Free for academic non-profit institutions. Other users need a Commercial license

Aliases for MURC Gene

Aliases for MURC Gene

  • Muscle Related Coiled-Coil Protein 2 3 5
  • Muscle-Restricted Coiled-Coil Protein 2 3 4
  • Muscle-Related Coiled-Coil Protein 2 3
  • Cavin-4 3
  • CAVIN4 3

External Ids for MURC Gene

Previous GeneCards Identifiers for MURC Gene

  • GC09P102381
  • GC09P103341
  • GC09P072939

Summaries for MURC Gene

Entrez Gene Summary for MURC Gene

  • This gene encodes a protein containing two coiled-coil regions. The encoded protein promotes Rho/ROCK (Rho-kinase) signaling in cardiac muscles cells, and may facilitate myofibrillar organization. [provided by RefSeq, Jun 2013]

GeneCards Summary for MURC Gene

MURC (Muscle Related Coiled-Coil Protein) is a Protein Coding gene. Diseases associated with MURC include Bejel and Yaws. An important paralog of this gene is PTRF.

UniProtKB/Swiss-Prot for MURC Gene

  • Induces RHOA activation and activates NPPA transcription and myofibrillar organization through the Rho/ROCK signaling pathway.

No data available for Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for MURC Gene

Genomics for MURC Gene

Regulatory Elements for MURC Gene

Enhancers for MURC Gene
GeneHancer Identifier Enhancer Score Enhancer Sources Gene-Enhancer Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor Binding Sites within enhancer Gene Targets for Enhancer
GH09F100600 0.9 Ensembl ENCODE 18.6 +24.4 24353 1.8 CTCF ZNF654 SAP130 TRIM22 RAD21 TEAD3 RFXANK ZNF143 SMC3 HOMEZ MURC TMEFF1 INVS GC09M100582 RN7SKP87 PIR40273
GH09F100598 1.1 Ensembl ENCODE 11.3 +22.1 22111 1.6 ARID4B SIN3A ZNF48 YY1 ELK1 SCRT2 RCOR1 SP3 ZBTB2 SP5 MURC MSANTD3 GC09M100582 RN7SKP87 PIR40273
GH09F100410 1.2 Ensembl ENCODE 8.4 -165.5 -165467 2.0 ARID4B SIN3A DMAP1 ZNF143 ZNF263 SP3 NFYC MXD4 ZNF518A KAT8 TMEFF1 TEX10 MSANTD3-TMEFF1 MURC MSANTD3 LOC105376177
GH09F100589 0.6 ENCODE 16.5 +13.6 13597 1.6 JUND ATF3 POLR2A JUN BHLHE40 NFE2 FOS TMEFF1 MURC MSANTD3-TMEFF1 MSANTD3 GC09M100582 RN7SKP87 PIR40273
GH09F100577 0.4 ENCODE 23 +3.7 3729 6.0 ZNF24 MURC TMEFF1 GC09M100582 RN7SKP87
- Elite enhancer and/or Elite enhancer-gene association Download GeneHancer data dump

Enhancers around MURC on UCSC Golden Path with GeneCards custom track

Genomic Location for MURC Gene

100,576,867 bp from pter
100,588,402 bp from pter
11,536 bases
Plus strand

Genomic View for MURC Gene

Genes around MURC on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
MURC Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for MURC Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for MURC Gene

Proteins for MURC Gene

  • Protein details for MURC Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Recommended name:
    Muscle-related coiled-coil protein
    Protein Accession:
    Secondary Accessions:
    • B1PRL3
    • B4DT88

    Protein attributes for MURC Gene

    364 amino acids
    Molecular mass:
    41899 Da
    Quaternary structure:
    • Interacts with SDPR; this augments the transactivation of NPPA.
    • Sequence=AAH90888.1; Type=Erroneous initiation; Evidence={ECO:0000305};

neXtProt entry for MURC Gene

Post-translational modifications for MURC Gene

  • Modification sites at PhosphoSitePlus
  • Modification sites at neXtProt

Other Protein References for MURC Gene

ENSEMBL proteins:
REFSEQ proteins:

No data available for DME Specific Peptides for MURC Gene

Domains & Families for MURC Gene

Gene Families for MURC Gene

Protein Domains for MURC Gene


Suggested Antigen Peptide Sequences for MURC Gene

GenScript: Design optimal peptide antigens:

Graphical View of Domain Structure for InterPro Entry



  • Belongs to the PTRF/SDPR family.
  • Belongs to the PTRF/SDPR family.
genes like me logo Genes that share domains with MURC: view

Function for MURC Gene

Molecular function for MURC Gene

UniProtKB/Swiss-Prot Function:
Induces RHOA activation and activates NPPA transcription and myofibrillar organization through the Rho/ROCK signaling pathway.
genes like me logo Genes that share phenotypes with MURC: view

Animal Models for MURC Gene

MGI Knock Outs for MURC:

Animal Model Products

Inhibitory RNA Products

Flow Cytometry Products

No data available for Enzyme Numbers (IUBMB) , Gene Ontology (GO) - Molecular Function , Human Phenotype Ontology , Transcription Factor Targets and HOMER Transcription for MURC Gene

Localization for MURC Gene

Subcellular locations from UniProtKB/Swiss-Prot for MURC Gene

Cytoplasm, myofibril, sarcomere. Cytoplasm. Note=In cardiomyocytes, accumulates in the Z-line of the sarcomere. In vascular smooth muscle cells, detected diffusely throughout the cytoplasm (By similarity). {ECO:0000250}.

Subcellular locations from

Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for MURC gene
Compartment Confidence
nucleus 3
plasma membrane 1
cytosol 1

Gene Ontology (GO) - Cellular Components for MURC Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005737 cytoplasm IBA --
GO:0030017 sarcomere IEA --
GO:0030018 Z disc IEA --
genes like me logo Genes that share ontologies with MURC: view

Pathways & Interactions for MURC Gene

No Data Available

Interacting Proteins for MURC Gene

STRING Interaction Network Preview (showing 1 interactants - click image to see details)
Selected Interacting proteins: ENSP00000418668 Q5BKX8-MURC_HUMAN for MURC Gene via STRING IID

Gene Ontology (GO) - Biological Process for MURC Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0006351 transcription, DNA-templated IEA --
GO:0006355 regulation of transcription, DNA-templated IEA --
GO:0007275 multicellular organism development IEA --
GO:0007517 muscle organ development IEA --
GO:0010468 regulation of gene expression IMP 21642240
genes like me logo Genes that share ontologies with MURC: view

No data available for Pathways by source and SIGNOR curated interactions for MURC Gene

Transcripts for MURC Gene

mRNA/cDNA for MURC Gene

(1) REFSEQ mRNAs :
(4) Additional mRNA sequences :
(20) Selected AceView cDNA sequences:
(1) Ensembl transcripts including schematic representations, and UCSC links where relevant :

Unigene Clusters for MURC Gene

Muscle-related coiled-coil protein:
Representative Sequences:

Inhibitory RNA Products

Flow Cytometry Products

Alternative Splicing Database (ASD) splice patterns (SP) for MURC Gene

No ASD Table

Relevant External Links for MURC Gene

GeneLoc Exon Structure for
ECgene alternative splicing isoforms for

Expression for MURC Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and SAGE for MURC Gene

mRNA expression in embryonic tissues and stem cells from LifeMap Discovery

mRNA differential expression in normal tissues according to GTEx for MURC Gene

This gene is overexpressed in Muscle - Skeletal (x25.4), Heart - Left Ventricle (x11.6), and Heart - Atrial Appendage (x5.8).

Protein differential expression in normal tissues from HIPED for MURC Gene

This gene is overexpressed in Heart (24.6), Blymphocyte (23.0), and Esophagus (10.1).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB and MOPED for MURC Gene

NURSA nuclear receptor signaling pathways regulating expression of MURC Gene:


SOURCE GeneReport for Unigene cluster for MURC Gene:

genes like me logo Genes that share expression patterns with MURC: view

Primer Products

No data available for Protein tissue co-expression partners and mRNA Expression by UniProt/SwissProt for MURC Gene

Orthologs for MURC Gene

This gene was present in the common ancestor of chordates.

Orthologs for MURC Gene

Organism Taxonomy Gene Similarity Type Details
(Pan troglodytes)
Mammalia MURC 34 35
  • 99.27 (n)
(Canis familiaris)
Mammalia MURC 34 35
  • 89.01 (n)
(Bos Taurus)
Mammalia MURC 34 35
  • 88.18 (n)
(Mus musculus)
Mammalia Murc 34 16 35
  • 81.95 (n)
(Rattus norvegicus)
Mammalia Murc 34
  • 81.68 (n)
(Monodelphis domestica)
Mammalia MURC 35
  • 67 (a)
(Ornithorhynchus anatinus)
Mammalia MURC 35
  • 64 (a)
(Gallus gallus)
Aves MURC 34 35
  • 69.7 (n)
tropical clawed frog
(Silurana tropicalis)
Amphibia murc 34
  • 63.47 (n)
African clawed frog
(Xenopus laevis)
Amphibia Xl.23948 34
(Danio rerio)
Actinopterygii murca 34
  • 58.23 (n)
murcb 35
  • 44 (a)
MURC (1 of 2) 35
  • 36 (a)
Species where no ortholog for MURC was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • fruit fly (Drosophila melanogaster)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • lizard (Anolis carolinensis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea squirt (Ciona intestinalis)
  • sea squirt (Ciona savignyi)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)
  • worm (Caenorhabditis elegans)

Evolution for MURC Gene

Gene Tree for MURC (if available)
Gene Tree for MURC (if available)

Paralogs for MURC Gene

Paralogs for MURC Gene

(1) SIMAP similar genes for MURC Gene using alignment to 1 proteins:

genes like me logo Genes that share paralogs with MURC: view

Variants for MURC Gene

Sequence variations from dbSNP and Humsavar for MURC Gene

SNP ID Clin Chr 09 pos Sequence Context AA Info Type
rs145794010 Likely benign 100,585,875(+) TCTTC(C/G)GATGA reference, synonymous-codon
rs149165620 Likely benign 100,578,386(+) AGCAA(G/T)ACAGG reference, missense
rs565406194 Likely benign 100,586,361(+) ATCCC(C/T)ACCCC reference, synonymous-codon
rs778284038 Likely benign 100,586,295(+) GATGA(A/G)CTCAG reference, synonymous-codon
rs876657508 Likely benign 100,586,058(+) AGGCT(-/AAGGCAGTCAGGAGAGAGGCT)GAGAC cds-indel

Variation tolerance for MURC Gene

Residual Variation Intolerance Score: 64.5% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 2.68; 46.00% of all genes are more intolerant (likely to be disease-causing)

Relevant External Links for MURC Gene

Human Gene Mutation Database (HGMD)
SNPedia medical, phenotypic, and genealogical associations of SNPs for

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot and Structural Variations from Database of Genomic Variants (DGV) for MURC Gene

Disorders for MURC Gene

MalaCards: The human disease database

(2) MalaCards diseases for MURC Gene - From: DISEASES

Disorder Aliases PubMed IDs
  • njovera
  • bouba
- elite association - COSMIC cancer census association via MalaCards
Search MURC in MalaCards View complete list of genes associated with diseases

Relevant External Links for MURC

Genetic Association Database (GAD)
Atlas of Genetics and Cytogenetics in Oncology and Haematology:
genes like me logo Genes that share disorders with MURC: view

No data available for UniProtKB/Swiss-Prot and Genatlas for MURC Gene

Publications for MURC Gene

  1. MURC, a muscle-restricted coiled-coil protein that modulates the Rho/ROCK pathway, induces cardiac dysfunction and conduction disturbance. (PMID: 18332105) Ogata T. … Oh H. (Mol. Cell. Biol. 2008) 2 3 4 64
  2. MURC, a muscle-restricted coiled-coil protein, is involved in the regulation of skeletal myogenesis. (PMID: 18508909) Tagawa M. … Oh H. (Am. J. Physiol., Cell Physiol. 2008) 2 3 64
  3. MURC/cavin-4 Is Co-Expressed with Caveolin-3 in Rhabdomyosarcoma Tumors and Its Silencing Prevents Myogenic Differentiation in the Human Embryonal RD Cell Line. (PMID: 26086601) Faggi F. … Fanzani A. (PLoS ONE 2015) 3 64
  4. A genome-wide association meta-analysis of plasma AI^ peptides concentrations in the elderly. (PMID: 24535457) Chouraki V. … Lambert J.C. (Mol. Psychiatry 2014) 3 64
  5. FSHD myotubes with different phenotypes exhibit distinct proteomes. (PMID: 23272181) Tassin A. … Belayew A. (PLoS ONE 2012) 3 64

Products for MURC Gene

Sources for MURC Gene

Loading form....