Free for academic non-profit institutions. Other users need a Commercial license

Aliases for MRPL23 Gene

Aliases for MRPL23 Gene

  • Mitochondrial Ribosomal Protein L23 2 3 5
  • L23 Mitochondrial-Related Protein 3 4
  • MRP-L23 3 4
  • RPL23L 3 4
  • L23MRP 3 4
  • L23mt 3 4
  • Ribosomal Protein Related To L23 (Mitochondrial) 3
  • 39S Ribosomal Protein L23, Mitochondrial 3
  • Ribosomal Protein L23-Like 4
  • RPL23 3

External Ids for MRPL23 Gene

Previous HGNC Symbols for MRPL23 Gene

  • RPL23L

Previous GeneCards Identifiers for MRPL23 Gene

  • GC11P000628
  • GC11P002056
  • GC11P001927
  • GC11P001932
  • GC11P001897
  • GC11P001925
  • GC11P001961
  • GC11P001763
  • GC11P001971

Summaries for MRPL23 Gene

Entrez Gene Summary for MRPL23 Gene

  • Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 39S subunit protein. The gene is biallelically expressed, despite its location within a region of imprinted genes on chromosome 11. [provided by RefSeq, Jul 2008]

GeneCards Summary for MRPL23 Gene

MRPL23 (Mitochondrial Ribosomal Protein L23) is a Protein Coding gene. Diseases associated with MRPL23 include Beckwith-Wiedemann Syndrome. Among its related pathways are Mitochondrial translation and Viral mRNA Translation. GO annotations related to this gene include RNA binding and structural constituent of ribosome. An important paralog of this gene is LOC107987373.

Gene Wiki entry for MRPL23 Gene

No data available for UniProtKB/Swiss-Prot , Tocris Summary , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for MRPL23 Gene

Genomics for MRPL23 Gene

Regulatory Elements for MRPL23 Gene

Enhancers for MRPL23 Gene
GeneHancer Identifier Enhancer Score Enhancer Sources Gene-Enhancer Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor Binding Sites within enhancer Gene Targets for Enhancer
GH11F001903 0.4 ENCODE 14.8 -43.5 -43463 0.9 GLIS1 MNT MRPL23 LINC01150 TNNT3
GH11F001896 1 Ensembl ENCODE 13 -50.0 -49972 1.4 SRF CTCF RNF2 TRIM22 BMI1 ZBTB7A RAD21 POLR2A ZBTB33 TNNT3 MRPL23 MRPL23-AS1 LINC01150
GH11F001942 0.2 Ensembl 0.8 -4.7 -4672 0.8 ZNF24 MRPL23-AS1 TNNT3 MRPL23
GH11F001943 0.5 Ensembl 0.8 -3.2 -3249 0.8 HIC1 ZNF24 ZBTB7A MRPL23 TNNT3
GH11F001937 0.5 Ensembl ENCODE 0.4 -8.3 -8294 2.6 HDGF ZFHX2 BHLHE40 NBN EGR2 LSP1 MIR7847 TNNT3 MRPL23
- Elite enhancer/Elite enhancer-gene association Download Table
Download GeneHancer data dump

Enhancers around MRPL23 on UCSC Golden Path with GeneCards custom track

Promoters for MRPL23 Gene
Ensembl Regulatory Elements (ENSRs) TSS Distance (bp) Size (bp) Binding Sites for Transcription Factors within promoters
ENSR00001601274 428 2201 ATF1 CREB3L1 ARID4B SIN3A DMAP1 ZNF48 YY1 GLIS2 ELK1 ZNF143

Genomic Location for MRPL23 Gene

1,947,272 bp from pter
2,014,017 bp from pter
66,746 bases
Plus strand

Genomic View for MRPL23 Gene

Genes around MRPL23 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
MRPL23 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for MRPL23 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for MRPL23 Gene

Proteins for MRPL23 Gene

  • Protein details for MRPL23 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Recommended name:
    39S ribosomal protein L23, mitochondrial
    Protein Accession:
    Secondary Accessions:
    • A8MT29
    • Q96Q71

    Protein attributes for MRPL23 Gene

    153 amino acids
    Molecular mass:
    17781 Da
    Quaternary structure:
    • Component of the mitochondrial ribosome large subunit (39S) which comprises a 16S rRNA and about 50 distinct proteins.

    Three dimensional structures from OCA and Proteopedia for MRPL23 Gene

neXtProt entry for MRPL23 Gene

Post-translational modifications for MRPL23 Gene

  • Modification sites at PhosphoSitePlus
  • Modification sites at neXtProt

No data available for DME Specific Peptides for MRPL23 Gene

Domains & Families for MRPL23 Gene

Gene Families for MRPL23 Gene

Suggested Antigen Peptide Sequences for MRPL23 Gene

GenScript: Design optimal peptide antigens:

Graphical View of Domain Structure for InterPro Entry



  • Belongs to the ribosomal protein L23P family.
  • Belongs to the ribosomal protein L23P family.
genes like me logo Genes that share domains with MRPL23: view

Function for MRPL23 Gene

Gene Ontology (GO) - Molecular Function for MRPL23 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0000166 nucleotide binding IEA --
GO:0003723 RNA binding TAS 8541832
GO:0003735 structural constituent of ribosome IEA --
GO:0005515 protein binding IPI 25416956
genes like me logo Genes that share ontologies with MRPL23: view
genes like me logo Genes that share phenotypes with MRPL23: view

Animal Model Products

miRNA for MRPL23 Gene

miRTarBase miRNAs that target MRPL23

Inhibitory RNA Products

Flow Cytometry Products

No data available for Molecular function , Enzyme Numbers (IUBMB) , Human Phenotype Ontology , Animal Models , Transcription Factor Targets and HOMER Transcription for MRPL23 Gene

Localization for MRPL23 Gene

Subcellular locations from UniProtKB/Swiss-Prot for MRPL23 Gene


Subcellular locations from

Jensen Localization Image for MRPL23 Gene COMPARTMENTS Subcellular localization image for MRPL23 gene
Compartment Confidence
mitochondrion 5
nucleus 5

Gene Ontology (GO) - Cellular Components for MRPL23 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005622 intracellular IEA --
GO:0005730 nucleolus IDA --
GO:0005739 mitochondrion IEA,IDA --
GO:0005743 mitochondrial inner membrane TAS --
GO:0005762 mitochondrial large ribosomal subunit IDA,TAS 25278503
genes like me logo Genes that share ontologies with MRPL23: view

Pathways & Interactions for MRPL23 Gene

genes like me logo Genes that share pathways with MRPL23: view

Gene Ontology (GO) - Biological Process for MRPL23 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0006412 translation IEA,TAS 8541832
GO:0032543 mitochondrial translation IBA --
GO:0070125 mitochondrial translational elongation TAS --
GO:0070126 mitochondrial translational termination TAS --
genes like me logo Genes that share ontologies with MRPL23: view

No data available for SIGNOR curated interactions for MRPL23 Gene

Transcripts for MRPL23 Gene

Unigene Clusters for MRPL23 Gene

Mitochondrial ribosomal protein L23:
Representative Sequences:

Inhibitory RNA Products

Flow Cytometry Products

Alternative Splicing Database (ASD) splice patterns (SP) for MRPL23 Gene

No ASD Table

Relevant External Links for MRPL23 Gene

GeneLoc Exon Structure for
ECgene alternative splicing isoforms for

Expression for MRPL23 Gene

mRNA expression in normal human tissues for MRPL23 Gene

Protein differential expression in normal tissues from HIPED for MRPL23 Gene

This gene is overexpressed in Lung (28.9) and Pancreas (7.5).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, PaxDb, MaxQB, and MOPED for MRPL23 Gene

Protein tissue co-expression partners for MRPL23 Gene

- Elite partner

NURSA nuclear receptor signaling pathways regulating expression of MRPL23 Gene:


SOURCE GeneReport for Unigene cluster for MRPL23 Gene:

genes like me logo Genes that share expression patterns with MRPL23: view

Primer Products

No data available for mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , mRNA differential expression in normal tissues and mRNA Expression by UniProt/SwissProt for MRPL23 Gene

Orthologs for MRPL23 Gene

This gene was present in the common ancestor of animals.

Orthologs for MRPL23 Gene

Organism Taxonomy Gene Similarity Type Details
(Pan troglodytes)
Mammalia MRPL23 34 35
  • 98.87 (n)
(Canis familiaris)
Mammalia MRPL23 34 35
  • 83.77 (n)
(Mus musculus)
Mammalia Mrpl23 34 16 35
  • 80.46 (n)
(Bos Taurus)
Mammalia MRPL23 34 35
  • 80 (n)
(Rattus norvegicus)
Mammalia Mrpl23 34
  • 79.45 (n)
(Monodelphis domestica)
Mammalia MRPL23 35
  • 76 (a)
(Gallus gallus)
Aves MRPL23 34 35
  • 71.93 (n)
(Anolis carolinensis)
Reptilia MRPL23 35
  • 76 (a)
tropical clawed frog
(Silurana tropicalis)
Amphibia mrpl23 34
  • 64.71 (n)
Str.11979 34
African clawed frog
(Xenopus laevis)
Amphibia Xl.6464 34
(Danio rerio)
Actinopterygii mrpl23 34 35
  • 61.44 (n)
Dr.11081 34
rainbow trout
(Oncorhynchus mykiss)
Actinopterygii Omy.9515 34
fruit fly
(Drosophila melanogaster)
Insecta mRpL23 34 35
  • 51.28 (n)
African malaria mosquito
(Anopheles gambiae)
Insecta RM23_ANOGA 34
  • 48.38 (n)
(Caenorhabditis elegans)
Secernentea mrpl-23 35
  • 33 (a)
sea squirt
(Ciona savignyi)
Ascidiacea -- 35
  • 24 (a)
Species where no ortholog for MRPL23 was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • platypus (Ornithorhynchus anatinus)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)

Evolution for MRPL23 Gene

Gene Tree for MRPL23 (if available)
Gene Tree for MRPL23 (if available)

Paralogs for MRPL23 Gene

Paralogs for MRPL23 Gene Pseudogenes for MRPL23 Gene

genes like me logo Genes that share paralogs with MRPL23: view

Variants for MRPL23 Gene

Sequence variations from dbSNP and Humsavar for MRPL23 Gene

SNP ID Clin Chr 11 pos Sequence Context AA Info Type
rs431825163 untested 2,001,815(+) GGAAT(A/G)TTAAT intron-variant, upstream-variant-2KB
rs431825164 untested 2,001,083(+) CCCCC(A/G)ATGAC intron-variant
rs431825165 untested 2,001,763(+) GCTCT(-/TTAGCATCTCAAGCTCCTAAA)TTAGC intron-variant, upstream-variant-2KB
rs431825166 untested 2,000,708(+) TGGCT(A/T)GCGGG intron-variant
rs431825167 untested 2,000,108(+) CCCTG(A/C)GAGAA intron-variant

Structural Variations from Database of Genomic Variants (DGV) for MRPL23 Gene

Variant ID Type Subtype PubMed ID
dgv1015n100 CNV gain 25217958
dgv1016n100 CNV gain 25217958
esv1010623 CNV deletion 20482838
esv1696864 CNV deletion 17803354
esv2041292 CNV deletion 18987734
esv2677244 CNV deletion 23128226
esv2743985 CNV deletion 23290073
esv2743987 CNV deletion 23290073
esv29980 CNV loss 17803354
esv3579243 CNV loss 25503493
nsv1047474 CNV gain 25217958
nsv1069998 CNV deletion 25765185
nsv1121471 CNV deletion 24896259
nsv1124546 CNV deletion 24896259
nsv1130654 CNV deletion 24896259
nsv1149802 CNV deletion 26484159
nsv1153324 CNV deletion 26484159
nsv467645 CNV gain 19166990
nsv469926 CNV loss 18288195
nsv516622 CNV loss 19592680
nsv522320 CNV loss 19592680
nsv553047 CNV gain 21841781
nsv553063 CNV loss 21841781
nsv553064 CNV loss 21841781
nsv62 OTHER inversion 15895083
nsv7213 OTHER inversion 18451855
nsv825703 CNV gain 20364138
nsv951283 CNV deletion 24416366

Variation tolerance for MRPL23 Gene

Residual Variation Intolerance Score: 84.9% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 7.68; 82.96% of all genes are more intolerant (likely to be disease-causing)

Relevant External Links for MRPL23 Gene

SNPedia medical, phenotypic, and genealogical associations of SNPs for

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for MRPL23 Gene

Disorders for MRPL23 Gene

MalaCards: The human disease database

(1) MalaCards diseases for MRPL23 Gene - From: DISEASES and GeneCards

Disorder Aliases PubMed IDs
beckwith-wiedemann syndrome
  • wiedemann-beckwith syndrome
- elite association - COSMIC cancer census association via MalaCards

Relevant External Links for MRPL23

Genetic Association Database (GAD)
Human Genome Epidemiology (HuGE) Navigator
Atlas of Genetics and Cytogenetics in Oncology and Haematology:
genes like me logo Genes that share disorders with MRPL23: view

No data available for UniProtKB/Swiss-Prot and Genatlas for MRPL23 Gene

Publications for MRPL23 Gene

  1. A novel L23-related gene 40 kb downstream of the imprinted H19 gene is biallelically expressed in mid-fetal and adult human tissues. (PMID: 8541832) Tsang P. … Tycko B. (Hum. Mol. Genet. 1995) 2 3 4 22 64
  2. Structure of the large ribosomal subunit from human mitochondria. (PMID: 25278503) Brown A. … Ramakrishnan V. (Science 2014) 3 4 64
  3. Genetic variants in nuclear-encoded mitochondrial genes influence AIDS progression. (PMID: 20877624) Hendrickson S.L. … O'Brien S.J. (PLoS ONE 2010) 3 46 64
  4. Association between invasive ovarian cancer susceptibility and 11 best candidate SNPs from breast cancer genome-wide association study. (PMID: 19304784) Song H. … Pharoah P.D. (Hum. Mol. Genet. 2009) 3 46 64
  5. The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). (PMID: 15489334) Gerhard D.S. … Malek J. (Genome Res. 2004) 3 4 64

Products for MRPL23 Gene

Sources for MRPL23 Gene

Loading form....