Free for academic non-profit institutions. Other users need a Commercial license

Aliases for MTG2 Gene

Aliases for MTG2 Gene

  • Mitochondrial Ribosome Associated GTPase 2 2 3 5
  • Mitochondrial Ribosome-Associated GTPase 2 2 3
  • GTP Binding Protein 5 (Putative) 2 3
  • GTP-Binding Protein 5 3 4
  • Protein Obg Homolog 1 3 4
  • GTPBP5 3 4
  • ObgH1 3 4
  • GTP-Binding Protein 5 (Putative) 2
  • DJ1005F21.2 3

External Ids for MTG2 Gene

Previous HGNC Symbols for MTG2 Gene

  • GTPBP5

Previous GeneCards Identifiers for MTG2 Gene

  • GC20P060759

Summaries for MTG2 Gene

Entrez Gene Summary for MTG2 Gene

  • Small G proteins, such as GTPBP5, act as molecular switches that play crucial roles in the regulation of fundamental cellular processes such as protein synthesis, nuclear transport, membrane trafficking, and signal transduction (Hirano et al., 2006 [PubMed 17054726]).[supplied by OMIM, Mar 2008]

GeneCards Summary for MTG2 Gene

MTG2 (Mitochondrial Ribosome Associated GTPase 2) is a Protein Coding gene. GO annotations related to this gene include GTP binding and magnesium ion binding. An important paralog of this gene is GTPBP10.

UniProtKB/Swiss-Prot for MTG2 Gene

  • Plays a role in the regulation of the mitochondrial ribosome assembly and of translational activity. Displays GTPase activity. Involved in the ribosome maturation process.

No data available for CIViC summary , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for MTG2 Gene

Genomics for MTG2 Gene

Regulatory Elements for MTG2 Gene

Enhancers for MTG2 Gene
GeneHancer Identifier Enhancer Score Enhancer Sources Gene-Enhancer Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor Binding Sites within enhancer Gene Targets for Enhancer
GH20G062140 1.8 FANTOM5 ENCODE dbSUPER 8.7 -40.1 -40120 4.3 PKNOX1 ARNT ZFP64 WRNIP1 ARID4B SIN3A DMAP1 YY1 ZNF766 ZNF143 SS18L1 MTG2 PIR42263 PSMA7
GH20G062134 1.2 ENCODE dbSUPER 11.4 -48.0 -48012 2.0 FOXA2 MLX ARID4B ZNF48 YY1 ZNF143 PAF1 SP5 KAT8 SSRP1 MTG2 SS18L1 GC20M062135 PIR34643
GH20G062185 0.8 Ensembl 14.7 +3.0 2976 0.8 ELF3 TBP ARID4B DMAP1 THRB ZNF48 RAD21 RARA YY1 MIXL1 MTG2 PIR52239
- Elite enhancer and/or Elite enhancer-gene association Download GeneHancer data dump

Enhancers around MTG2 on UCSC Golden Path with GeneCards custom track

Promoters for MTG2 Gene
Ensembl Regulatory Elements (ENSRs) TSS Distance (bp) Size (bp) Binding Sites for Transcription Factors within promoters

Genomic Location for MTG2 Gene

62,183,025 bp from pter
62,203,568 bp from pter
20,544 bases
Plus strand

Genomic View for MTG2 Gene

Genes around MTG2 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
MTG2 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for MTG2 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for MTG2 Gene

Proteins for MTG2 Gene

  • Protein details for MTG2 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Recommended name:
    Mitochondrial ribosome-associated GTPase 2
    Protein Accession:
    Secondary Accessions:
    • A6NDR3
    • B4DR85
    • Q96I17
    • Q9NVG9
    • Q9UFR4

    Protein attributes for MTG2 Gene

    406 amino acids
    Molecular mass:
    43955 Da
    Name=Mg(2+); Xref=ChEBI:CHEBI:18420;
    Quaternary structure:
    • Associates with the mitochondrial ribosome large subunit; the association occurs in a GTP-dependent manner.
    • Sequence=BAA91783.1; Type=Erroneous termination; Positions=402; Note=Translated as Gln.; Evidence={ECO:0000305};

    Alternative splice isoforms for MTG2 Gene


neXtProt entry for MTG2 Gene

Post-translational modifications for MTG2 Gene

  • Ubiquitination at posLast=123123
  • Modification sites at PhosphoSitePlus

No data available for DME Specific Peptides for MTG2 Gene

Domains & Families for MTG2 Gene

Graphical View of Domain Structure for InterPro Entry



  • Belongs to the TRAFAC class OBG-HflX-like GTPase superfamily. OBG GTPase family.
  • Belongs to the TRAFAC class OBG-HflX-like GTPase superfamily. OBG GTPase family.
genes like me logo Genes that share domains with MTG2: view

No data available for Gene Families for MTG2 Gene

Function for MTG2 Gene

Molecular function for MTG2 Gene

UniProtKB/Swiss-Prot Function:
Plays a role in the regulation of the mitochondrial ribosome assembly and of translational activity. Displays GTPase activity. Involved in the ribosome maturation process.

Gene Ontology (GO) - Molecular Function for MTG2 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0000287 magnesium ion binding IEA --
GO:0003924 GTPase activity IDA 23396448
GO:0005525 GTP binding IEA --
GO:0046872 metal ion binding IEA --
genes like me logo Genes that share ontologies with MTG2: view
genes like me logo Genes that share phenotypes with MTG2: view

Animal Model Products

Inhibitory RNA Products

Clone Products

Flow Cytometry Products

No data available for Enzyme Numbers (IUBMB) , Human Phenotype Ontology , Animal Models , Transcription Factor Targets and HOMER Transcription for MTG2 Gene

Localization for MTG2 Gene

Subcellular locations from UniProtKB/Swiss-Prot for MTG2 Gene

Mitochondrion. Mitochondrion inner membrane; Peripheral membrane protein; Matrix side.

Subcellular locations from

Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for MTG2 gene
Compartment Confidence
mitochondrion 5
cytosol 2

Gene Ontology (GO) - Cellular Components for MTG2 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005739 mitochondrion IEA --
GO:0005743 mitochondrial inner membrane IDA,IEA 23396448
GO:0005759 mitochondrial matrix IDA 23396448
GO:0005761 mitochondrial ribosome IDA 23396448
GO:0016020 membrane IEA --
genes like me logo Genes that share ontologies with MTG2: view

Pathways & Interactions for MTG2 Gene

No Data Available

Gene Ontology (GO) - Biological Process for MTG2 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0006417 regulation of translation IEA --
GO:0042254 ribosome biogenesis IEA --
GO:0044065 regulation of respiratory system process IMP 23396448
GO:0070129 regulation of mitochondrial translation IMP 23396448
genes like me logo Genes that share ontologies with MTG2: view

No data available for Pathways by source and SIGNOR curated interactions for MTG2 Gene

Drugs & Compounds for MTG2 Gene

(1) Drugs for MTG2 Gene - From: HMDB

Name Status Disease Links Group Role Mechanism of Action Clinical Trials
Guanosine triphosphate Experimental Pharma 0
genes like me logo Genes that share compounds with MTG2: view

Transcripts for MTG2 Gene

Inhibitory RNA Products

Clone Products

Flow Cytometry Products

Alternative Splicing Database (ASD) splice patterns (SP) for MTG2 Gene

ExUns: 1 ^ 2 ^ 3a · 3b ^ 4a · 4b ^ 5 ^ 6 ^ 7a · 7b · 7c ^ 8a · 8b ^ 9a · 9b · 9c ^ 10a · 10b · 10c · 10d · 10e ^ 11 ^ 12a · 12b
SP1: - - - - - -
SP2: - - - - - - -
SP3: - - - - - - - - - -
SP4: - - - - - - - -
SP5: - - - - -
SP6: - - - - - -
SP7: - - - - - - -
SP8: - - - - - -
SP9: -
SP10: - - - - - - - - -
SP11: - - -
SP12: - - - - - - - - - -
SP13: - - - - - - - - - - - - - - - -
SP14: - - - -
SP15: - - -

Relevant External Links for MTG2 Gene

GeneLoc Exon Structure for
ECgene alternative splicing isoforms for

Expression for MTG2 Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for MTG2 Gene

mRNA expression in embryonic tissues and stem cells from LifeMap Discovery

Protein differential expression in normal tissues from HIPED for MTG2 Gene

This gene is overexpressed in Lung (22.3), Esophagus (15.0), and Colon (14.0).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, PaxDb, MaxQB, and MOPED for MTG2 Gene

NURSA nuclear receptor signaling pathways regulating expression of MTG2 Gene:


Evidence on tissue expression from TISSUES for MTG2 Gene

  • Nervous system(4.7)
  • Intestine(4.2)
  • Muscle(4.2)
  • Skin(2.9)
  • Kidney(2.1)
genes like me logo Genes that share expression patterns with MTG2: view

Primer Products

No data available for mRNA differential expression in normal tissues , Protein tissue co-expression partners , mRNA Expression by UniProt/SwissProt and Phenotype-based relationships between genes and organs from Gene ORGANizer for MTG2 Gene

Orthologs for MTG2 Gene

This gene was present in the common ancestor of eukaryotes.

Orthologs for MTG2 Gene

Organism Taxonomy Gene Similarity Type Details
(Pan troglodytes)
Mammalia GTPBP5 34 35
  • 99.01 (n)
(Canis familiaris)
Mammalia MTG2 34 35
  • 78.95 (n)
(Mus musculus)
Mammalia Mtg2 34 16 35
  • 78.93 (n)
(Rattus norvegicus)
Mammalia Gtpbp5 34
  • 78.49 (n)
(Bos Taurus)
Mammalia GTPBP5 34 35
  • 77.35 (n)
(Monodelphis domestica)
Mammalia MTG2 35
  • 69 (a)
(Ornithorhynchus anatinus)
Mammalia MTG2 35
  • 67 (a)
(Gallus gallus)
Aves GTPBP5 34
  • 64.92 (n)
MTG2 35
  • 62 (a)
(Anolis carolinensis)
Reptilia MTG2 35
  • 63 (a)
tropical clawed frog
(Silurana tropicalis)
Amphibia mtg2 34
  • 65.08 (n)
(Danio rerio)
Actinopterygii mtg2 34 35
  • 63.91 (n)
African malaria mosquito
(Anopheles gambiae)
Insecta AgaP_AGAP009702 34
  • 53.11 (n)
fruit fly
(Drosophila melanogaster)
Insecta CG13390 34 35
  • 49.54 (n)
(Caenorhabditis elegans)
Secernentea M01E5.2 34 35
  • 49.84 (n)
baker's yeast
(Saccharomyces cerevisiae)
Saccharomycetes MTG2 35
  • 26 (a)
thale cress
(Arabidopsis thaliana)
eudicotyledons EMB269 34
  • 45.1 (n)
(Oryza sativa)
Liliopsida Os07g0669200 34
  • 46.1 (n)
sea squirt
(Ciona savignyi)
Ascidiacea -- 35
  • 45 (a)
Species where no ortholog for MTG2 was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)

Evolution for MTG2 Gene

Gene Tree for MTG2 (if available)
Gene Tree for MTG2 (if available)

Paralogs for MTG2 Gene

Paralogs for MTG2 Gene

(1) SIMAP similar genes for MTG2 Gene using alignment to 5 proteins:

genes like me logo Genes that share paralogs with MTG2: view

Variants for MTG2 Gene

Sequence variations from dbSNP and Humsavar for MTG2 Gene

SNP ID Clin Chr 20 pos Sequence Context AA Info Type
rs1000278150 -- 62,183,167(+) AGCGG(-/GAGAGGCCCCGGCCTAGGAGCT)GAGAG intron-variant
rs1000574003 -- 62,195,414(+) ATTTC(A/G)GGAAT intron-variant
rs1000610753 -- 62,201,606(+) TCGGG(A/G)GGCCT utr-variant-3-prime
rs1000635810 -- 62,191,645(+) CCCTC(A/G)TTGTG intron-variant, utr-variant-5-prime
rs1000770872 -- 62,187,839(+) CTCCT(C/T)CTACT intron-variant, upstream-variant-2KB

Structural Variations from Database of Genomic Variants (DGV) for MTG2 Gene

Variant ID Type Subtype PubMed ID
esv2665017 CNV deletion 23128226
esv3646285 CNV loss 21293372
nsv1160689 CNV deletion 26073780
nsv586484 CNV loss 21841781
nsv955149 CNV deletion 24416366

Variation tolerance for MTG2 Gene

Residual Variation Intolerance Score: 96.1% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 3.77; 58.02% of all genes are more intolerant (likely to be disease-causing)

Relevant External Links for MTG2 Gene

Human Gene Mutation Database (HGMD)
SNPedia medical, phenotypic, and genealogical associations of SNPs for

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for MTG2 Gene

Disorders for MTG2 Gene

Relevant External Links for MTG2

Atlas of Genetics and Cytogenetics in Oncology and Haematology:

No disorders were found for MTG2 Gene.

No data available for MalaCards , UniProtKB/Swiss-Prot and Genatlas for MTG2 Gene

Publications for MTG2 Gene

  1. Human G-proteins, ObgH1 and Mtg1, associate with the large mitochondrial ribosome subunit and are involved in translation and assembly of respiratory complexes. (PMID: 23396448) Kotani T. … Takeuchi N. (Nucleic Acids Res. 2013) 2 3 4 64
  2. Human small G proteins, ObgH1, and ObgH2, participate in the maintenance of mitochondria and nucleolar architectures. (PMID: 17054726) Hirano Y. … Takeyasu K. (Genes Cells 2006) 2 3 4 64
  3. Complete sequencing and characterization of 21,243 full-length human cDNAs. (PMID: 14702039) Ota T. … Sugano S. (Nat. Genet. 2004) 3 4 64
  4. The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). (PMID: 15489334) Gerhard D.S. … Malek J. (Genome Res. 2004) 3 4 64
  5. The DNA sequence and comparative analysis of human chromosome 20. (PMID: 11780052) Deloukas P. … Rogers J. (Nature 2001) 3 4 64

Products for MTG2 Gene

Sources for MTG2 Gene

Loading form....