Free for academic non-profit institutions. Other users need a Commercial license

Aliases for MRFAP1L1 Gene

Aliases for MRFAP1L1 Gene

  • Morf4 Family Associated Protein 1-Like 1 2 3
  • MORF4 Family-Associated Protein 1-Like 1 3
  • PP784 3

External Ids for MRFAP1L1 Gene

Previous GeneCards Identifiers for MRFAP1L1 Gene

  • GC04M006828
  • GC04M006709
  • GC04M006641

Summaries for MRFAP1L1 Gene

GeneCards Summary for MRFAP1L1 Gene

MRFAP1L1 (Morf4 Family Associated Protein 1-Like 1) is a Protein Coding gene. An important paralog of this gene is MRFAP1.

No data available for Entrez Gene Summary , UniProtKB/Swiss-Prot , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for MRFAP1L1 Gene

Genomics for MRFAP1L1 Gene

Regulatory Elements for MRFAP1L1 Gene

Epigenetics Products

  • DNA Methylation CpG Assay Predesigned for Pyrosequencing in human,mouse,rat

Genomic Location for MRFAP1L1 Gene

6,707,701 bp from pter
6,709,880 bp from pter
2,180 bases
Minus strand

Genomic View for MRFAP1L1 Gene

UCSC Golden Path with GeneCards custom track
Cytogenetic band:
Genomic Location for MRFAP1L1 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for MRFAP1L1 Gene

Proteins for MRFAP1L1 Gene

  • Protein details for MRFAP1L1 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Recommended name:
    MORF4 family-associated protein 1-like 1
    Protein Accession:
    Secondary Accessions:
    • B2R6R0
    • Q6NXT8
    • Q9P0J5

    Protein attributes for MRFAP1L1 Gene

    127 amino acids
    Molecular mass:
    14808 Da
    Quaternary structure:
    No Data Available
    • Sequence=AAF67011.1; Type=Frameshift; Positions=89; Evidence={ECO:0000305};

neXtProt entry for MRFAP1L1 Gene

Proteomics data for MRFAP1L1 Gene at MOPED

Post-translational modifications for MRFAP1L1 Gene

  • Ubiquitination at Lys56 and Lys99
  • Modification sites at PhosphoSitePlus

Other Protein References for MRFAP1L1 Gene

ENSEMBL proteins:
REFSEQ proteins:

No data available for DME Specific Peptides for MRFAP1L1 Gene

Domains for MRFAP1L1 Gene

Protein Domains for MRFAP1L1 Gene


Suggested Antigen Peptide Sequences for MRFAP1L1 Gene

GenScript: Design optimal peptide antigens:

Graphical View of Domain Structure for InterPro Entry



  • Belongs to the MORF4 family-associated protein family.
  • Belongs to the MORF4 family-associated protein family.
genes like me logo Genes that share domains with MRFAP1L1: view

No data available for Gene Families for MRFAP1L1 Gene

Function for MRFAP1L1 Gene

Gene Ontology (GO) - Molecular Function for MRFAP1L1 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005515 protein binding IPI 16189514
GO:0042802 identical protein binding IPI 25416956
genes like me logo Genes that share ontologies with MRFAP1L1: view

Phenotypes for MRFAP1L1 Gene

genes like me logo Genes that share phenotypes with MRFAP1L1: view

Animal Model Products

CRISPR Products

miRNA Products

Inhibitory RNA Products

  • Predesigned siRNA for gene silencing in human,mouse,rat for MRFAP1L1

In Situ Assay Products

Flow Cytometry Products

No data available for Molecular function , Enzyme Numbers (IUBMB) , Animal Models , miRNA , Transcription Factor Targets and HOMER Transcription for MRFAP1L1 Gene

Localization for MRFAP1L1 Gene

Subcellular locations from

Jensen Localization Image for MRFAP1L1 Gene COMPARTMENTS Subcellular localization image for MRFAP1L1 gene
Compartment Confidence
cytosol 2
nucleus 2
extracellular 1

No data available for Subcellular locations from UniProtKB/Swiss-Prot and Gene Ontology (GO) - Cellular Components for MRFAP1L1 Gene

Pathways for MRFAP1L1 Gene

SuperPathways for MRFAP1L1 Gene

No Data Available

Gene Ontology (GO) - Biological Process for MRFAP1L1 Gene


No data available for Pathways by source for MRFAP1L1 Gene

Transcripts for MRFAP1L1 Gene

mRNA/cDNA for MRFAP1L1 Gene

Unigene Clusters for MRFAP1L1 Gene

Morf4 family associated protein 1-like 1:
Representative Sequences:

CRISPR Products

miRNA Products

Inhibitory RNA Products

  • Predesigned siRNA for gene silencing in human,mouse,rat for MRFAP1L1

Flow Cytometry Products

Alternative Splicing Database (ASD) splice patterns (SP) for MRFAP1L1 Gene

ExUns: 1a · 1b ^ 2

Relevant External Links for MRFAP1L1 Gene

GeneLoc Exon Structure for
ECgene alternative splicing isoforms for

Expression for MRFAP1L1 Gene

mRNA expression in normal human tissues for MRFAP1L1 Gene

Protein differential expression in normal tissues for MRFAP1L1 Gene

This gene is overexpressed in Peripheral blood mononuclear cells (69.0).

Integrated Proteomics: protein expression from ProteomicsDB, PaxDb, and MOPED for MRFAP1L1 Gene

SOURCE GeneReport for Unigene cluster for MRFAP1L1 Gene Hs.593159

genes like me logo Genes that share expressions with MRFAP1L1: view

Expression partners for MRFAP1L1 Gene

* - Elite partner

Primer Products

  • QuantiTect SYBR Green Assays in human,mouse,rat
  • Pre-validated RT² qPCR Primer Assay in human,mouse,rat
  • QuantiFast Probe-based Assays in human,mouse,rat

In Situ Assay Products

No data available for mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , mRNA differential expression in normal tissues and mRNA Expression by UniProt/SwissProt for MRFAP1L1 Gene

Orthologs for MRFAP1L1 Gene

This gene was present in the common ancestor of human and chimp.

Orthologs for MRFAP1L1 Gene

Organism Taxonomy Gene Similarity Type Details
(Pan troglodytes)
Mammalia MRFAP1L1 35
  • 99.74 (n)
  • 100 (a)
  • 100 (a)
Species with no ortholog for MRFAP1L1:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • chicken (Gallus gallus)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • cow (Bos Taurus)
  • dog (Canis familiaris)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • fruit fly (Drosophila melanogaster)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • lizard (Anolis carolinensis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • mouse (Mus musculus)
  • oppossum (Monodelphis domestica)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • platypus (Ornithorhynchus anatinus)
  • rainbow trout (Oncorhynchus mykiss)
  • rat (Rattus norvegicus)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea squirt (Ciona intestinalis)
  • sea squirt (Ciona savignyi)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • tropical clawed frog (Silurana tropicalis)
  • wheat (Triticum aestivum)
  • worm (Caenorhabditis elegans)
  • zebrafish (Danio rerio)

Evolution for MRFAP1L1 Gene

Gene Tree for MRFAP1L1 (if available)
Gene Tree for MRFAP1L1 (if available)

Paralogs for MRFAP1L1 Gene

Paralogs for MRFAP1L1 Gene

(1) SIMAP similar genes for MRFAP1L1 Gene using alignment to 1 proteins: Pseudogenes for MRFAP1L1 Gene

genes like me logo Genes that share paralogs with MRFAP1L1: view

Variants for MRFAP1L1 Gene

Sequence variations from dbSNP and Humsavar for MRFAP1L1 Gene

SNP ID Clin Chr 04 pos Sequence Context AA Info Type MAF
rs578240488 -- 6,709,871(+) GCAGC(C/G)GTCAA utr-variant-5-prime, upstream-variant-2KB
rs578236701 -- 6,709,251(+) TCAAG(A/T)AGACT missense, reference
rs577912039 -- 6,708,784(+) ATAGA(-/ACAATCTGGAAATTTCAGGTAATGGCCTCTGG)CTTTA intron-variant
rs577762022 -- 6,710,518(+) CAGGG(C/T)CTTAG upstream-variant-2KB
rs577279315 -- 6,707,746(+) TTGGT(A/C)ATGTG utr-variant-3-prime

Structural Variations from Database of Genomic Variants (DGV) for MRFAP1L1 Gene

Variant ID Type Subtype PubMed ID
esv34196 OTHER Inversion 12058347

Relevant External Links for MRFAP1L1 Gene

HapMap Linkage Disequilibrium report

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for MRFAP1L1 Gene

Disorders for MRFAP1L1 Gene

Relevant External Links for MRFAP1L1

Genetic Association Database (GAD)

No disorders were found for MRFAP1L1 Gene.

No data available for MalaCards , OMIM , UniProtKB/Swiss-Prot , University of Copenhagen DISEASES , Novoseek inferred disease relationships and Genatlas for MRFAP1L1 Gene

Publications for MRFAP1L1 Gene

  1. Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences. (PMID: 12477932) Strausberg R.L. … Marra M.A. (Proc. Natl. Acad. Sci. U.S.A. 2002) 2 3
  2. Towards a proteome-scale map of the human protein-protein interaction network. (PMID: 16189514) Rual J.F. … Vidal M. (Nature 2005) 3
  3. hORFeome v3.1: a resource of human open reading frames representing over 10,000 human genes. (PMID: 17207965) Lamesch P. … Vidal M. (Genomics 2007) 3
  4. Mass spectrometric analysis of lysine ubiquitylation reveals promiscuity at site level. (PMID: 21139048) Danielsen J.M. … Nielsen M.L. (Mol. Cell Proteomics 2011) 3
  5. A proteome-wide, quantitative survey of in vivo ubiquitylation sites reveals widespread regulatory roles. (PMID: 21890473) Wagner S.A. … Choudhary C. (Mol. Cell Proteomics 2011) 3

Products for MRFAP1L1 Gene

  • DNA Methylation CpG Assay Predesigned for Pyrosequencing in human,mouse,rat
  • QIAGEN qRT-PCR Assays for microRNAs that regulate MRFAP1L1
  • QuantiTect SYBR Green Assays in human,mouse,rat
  • Pre-validated RT² qPCR Primer Assay in human,mouse,rat
  • QuantiFast Probe-based Assays in human,mouse,rat
  • Predesigned siRNA for gene silencing in human,mouse,rat for MRFAP1L1
  • Block miRNA regulation of MRFAP1L1 using miScript Target Protectors

Sources for MRFAP1L1 Gene

Back to Top
