER Transcription for MXRA8 Gene

Localization for MXRA8 Gene

Subcellular locations from UniProtKB/Swiss-Prot for MXRA8 Gene

Membrane; Single-pass type I membrane protein.

Subcellular locations from

COMPARTMENTS
Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for MXRA8 gene
Compartment Confidence
extracellular 5
endoplasmic reticulum 5
plasma membrane 2
mitochondrion 2
nucleus 2
peroxisome 1

Subcellular locations from the

Human Protein Atlas (HPA)

Gene Ontology (GO) - Cellular Components for MXRA8 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005788 endoplasmic reticulum lumen TAS --
GO:0009986 cell surface ISS 14603461
GO:0016020 membrane IEA --
GO:0016021 integral component of membrane IEA --
GO:0070062 extracellular exosome IDA,HDA 19056867
genes like me logo Genes that share ontologies with MXRA8: view

Pathways & Interactions for MXRA8 Gene

SuperPathways for MXRA8 Gene

No Data Available

Gene Ontology (GO) - Biological Process for MXRA8 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0043687 post-translational protein modification TAS --
GO:0044267 cellular protein metabolic process TAS --
GO:0060857 establishment of glial blood-brain barrier ISS 14603461
genes like me logo Genes that share ontologies with MXRA8: view

No data available for Pathways by source and SIGNOR curated interactions for MXRA8 Gene

Drugs & Compounds for MXRA8 Gene

No Compound Related Data Available

Transcripts for MXRA8 Gene

mRNA/cDNA for MXRA8 Gene

(7) REFSEQ mRNAs :
(11) Additional mRNA sequences :
(10) Ensembl transcripts including schematic representations, and UCSC links where relevant :

Unigene Clusters for MXRA8 Gene

Matrix-remodelling associated 8:
Representative Sequences:

Clone Products

Alternative Splicing Database (ASD) splice patterns (SP) for MXRA8 Gene

ExUns: 1 ^ 2 ^ 3a · 3b ^ 4 ^ 5a · 5b · 5c ^ 6 ^ 7 ^ 8 ^ 9a · 9b ^ 10a · 10b
SP1:
SP2:
SP3: - -
SP4:
SP5:

Relevant External Links for MXRA8 Gene

GeneLoc Exon Structure for
MXRA8
ECgene alternative splicing isoforms for
MXRA8

Expression for MXRA8 Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for MXRA8 Gene

Protein differential expression in normal tissues from HIPED for MXRA8 Gene

This gene is overexpressed in Urine (55.6).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, PaxDb, MaxQB, and MOPED for MXRA8 Gene



NURSA nuclear receptor signaling pathways regulating expression of MXRA8 Gene:

MXRA8

SOURCE GeneReport for Unigene cluster for MXRA8 Gene:

Hs.515687

Evidence on tissue expression from TISSUES for MXRA8 Gene

  • Nervous system(4.8)
  • Eye(4.5)
  • Pancreas(4.2)
  • Skin(3.4)
  • Kidney(3)
  • Intestine(2.2)
  • Gall bladder(2.1)
genes like me logo Genes that share expression patterns with MXRA8: view

No data available for mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , mRNA differential expression in normal tissues , Protein tissue co-expression partners , mRNA Expression by UniProt/SwissProt and Phenotype-based relationships between genes and organs from Gene ORGANizer for MXRA8 Gene

Orthologs for MXRA8 Gene

This gene was present in the common ancestor of chordates.

Orthologs for MXRA8 Gene

Organism Taxonomy Gene Similarity Type Details
dog
(Canis familiaris)
Mammalia MXRA8 33 34
  • 84.99 (n)
cow
(Bos Taurus)
Mammalia MXRA8 33 34
  • 84.74 (n)
mouse
(Mus musculus)
Mammalia Mxra8 33 16 34
  • 78.08 (n)
rat
(Rattus norvegicus)
Mammalia Mxra8 33
  • 77.17 (n)
oppossum
(Monodelphis domestica)
Mammalia MXRA8 34
  • 69 (a)
OneToOne
platypus
(Ornithorhynchus anatinus)
Mammalia MXRA8 34
  • 61 (a)
OneToOne
chicken
(Gallus gallus)
Aves MXRA8 33 34
  • 64.21 (n)
lizard
(Anolis carolinensis)
Reptilia MXRA8 34
  • 56 (a)
OneToOne
tropical clawed frog
(Silurana tropicalis)
Amphibia mxra8 33
  • 57.64 (n)
zebrafish
(Danio rerio)
Actinopterygii mxra8a 33 34
  • 56.5 (n)
mxra8b 34
  • 42 (a)
OneToMany
Species where no ortholog for MXRA8 was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • chimpanzee (Pan troglodytes)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • fruit fly (Drosophila melanogaster)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea squirt (Ciona intestinalis)
  • sea squirt (Ciona savignyi)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)
  • worm (Caenorhabditis elegans)

Evolution for MXRA8 Gene

ENSEMBL:
Gene Tree for MXRA8 (if available)
TreeFam:
Gene Tree for MXRA8 (if available)

Paralogs for MXRA8 Gene

No data available for Paralogs for MXRA8 Gene

Variants for MXRA8 Gene

Sequence variations from dbSNP and Humsavar for MXRA8 Gene

SNP ID Clin Chr 01 pos Variation AA Info Type
rs374879755 likely-pathogenic, Abnormality of brain morphology 1,353,913(-) A/G/T coding_sequence_variant, missense_variant
rs1000015240 -- 1,362,918(-) C/T genic_upstream_transcript_variant, intron_variant, upstream_transcript_variant
rs1000102657 -- 1,364,390(-) C/T upstream_transcript_variant
rs1000610776 -- 1,358,208(-) C/T intron_variant
rs1000784544 -- 1,360,286(-) GGGGCAGCTGACCCCCATGGGGC/GGGGC 5_prime_UTR_variant, genic_upstream_transcript_variant, intron_variant, upstream_transcript_variant

Structural Variations from Database of Genomic Variants (DGV) for MXRA8 Gene

Variant ID Type Subtype PubMed ID
dgv27n54 CNV gain 21841781
dgv28n54 CNV gain 21841781
dgv2n67 CNV gain 20364138
dgv30n54 CNV gain 21841781
dgv33n54 CNV loss 21841781
dgv6n100 CNV gain+loss 25217958
dgv7n100 CNV loss 25217958
esv2758912 CNV loss 17122850
esv3890636 CNV loss 25118596
nsv1000169 CNV gain 25217958
nsv1009541 CNV gain 25217958
nsv10161 CNV gain+loss 18304495
nsv1074030 CNV deletion 25765185
nsv1136054 CNV deletion 24896259
nsv1160788 CNV deletion 26073780
nsv470680 CNV loss 18288195
nsv482937 CNV loss 15286789
nsv544969 CNV loss 21841781
nsv544991 CNV loss 21841781
nsv544996 CNV gain 21841781
nsv950452 CNV deletion 24416366
nsv997291 CNV gain 25217958

Variation tolerance for MXRA8 Gene

Residual Variation Intolerance Score: 36.8% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 3.88; 59.06% of all genes are more intolerant (likely to be disease-causing)

Additional Variant Information for MXRA8 Gene

Human Gene Mutation Database (HGMD)
MXRA8
SNPedia medical, phenotypic, and genealogical associations of SNPs for
MXRA8

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for MXRA8 Gene

Disorders for MXRA8 Gene

Additional Disease Information for MXRA8

No disorders were found for MXRA8 Gene.

No data available for MalaCards , UniProtKB/Swiss-Prot and Genatlas for MXRA8 Gene

Publications for MXRA8 Gene

  1. Limitrin, a novel immunoglobulin superfamily protein localized to glia limitans formed by astrocyte endfeet. (PMID: 14603461) Yonezawa T … Ninomiya Y (Glia 2003) 2 3 4 58
  2. Complete sequencing and characterization of 21,243 full-length human cDNAs. (PMID: 14702039) Ota T … Sugano S (Nature genetics 2004) 3 4 58
  3. A Single Kinase Generates the Majority of the Secreted Phosphoproteome. (PMID: 26091039) Tagliabracci VS … Dixon JE (Cell 2015) 4 58
  4. Proteomic analysis of podocyte exosome-enriched fraction from normal human urine. (PMID: 23376485) Prunotto M … Moll S (Journal of proteomics 2013) 3 58
  5. DICAM inhibits angiogenesis via suppression of AKT and p38 MAP kinase signalling. (PMID: 23386276) Han SW … Choi JY (Cardiovascular research 2013) 3 58

Products for MXRA8 Gene

Sources for MXRA8 Gene

Content
Loading form....