Aliases for MXRA8 Gene
Aliases for MXRA8 Gene
External Ids for MXRA8 Gene
- HGNC: 7542
- Entrez Gene: 54587
- Ensembl: ENSG00000162576
- OMIM: 617293
- UniProtKB: Q9BRK3
Previous GeneCards Identifiers for MXRA8 Gene
- GC00U990744
- GC01U901165
- GC01M001278
- GC01M000561
Summaries for MXRA8 Gene
GeneCards Summary for MXRA8 Gene
MXRA8 (Matrix Remodeling Associated 8) is a Protein Coding gene.
UniProtKB/Swiss-Prot for MXRA8 Gene
-
May play a role in the maturation and maintenance of blood-brain barrier.
No data available for Entrez Gene Summary , CIViC summary , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for MXRA8 Gene
Genomics for MXRA8 Gene
GeneHancer (GH) Regulatory Elements for MXRA8 Gene
Promoters and enhancers for MXRA8 Gene
- Elite GeneHancer and/or Elite GeneHancer-gene association
Download GeneHancer data dump
GeneHancers around MXRA8 on UCSC Golden Path with GeneCards custom track
- Top Transcription factor binding sites by QIAGEN in the MXRA8 gene promoter:
Regulatory Element Products
Genomic Locations for MXRA8 Gene
Genomic Locations for MXRA8 Gene
- chr1:1,352,689-1,363,541
- (GRCh38/hg38)
- Size:
- 10,853 bases
- Orientation:
- Minus strand
- chr1:1,288,069-1,297,157
- (GRCh37/hg19)
Genomic View for MXRA8 Gene
Genes around MXRA8 on UCSC Golden Path with GeneCards custom track
- Cytogenetic band:
-
- 1p36.33 by Ensembl
- 1p36.33 by Entrez Gene
- 1p36.33 by HGNC
MXRA8 Gene in genomic location: bands according to
Ensembl, locations according to GeneLoc
(and/or Entrez Gene and/or Ensembl if different)


RefSeq DNA sequence for MXRA8 Gene
Proteins for MXRA8 Gene
-
Protein details for MXRA8 Gene (UniProtKB/Swiss-Prot)
- Protein Symbol:
- Q9BRK3-MXRA8_HUMAN
- Recommended name:
- Matrix remodeling-associated protein 8
- Protein Accession:
- Q9BRK3
- B3KTR6
- B4DE34
- Q5TA39
- Q96KC3
Protein attributes for MXRA8 Gene
- Size:
- 442 amino acids
- Molecular mass:
- 49132 Da
- Quaternary structure:
- No Data Available
Protein Expression for MXRA8 Gene
Post-translational modifications for MXRA8 Gene
- Glycosylation at isoforms=2, 3119 and isoforms=2, 3, 4306
Other Protein References for MXRA8 Gene
- ENSEMBL proteins:
- REFSEQ proteins:
Antibody Products
- Novus Biologicals Antibodies for MXRA8
- Invitrogen Antibodies for MXRA8
- Search GeneTex for Antibodies for MXRA8
Protein Products
- R&D Systems Proteins and Enzymes for MXRA8 (MXRA8/DICAM)
-
OriGene Purified Proteins for MXRA8
- Search Origene for MassSpec and Protein Over-expression Lysates for MXRA8
- Origene Custom Protein Services for MXRA8
- Novus Biologicals proteins for MXRA8
- antibodies-online: Search results for 8 available MXRA8 Proteins ranked by validation data
- Compare Top MXRA8 Proteins
-
Quality Products:
- Search GeneTex for Proteins for MXRA8
Assay Products
- antibodies-online: Search results for 1 available MXRA8 Elisa Kits ranked by validation data
- Compare Top MXRA8 Elisa Kits
-
Quality Products:
No data available for DME Specific Peptides for MXRA8 Gene
Domains & Families for MXRA8 Gene
Gene Families for MXRA8 Gene
- HGNC:
- Human Protein Atlas (HPA):
-
- Predicted membrane proteins
Protein Domains for MXRA8 Gene
- InterPro:
- Blocks:
- ProtoNet:
Suggested Antigen Peptide Sequences for MXRA8 Gene
- GenScript: Design optimal peptide antigens:
Graphical View of Domain Structure for InterPro Entry
No data available for UniProtKB/Swiss-Prot for MXRA8 Gene
Function for MXRA8 Gene
Molecular function for MXRA8 Gene
- UniProtKB/Swiss-Prot Function:
- May play a role in the maturation and maintenance of blood-brain barrier.
Phenotypes From GWAS Catalog for MXRA8 Gene
GO ID | Qualified GO term | Evidence | PubMed IDs |
---|---|---|---|
GO:0003674 | molecular_function | ND | -- |
Phenotypes for MXRA8 Gene
- MGI mutant phenotypes for MXRA8:
- inferred from 1 alleles
- GenomeRNAi human phenotypes for MXRA8:
Animal Model Products
- Taconic Biosciences: Generate A Custom CRISPR Mouse Model For Your Study
-
ViGene Biosciences lentiviral particle packaged cDNA for MXRA8 gene
-
ViGene Biosciences ready-to-package AAV shRNAs for MXRA8 gene
- Search ViGene Biosciences for MXRA8
CRISPR Products
-
OriGene CRISPR knockouts for MXRA8
- genomics-online: gRNA clones - Search results for 109 available MXRA8 gene related products
- Overview of 109 available MXRA8 gene related products
- Applied Biological Materials CRISPR for MXRA8
-
Vectors and viruses for KO, Activation, Repression, and more
-
Santa Cruz Biotechnology (SCBT) CRISPR for MXRA8
- GenScript: Design CRISPR guide RNA sequences for MXRA8
miRNA for MXRA8 Gene
- miRTarBase miRNAs that target MXRA8
-
- hsa-mir-335-5p (MIRT018682)
- hsa-mir-3688-5p (MIRT482919)
- hsa-mir-196a-3p (MIRT482920)
- hsa-mir-4693-3p (MIRT482921)
- hsa-mir-6761-5p (MIRT482922)
- hsa-mir-4717-5p (MIRT482923)
- hsa-mir-1972 (MIRT482924)
- hsa-mir-6768-5p (MIRT482925)
- hsa-mir-1295b-5p (MIRT762352)
- hsa-mir-1912 (MIRT763380)
- hsa-mir-3157-5p (MIRT765079)
- hsa-mir-4690-3p (MIRT771081)
- hsa-mir-5685 (MIRT774967)
- hsa-mir-6759-3p (MIRT778439)
- hsa-mir-6814-5p (MIRT779796)
- hsa-mir-6830-5p (MIRT780000)
miRNA Products
- Search ViGene Biosciences for MXRA8
Inhibitory RNA Products
- Origene RNAi and shrna products in human, mouse, rat for MXRA8
- Browse OriGene Inhibitory RNA Products For MXRA8
- genomics-online: shRNA clones - Search results for 109 available MXRA8 gene related products
- Overview of 109 available MXRA8 gene related products
-
ViGene Biosciences ready-to-package AAV shRNAs for MXRA8 gene
Clone Products
- Sino Biological Human cDNA Clone for MXRA8
- Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat
- Applied Biological Materials Clones for MXRA8
-
Vectors and viruses for ORF, Lenti, Retro, Adenovirus, AAV, and more
- R&D Systems cDNA Clones for MXRA8 (MXRA8/DICAM)
Cell Line Products
-
Horizon Cell Lines for MXRA8
-
ViGene Biosciences adenoviral particle packaged cDNA for MXRA8 gene
-
ViGene Biosciences lentiviral particle packaged cDNA for MXRA8 gene
-
ViGene Biosciences ready-to-package AAV shRNAs for MXRA8 gene
No data available for Enzyme Numbers (IUBMB) , Human Phenotype Ontology , Animal Models , Transcription Factor Targets and HOMER Transcription for MXRA8 Gene
Localization for MXRA8 Gene
Subcellular locations from UniProtKB/Swiss-Prot for MXRA8 Gene
- Membrane; Single-pass type I membrane protein.
- Nucleoli (2)
GO ID | Qualified GO term | Evidence | PubMed IDs |
---|---|---|---|
GO:0005788 | endoplasmic reticulum lumen | TAS | -- |
GO:0009986 | cell surface | ISS | 14603461 |
GO:0016020 | membrane | IEA | -- |
GO:0016021 | integral component of membrane | IEA | -- |
GO:0070062 | extracellular exosome | IDA,HDA | 19056867 |
Pathways & Interactions for MXRA8 Gene
No Data Available
Interacting Proteins for MXRA8 Gene
GO ID | Qualified GO term | Evidence | PubMed IDs |
---|---|---|---|
GO:0043687 | post-translational protein modification | TAS | -- |
GO:0044267 | cellular protein metabolic process | TAS | -- |
GO:0060857 | establishment of glial blood-brain barrier | ISS | 14603461 |
No data available for Pathways by source and SIGNOR curated interactions for MXRA8 Gene
Transcripts for MXRA8 Gene
mRNA/cDNA for MXRA8 Gene
- (7) REFSEQ mRNAs :
- (11) Additional mRNA sequences :
- (10) Ensembl transcripts including schematic representations, and UCSC links where relevant :
Unigene Clusters for MXRA8 Gene
CRISPR Products
-
OriGene CRISPR knockouts for MXRA8
- genomics-online: gRNA clones - Search results for 109 available MXRA8 gene related products
- Overview of 109 available MXRA8 gene related products
- Applied Biological Materials CRISPR for MXRA8
-
Vectors and viruses for KO, Activation, Repression, and more
-
Santa Cruz Biotechnology (SCBT) CRISPR for MXRA8
- GenScript: Design CRISPR guide RNA sequences for MXRA8
miRNA Products
- Search ViGene Biosciences for MXRA8
Inhibitory RNA Products
- Origene RNAi and shrna products in human, mouse, rat for MXRA8
- Browse OriGene Inhibitory RNA Products For MXRA8
- genomics-online: shRNA clones - Search results for 109 available MXRA8 gene related products
- Overview of 109 available MXRA8 gene related products
-
ViGene Biosciences ready-to-package AAV shRNAs for MXRA8 gene
Clone Products
- Sino Biological Human cDNA Clone for MXRA8
- Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat
- Applied Biological Materials Clones for MXRA8
-
Vectors and viruses for ORF, Lenti, Retro, Adenovirus, AAV, and more
- R&D Systems cDNA Clones for MXRA8 (MXRA8/DICAM)
ExUns: | 1 | ^ | 2 | ^ | 3a | · | 3b | ^ | 4 | ^ | 5a | · | 5b | · | 5c | ^ | 6 | ^ | 7 | ^ | 8 | ^ | 9a | · | 9b | ^ | 10a | · | 10b |
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
SP1: | |||||||||||||||||||||||||||||
SP2: | |||||||||||||||||||||||||||||
SP3: | - | - | |||||||||||||||||||||||||||
SP4: | |||||||||||||||||||||||||||||
SP5: |
Expression for MXRA8 Gene
This gene is overexpressed in Urine (55.6).
Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, PaxDb, MaxQB, and MOPED for MXRA8 Gene
NURSA nuclear receptor signaling pathways regulating expression of MXRA8 Gene:
MXRA8SOURCE GeneReport for Unigene cluster for MXRA8 Gene:
Hs.515687Evidence on tissue expression from TISSUES for MXRA8 Gene
- Nervous system(4.8)
- Eye(4.5)
- Pancreas(4.2)
- Skin(3.4)
- Kidney(3)
- Intestine(2.2)
- Gall bladder(2.1)
Primer Products
-
OriGene qPCR primer pairs for MXRA8
-
OriGene qPCR primer pairs and template standards for MXRA8
No data available for mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , mRNA differential expression in normal tissues , Protein tissue co-expression partners , mRNA Expression by UniProt/SwissProt and Phenotype-based relationships between genes and organs from Gene ORGANizer for MXRA8 Gene
Orthologs for MXRA8 Gene
This gene was present in the common ancestor of chordates.
Organism | Taxonomy | Gene | Similarity | Type | Details |
---|---|---|---|---|---|
dog (Canis familiaris) |
Mammalia | MXRA8 33 34 |
|
||
cow (Bos Taurus) |
Mammalia | MXRA8 33 34 |
|
||
mouse (Mus musculus) |
Mammalia | Mxra8 33 16 34 |
|
||
rat (Rattus norvegicus) |
Mammalia | Mxra8 33 |
|
||
oppossum (Monodelphis domestica) |
Mammalia | MXRA8 34 |
|
OneToOne | |
platypus (Ornithorhynchus anatinus) |
Mammalia | MXRA8 34 |
|
OneToOne | |
chicken (Gallus gallus) |
Aves | MXRA8 33 34 |
|
||
lizard (Anolis carolinensis) |
Reptilia | MXRA8 34 |
|
OneToOne | |
tropical clawed frog (Silurana tropicalis) |
Amphibia | mxra8 33 |
|
||
zebrafish (Danio rerio) |
Actinopterygii | mxra8a 33 34 |
|
||
mxra8b 34 |
|
OneToMany |
- Species where no ortholog for MXRA8 was found in the sources mined by GeneCards:
-
- A. gosspyii yeast (Ashbya gossypii)
- Actinobacteria (Mycobacterium tuberculosis)
- African clawed frog (Xenopus laevis)
- African malaria mosquito (Anopheles gambiae)
- Alicante grape (Vitis vinifera)
- alpha proteobacteria (Wolbachia pipientis)
- amoeba (Dictyostelium discoideum)
- Archea (Pyrococcus horikoshii)
- baker's yeast (Saccharomyces cerevisiae)
- barley (Hordeum vulgare)
- beta proteobacteria (Neisseria meningitidis)
- bread mold (Neurospora crassa)
- chimpanzee (Pan troglodytes)
- Chromalveolata (Phytophthora infestans)
- common water flea (Daphnia pulex)
- corn (Zea mays)
- E. coli (Escherichia coli)
- filamentous fungi (Aspergillus nidulans)
- Firmicute bacteria (Streptococcus pneumoniae)
- fission yeast (Schizosaccharomyces pombe)
- fruit fly (Drosophila melanogaster)
- green algae (Chlamydomonas reinhardtii)
- honey bee (Apis mellifera)
- K. lactis yeast (Kluyveromyces lactis)
- loblloly pine (Pinus taeda)
- malaria parasite (Plasmodium falciparum)
- medicago trunc (Medicago Truncatula)
- moss (Physcomitrella patens)
- orangutan (Pongo pygmaeus)
- pig (Sus scrofa)
- rainbow trout (Oncorhynchus mykiss)
- rice (Oryza sativa)
- rice blast fungus (Magnaporthe grisea)
- schistosome parasite (Schistosoma mansoni)
- sea anemone (Nematostella vectensis)
- sea squirt (Ciona intestinalis)
- sea squirt (Ciona savignyi)
- sea urchin (Strongylocentrotus purpuratus)
- sorghum (Sorghum bicolor)
- soybean (Glycine max)
- stem rust fungus (Puccinia graminis)
- sugarcane (Saccharum officinarum)
- thale cress (Arabidopsis thaliana)
- tomato (Lycopersicon esculentum)
- toxoplasmosis (Toxoplasma gondii)
- Trichoplax (Trichoplax adhaerens)
- wheat (Triticum aestivum)
- worm (Caenorhabditis elegans)
Paralogs for MXRA8 Gene
No data available for Paralogs for MXRA8 Gene
Variants for MXRA8 Gene
SNP ID | Clin | Chr 01 pos | Variation | AA Info | Type |
---|---|---|---|---|---|
rs374879755 | likely-pathogenic, Abnormality of brain morphology | 1,353,913(-) | A/G/T | coding_sequence_variant, missense_variant | |
rs1000015240 | -- | 1,362,918(-) | C/T | genic_upstream_transcript_variant, intron_variant, upstream_transcript_variant | |
rs1000102657 | -- | 1,364,390(-) | C/T | upstream_transcript_variant | |
rs1000610776 | -- | 1,358,208(-) | C/T | intron_variant | |
rs1000784544 | -- | 1,360,286(-) | GGGGCAGCTGACCCCCATGGGGC/GGGGC | 5_prime_UTR_variant, genic_upstream_transcript_variant, intron_variant, upstream_transcript_variant |
Variant ID | Type | Subtype | PubMed ID |
---|---|---|---|
dgv27n54 | CNV | gain | 21841781 |
dgv28n54 | CNV | gain | 21841781 |
dgv2n67 | CNV | gain | 20364138 |
dgv30n54 | CNV | gain | 21841781 |
dgv33n54 | CNV | loss | 21841781 |
dgv6n100 | CNV | gain+loss | 25217958 |
dgv7n100 | CNV | loss | 25217958 |
esv2758912 | CNV | loss | 17122850 |
esv3890636 | CNV | loss | 25118596 |
nsv1000169 | CNV | gain | 25217958 |
nsv1009541 | CNV | gain | 25217958 |
nsv10161 | CNV | gain+loss | 18304495 |
nsv1074030 | CNV | deletion | 25765185 |
nsv1136054 | CNV | deletion | 24896259 |
nsv1160788 | CNV | deletion | 26073780 |
nsv470680 | CNV | loss | 18288195 |
nsv482937 | CNV | loss | 15286789 |
nsv544969 | CNV | loss | 21841781 |
nsv544991 | CNV | loss | 21841781 |
nsv544996 | CNV | gain | 21841781 |
nsv950452 | CNV | deletion | 24416366 |
nsv997291 | CNV | gain | 25217958 |
Residual Variation Intolerance Score:
36.8% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score:
3.88;
59.06% of all genes are more intolerant (likely to be disease-causing)
Additional Variant Information for MXRA8 Gene
No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for MXRA8 Gene
Disorders for MXRA8 Gene
Additional Disease Information for MXRA8
No disorders were found for MXRA8 Gene.
No data available for MalaCards , UniProtKB/Swiss-Prot and Genatlas for MXRA8 Gene
Publications for MXRA8 Gene
- Limitrin, a novel immunoglobulin superfamily protein localized to glia limitans formed by astrocyte endfeet. (PMID: 14603461) Yonezawa T … Ninomiya Y (Glia 2003) 2 3 4 58
- Complete sequencing and characterization of 21,243 full-length human cDNAs. (PMID: 14702039) Ota T … Sugano S (Nature genetics 2004) 3 4 58
- A Single Kinase Generates the Majority of the Secreted Phosphoproteome. (PMID: 26091039) Tagliabracci VS … Dixon JE (Cell 2015) 4 58
- Proteomic analysis of podocyte exosome-enriched fraction from normal human urine. (PMID: 23376485) Prunotto M … Moll S (Journal of proteomics 2013) 3 58
- DICAM inhibits angiogenesis via suppression of AKT and p38 MAP kinase signalling. (PMID: 23386276) Han SW … Choi JY (Cardiovascular research 2013) 3 58
Products for MXRA8 Gene
- Browse R&D Systems for Antibodies
- R&D Systems Proteins and Enzymes for MXRA8 (MXRA8/DICAM)
- Browse R&D Systems for biochemical assays
- R&D Systems cDNA Clones for MXRA8 (MXRA8/DICAM)
- Browse Primary Antibodies
- Browse Proteins and Enzymes
- Browse ELISAs
- Browse Activity Assays
- Browse cDNA Clones
- Browse Cell Culture Products
- Browse Cell Selection and Detection Kits
- Browse DNA Damage and Repair Kits
- Browse ELISpot/FluoroSpot Kits and Development Modules
- Browse Flow Cytometry Kits
- Browse Immunoprecipitation Assays
- Browse Luminex Assays
- Browse Peptides
- Browse Proteome Profiler Antibody Arrays
- Browse Small Molecules
- Browse OriGene Antibodies
- Custom Antibody Services
- Browse OriGene ELISA Kits
- Custom Assay Services
- OriGene Purified Proteins for MXRA8
- Search Origene for MassSpec and Protein Over-expression Lysates for MXRA8
- Origene Custom Protein Services for MXRA8
- Origene shrna and RNAi products in human, mouse, rat for MXRA8
- Browse OriGene Inhibitory RNA Products For MXRA8
- OriGene qPCR primer pairs and template standards for MXRA8
- OriGene qPCR primer pairs for MXRA8
- OriGene CRISPR knockouts for MXRA8
- OriGene ORF clones in human for MXRA8
- Custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
- Browse OriGene miRNA Products For MXRA8
- GenScript: Next-day shipping of latest version cDNA ORF clones for MXRA8 in any vector
- GenScript Custom Purified and Recombinant Proteins Services for MXRA8
- GenScript Custom Assay Services for MXRA8
- GenScript Custom overexpressing Cell Line Services for MXRA8
- GenScript: Design CRISPR guide RNA sequences for MXRA8
- Design optimal peptide antigens
- CloneReady with Over 120,000 Genes
- Gene Synthesis: Any Gene in Any Vector
- Vector-based siRNA and miRNA, Ready for Transfection
- Gene Mutant Library, Variants up to 10^11
- Plasmid Preparation
- GenScript Custom Peptide Services for MXRA8
- Sino Biological Human cDNA Clone for MXRA8
- Browse Sino Biological Cell Lysates
- Browse Sino Biological Recombinant Proteins
- Browse Sino Biological Antibodies
- Browse Sino Biological Assays
- Browse Sino Biological ELISA Kits
- Browse Sino Biological ELISA Pair Sets
- Browse Sino Biological CRO Services
- Browse Sino Biological Control Vectors
- Sino Biological Transfection Reagent
- Sino Biological Anti-His Tag Antibody
- Novus Biologicals Antibodies for MXRA8
- Novus Biologicals proteins for MXRA8
- Novus Biologicals
- Novus Biologicals Tissue Microarrays
- Browse Antibodies at Cloud-Clone Corp.
- Browse Proteins at Cloud-Clone Corp.
- Browse Assay Kits at Cloud-Clone Corp.
- Browse Knockouts at Cloud-Clone Corp.
- Browse Knockins at Cloud-Clone Corp.
- Cloud-Clone Corp. disease models service
- Browse cDNA clones at Cloud-Clone Corp.
- Browse primers at Cloud-Clone Corp.
- Cloud-Clone Corp. primary cells service
- Invitrogen Antibodies for MXRA8
- Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat
- antibodies-online: Search results for available MXRA8 related products ranked by validation data
- antibodies-online: Search results for 1 available MXRA8 Elisa Kits ranked by validation data
- Compare Top MXRA8 Elisa Kits
- Quality Products:
- antibodies-online: Search results for 8 available MXRA8 Proteins ranked by validation data
- Compare Top MXRA8 Proteins
- Quality Products:
- Search GeneTex for Antibodies for MXRA8
- Search GeneTex for Proteins for MXRA8
- ViGene Biosciences adenoviral particle packaged cDNA for MXRA8 gene
- ViGene Biosciences lentiviral particle packaged cDNA for MXRA8 gene
- ViGene Biosciences ready-to-package AAV shRNAs for MXRA8 gene
- Search ViGene Biosciences for MXRA8
- Horizon Cell Lines for MXRA8
- genomics-online: cdna clones - Search results for 109 available MXRA8 gene related products
- Overview of 109 available MXRA8 gene related products
- orf clones - Search results for 109 available MXRA8 gene related products
- Overview of 109 available MXRA8 gene related products
- genomics-online: gRNA clones - Search results for 109 available MXRA8 gene related products
- Overview of 109 available MXRA8 gene related products
- genomics-online: primer clones - Search results for 109 available MXRA8 gene related products
- Overview of 109 available MXRA8 gene related products
- genomics-online: shRNA clones - Search results for 109 available MXRA8 gene related products
- Overview of 109 available MXRA8 gene related products
Sources for MXRA8 Gene
- (1) GeneCards
- (2) HGNC
- (3) EntrezGene
- (4) Swiss-Prot
- (5) Ensembl
- (6) OMIM
- (7) GeneLoc
- (8) Gene Wiki
- (9) UCSC
- (10) PhosphoSitePlus
- (11) GO
- (12) TrEMBL
- (13) InterPro
- (14) ProtoNet
- (15) Blocks
- (16) MGI
- (17) IUBMB
- (18) KEGG
- (19) MINT
- (20) STRING
- (21) IntAct
- (22) Novoseek
- (23) PharmGKB
- (24) DrugBank
- (25) HMDB
- (26) UniGene
- (27) AceView
- (28) ASD
- (29) ECgene
- (30) GeneAnnot
- (31) CGAP SAGE
- (32) SOURCE
- (33) HomoloGene
- (34) PanEnsembl
- (35) euGenes
- (36) SGD
- (37) FlyBase
- (38) WormBase
- (39) Pseudogene
- (40) DGV
- (41) dbSNP
- (42) GenAtlas
- (43) HGMD
- (44) GAD
- (45) BGMUT
- (46) HuGE
- (47) Atlas
- (48) Cell Signaling Technology
- (49) GenBank
- (50) H-invDB
- (51) HORDE
- (52) HUGE
- (53) IMGT
- (54) Leiden
- (55) miRBase
- (56) DME
- (57) OriGene
- (58) PubMed
- (59) R&D Systems
- (60) TGDB
- (61) Tocris
- (62) Abcam
- (63) Novus Biologicals
- (64) ProSpec
- (65) Sino Biological
- (66) GenScript
- (67) Qiagen
- (68) Cloud-Clone Corp.
- (69) OCA
- (70) Proteopedia
- (71) MOPED
- (72) neXtProt
- (73) Reactome
- (74) GeneGo (Thomson Reuters)
- (75) fRNAdb
- (76) DISEASES
- (77) SIMAP
- (78) GenomeRNAi
- (79) LifeMap
- (80) miRTarBase
- (81) MalaCards
- (82) Invitrogen
- (83) BitterDB
- (84) Vector BioLabs
- (85) ESI-BIO
- (86) RefSeq
- (87) BioSystems
- (88) MaxQB
- (89) IUPHAR
- (90) BioGPS
- (91) Illumina
- (92) COMPARTMENTS
- (93) HOMER
- (94) PaxDb
- (95) ApexBio
- (96) Addgene
- (97) antibodies-online
- (98) CYP
- (99) NONCODE
- (100) SwitchGear Genomics
- (101) TreeFam
- (102) PathCards
- (103) GeneReviews
- (104) GeneTex
- (105) Taconic Biosciences
- (106) GTEx
- (107) ProteomicsDB
- (108) SCBT
- (109) DGIdb
- (110) ClinicalTrials
- (111) FDA Approved Drugs
- (112) RVIS
- (113) SIGNOR
- (114) diseasecard
- (115) NIH Rare Diseases
- (116) Orphanet
- (117) UMLS
- (118) GTR
- (119) Disease Ontology
- (120) Genetics Home Reference
- (121) MeSH
- (122) MedlinePlus
- (123) CDC
- (124) NINDS
- (125) NCBI Bookshelf
- (126) ClinVar
- (127) Gene Damage Index
- (128) ViGene Biosciences
- (129) HPO
- (130) UDN
- (131) VISTA
- (132) FANTOM5
- (133) ENCODE
- (134) ProSci
- (135) Horizon
- (136) NURSA
- (137) IID
- (138) Cyagen
- (139) VectorBuilder
- (140) SNPedia
- (141) BRCA Exchange
- (142) St John's Lab
- (143) CIViC
- (144) ProteoGenix
- (145) dbSUPER
- (146) TISSUES
- (147) Gene ORGANizer
- (148) abm
- (149) CrownBio
- (150) Human Protein Atlas
- (151) GWAS Catalog
- (152) Monarch Initiative
- (153) DataMed
- (154) HumanCyc
- (155) genomics-online
- (156) UCNEbase
- (157) EPDnew