Free for academic non-profit institutions. Other users need a Commercial license

Aliases for MMAB Gene

Aliases for MMAB Gene

  • Methylmalonic Aciduria (Cobalamin Deficiency) CblB Type 2 3 5
  • Cilia And Flagella Associated Protein 23 2 3
  • Methylmalonic Aciduria Type B Protein 3 4
  • ATP:Cob(I)Alamin Adenosyltransferase 2 3
  • Cob(I)Yrinic Acid A,C-Diamide Adenosyltransferase, Mitochondrial 3
  • Methylmalonic Aciduria (Cobalamin Deficiency) Type B 2
  • Aquocob(I)Alamin Vitamin B12s Adenosyltransferase 3
  • ATP:Corrinoid Adenosyltransferase 3
  • Cob(I)Alamin Adenosyltransferase 4
  • EC 2.5.1.17 4
  • CFAP23 3
  • CblB 3
  • ATR 3
  • Cob 3

External Ids for MMAB Gene

Previous GeneCards Identifiers for MMAB Gene

  • GC12U900014
  • GC12M109886
  • GC12M108455
  • GC12M109991
  • GC12M107009

Summaries for MMAB Gene

Entrez Gene Summary for MMAB Gene

  • This gene encodes a protein that catalyzes the final step in the conversion of vitamin B(12) into adenosylcobalamin (AdoCbl), a vitamin B12-containing coenzyme for methylmalonyl-CoA mutase. Mutations in the gene are the cause of vitamin B12-dependent methylmalonic aciduria linked to the cblB complementation group. Alternatively spliced transcript variants have been found. [provided by RefSeq, Apr 2011]

GeneCards Summary for MMAB Gene

MMAB (Methylmalonic Aciduria (Cobalamin Deficiency) CblB Type) is a Protein Coding gene. Diseases associated with MMAB include Methylmalonic Aciduria, Cblb Type and Isolated Methylmalonic Acidemia. Among its related pathways are Metabolism and Metabolism of water-soluble vitamins and cofactors. Gene Ontology (GO) annotations related to this gene include cob(I)yrinic acid a,c-diamide adenosyltransferase activity.

UniProtKB/Swiss-Prot for MMAB Gene

  • Adenosyltransferase involved in intracellular vitamin B12 metabolism. Generates adenosylcobalamin (AdoCbl) and directly delivers the cofactor to MUT in a transfer taht is stimulated by ATP-binding to MMAB and gated by MMAA.

Gene Wiki entry for MMAB Gene

Additional gene information for MMAB Gene

No data available for CIViC summary , Tocris Summary , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for MMAB Gene

Genomics for MMAB Gene

GeneHancer (GH) Regulatory Elements for MMAB Gene

Promoters and enhancers for MMAB Gene
GeneHancer (GH) Identifier GH Type GH
Score
GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites
Gene Targets
GH12I109571 Promoter/Enhancer 2.1 EPDnew Ensembl ENCODE 550.8 +0.7 700 3.2 CLOCK DMAP1 YY1 SLC30A9 ZNF213 E2F8 ZNF143 SP3 NFYC MEF2D MVK MMAB RNU4-32P UBE3B KCTD10 GPN3 MYO1H GC12M109566
GH12I109713 Promoter/Enhancer 2.2 EPDnew Ensembl ENCODE dbSUPER 10.7 -141.5 -141517 3.7 PKNOX1 FOXA2 ARNT ARID4B SIN3A ZNF2 ZNF766 ZNF213 E2F8 ZNF143 FAM222A GC12P109715 RNU4-32P MMAB MVK TRPV4 UBE3B
GH12I109540 Enhancer 0.8 ENCODE dbSUPER 19.2 +31.7 31706 3 CTCF RARA SKI ZNF23 MLLT1 SMAD4 RCOR1 CHD2 ZBTB17 SPI1 KCTD10 MVK MMAB RNU4-32P MYO1H PIR34953 GC12M109568 UBE3B
GH12I109612 Enhancer 0.8 dbSUPER 18.9 -43.9 -43930 11 PKNOX1 ATF1 FOXA2 RAD21 GLIS2 ZNF366 RCOR1 ATF7 CREM SMARCA5 GC12M109613 MYO1H MMAB MVK KCTD10 RNU4-32P FAM222A FAM222A-AS1 UBE3B ACACB
GH12I109595 Enhancer 0.7 Ensembl dbSUPER 19 -21.6 -21585 0.5 POLR2A IKZF1 IKZF2 RUNX3 SPI1 MMAB MYO1H MVK RNU4-32P ENSG00000249094 GLTP TRPV4 ENSG00000255655 KCTD10 GC12M109613
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data dump

GeneHancers around MMAB on UCSC Golden Path with GeneCards custom track

Top Transcription factor binding sites by QIAGEN in the MMAB gene promoter:

Genomic Locations for MMAB Gene

Genomic Locations for MMAB Gene
chr12:109,553,715-109,573,874
(GRCh38/hg38)
Size:
20,160 bases
Orientation:
Minus strand
chr12:109,991,520-110,011,679
(GRCh37/hg19)

Genomic View for MMAB Gene

Genes around MMAB on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
MMAB Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for MMAB Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for MMAB Gene

Proteins for MMAB Gene

  • Protein details for MMAB Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Q96EY8-MMAB_HUMAN
    Recommended name:
    Cob(I)yrinic acid a,c-diamide adenosyltransferase, mitochondrial
    Protein Accession:
    Q96EY8
    Secondary Accessions:
    • C5HU05
    • Q9BSH0

    Protein attributes for MMAB Gene

    Size:
    250 amino acids
    Molecular mass:
    27388 Da
    Quaternary structure:
    • Homotrimer.

    Three dimensional structures from OCA and Proteopedia for MMAB Gene

neXtProt entry for MMAB Gene

Post-translational modifications for MMAB Gene

No Post-translational modifications

No data available for DME Specific Peptides for MMAB Gene

Domains & Families for MMAB Gene

Gene Families for MMAB Gene

HGNC:
Human Protein Atlas (HPA):
  • Disease related genes
  • Enzymes
  • Potential drug targets
  • Predicted intracellular proteins

Protein Domains for MMAB Gene

Suggested Antigen Peptide Sequences for MMAB Gene

GenScript: Design optimal peptide antigens:

Graphical View of Domain Structure for InterPro Entry

Q96EY8

UniProtKB/Swiss-Prot:

MMAB_HUMAN :
  • Belongs to the Cob(I)alamin adenosyltransferase family.
Family:
  • Belongs to the Cob(I)alamin adenosyltransferase family.
genes like me logo Genes that share domains with MMAB: view

Function for MMAB Gene

Molecular function for MMAB Gene

UniProtKB/Swiss-Prot CatalyticActivity:
ATP + cob(I)yrinic acid a,c-diamide = triphosphate + adenosylcob(III)yrinic acid a,c-diamide.
UniProtKB/Swiss-Prot CatalyticActivity:
ATP + cobinamide = triphosphate + adenosylcobinamide.
UniProtKB/Swiss-Prot Function:
Adenosyltransferase involved in intracellular vitamin B12 metabolism. Generates adenosylcobalamin (AdoCbl) and directly delivers the cofactor to MUT in a transfer taht is stimulated by ATP-binding to MMAB and gated by MMAA.

Enzyme Numbers (IUBMB) for MMAB Gene

Phenotypes From GWAS Catalog for MMAB Gene

Gene Ontology (GO) - Molecular Function for MMAB Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005515 protein binding IPI 25910212
GO:0005524 ATP binding IEA --
GO:0008817 cob(I)yrinic acid a,c-diamide adenosyltransferase activity TAS --
GO:0016740 transferase activity IEA --
GO:0031419 cobalamin binding IDA 28497574
genes like me logo Genes that share ontologies with MMAB: view

Phenotypes for MMAB Gene

genes like me logo Genes that share phenotypes with MMAB: view

Human Phenotype Ontology for MMAB Gene

HPO Id HPO Name Alternative Ids Definition Synonyms

Animal Model Products

CRISPR Products

miRNA for MMAB Gene

miRTarBase miRNAs that target MMAB

Inhibitory RNA Products

No data available for Animal Models , Transcription Factor Targets and HOMER Transcription for MMAB Gene

Localization for MMAB Gene

Subcellular locations from UniProtKB/Swiss-Prot for MMAB Gene

Mitochondrion.

Subcellular locations from

COMPARTMENTS
Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for MMAB gene
Compartment Confidence
mitochondrion 5
peroxisome 1
nucleus 1
cytosol 1

Subcellular locations from the

Human Protein Atlas (HPA)

Gene Ontology (GO) - Cellular Components for MMAB Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005739 mitochondrion IEA --
GO:0005759 mitochondrial matrix TAS --
genes like me logo Genes that share ontologies with MMAB: view

Pathways & Interactions for MMAB Gene

genes like me logo Genes that share pathways with MMAB: view

UniProtKB/Swiss-Prot Q96EY8-MMAB_HUMAN

  • Pathway: Cofactor biosynthesis; adenosylcobalamin biosynthesis; adenosylcobalamin from cob(II)yrinate a,c-diamide: step 2/7.

Gene Ontology (GO) - Biological Process for MMAB Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0009235 cobalamin metabolic process TAS 28497574
GO:0009236 cobalamin biosynthetic process IEA --
genes like me logo Genes that share ontologies with MMAB: view

No data available for SIGNOR curated interactions for MMAB Gene

Drugs & Compounds for MMAB Gene

(8) Drugs for MMAB Gene - From: DrugBank, HMDB, and Novoseek

Name Status Disease Links Group Role Mechanism of Action Clinical Trials
Hydroxocobalamin Approved Pharma Target, other 337
Cyanocobalamin Approved Nutra Enzyme, substrate 337
Cobamamide Approved Pharma 0
Manganese Approved Nutra 37
PPPi Experimental Pharma 0

(7) Additional Compounds for MMAB Gene - From: HMDB

Name Synonyms Role CAS Number PubChem IDs PubMed IDs
Adenosyl cobinamide
  • 5'-Deoxy-5'-adenosylcobinamide
  • Adenosylcobinamide
Adenosyl cobyrinic acid a,c diamide
  • Adenosyl cobyrinate a,c diamide
  • Adenosylcob(III)yrinic acid a,c-diamide
  • Adenosyl cobyrinate diamide
  • Adenosylcobyrinic acid a,c-diamide
adenosylcob(III)yrinic acid a,c-diamide
Cob(I)alamin
  • Cob(I)alamin
  • Cyanocobalamin
  • Hydrido-Cobalamin
  • Hydridocobalamin
  • Vitamin B12s
18534-66-2
Cob(I)yrinate a,c diamide
  • Cob(I)yrinate diamide
  • Cob(I)yrinic acid a,c-diamide
genes like me logo Genes that share compounds with MMAB: view

Transcripts for MMAB Gene

Unigene Clusters for MMAB Gene

Methylmalonic aciduria (cobalamin deficiency) cblB type:
Representative Sequences:

CRISPR Products

Inhibitory RNA Products

Alternative Splicing Database (ASD) splice patterns (SP) for MMAB Gene

ExUns: 1a · 1b · 1c · 1d · 1e · 1f ^ 2 ^ 3 ^ 4a · 4b ^ 5 ^ 6 ^ 7a · 7b ^ 8a · 8b ^ 9 ^ 10 ^ 11 ^ 12 ^ 13a · 13b · 13c · 13d
SP1: - - - - - - -
SP2: - - - - - -
SP3: - - - - - - -
SP4: - - - - - -
SP5: - - - - - - - - -
SP6: - - - - - - - - -
SP7: - - - - - - - -
SP8: - - - - - - - -
SP9: - - - -
SP10: -
SP11: - - - - -
SP12: - - -
SP13: - - - -
SP14: - -
SP15: -

Relevant External Links for MMAB Gene

GeneLoc Exon Structure for
MMAB
ECgene alternative splicing isoforms for
MMAB

Expression for MMAB Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for MMAB Gene

mRNA differential expression in normal tissues according to GTEx for MMAB Gene

This gene is overexpressed in Liver (x4.0).

Protein differential expression in normal tissues from HIPED for MMAB Gene

This gene is overexpressed in Liver (8.0) and Fetal testis (6.5).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, PaxDb, MaxQB, and MOPED for MMAB Gene



Protein tissue co-expression partners for MMAB Gene

- Elite partner

NURSA nuclear receptor signaling pathways regulating expression of MMAB Gene:

MMAB

SOURCE GeneReport for Unigene cluster for MMAB Gene:

Hs.12106

mRNA Expression by UniProt/SwissProt for MMAB Gene:

Q96EY8-MMAB_HUMAN
Tissue specificity: Expressed in liver and skeletal muscle.

Evidence on tissue expression from TISSUES for MMAB Gene

  • Liver(4.4)
  • Lung(4.2)
  • Nervous system(2)

Phenotype-based relationships between genes and organs from Gene ORGANizer for MMAB Gene

Germ Layers:
  • ectoderm
  • endoderm
  • mesoderm
Systems:
  • cardiovascular
  • digestive
  • immune
  • lymphatic
  • nervous
  • respiratory
  • skeletal muscle
Organs:
Head and neck:
  • brain
  • head
Thorax:
  • esophagus
  • lung
Abdomen:
  • liver
  • stomach
General:
  • blood
  • bone marrow
  • coagulation system
  • red blood cell
  • white blood cell
genes like me logo Genes that share expression patterns with MMAB: view

No data available for mRNA expression in embryonic tissues and stem cells from LifeMap Discovery for MMAB Gene

Orthologs for MMAB Gene

This gene was present in the common ancestor of animals.

Orthologs for MMAB Gene

Organism Taxonomy Gene Similarity Type Details
chimpanzee
(Pan troglodytes)
Mammalia MMAB 33 34
  • 98.61 (n)
dog
(Canis familiaris)
Mammalia MMAB 33 34
  • 88.13 (n)
cow
(Bos Taurus)
Mammalia MMAB 33 34
  • 87.95 (n)
mouse
(Mus musculus)
Mammalia Mmab 33 16 34
  • 86.15 (n)
rat
(Rattus norvegicus)
Mammalia Mmab 33
  • 82.97 (n)
platypus
(Ornithorhynchus anatinus)
Mammalia MMAB 34
  • 77 (a)
OneToOne
oppossum
(Monodelphis domestica)
Mammalia MMAB 34
  • 66 (a)
OneToOne
chicken
(Gallus gallus)
Aves -- 34
  • 64 (a)
OneToMany
-- 34
  • 64 (a)
OneToMany
zebrafish
(Danio rerio)
Actinopterygii mmab 33 34
  • 66 (n)
Dr.18617 33
rainbow trout
(Oncorhynchus mykiss)
Actinopterygii Omy.4954 33
worm
(Caenorhabditis elegans)
Secernentea mmab-1 34
  • 40 (a)
OneToOne
sea squirt
(Ciona savignyi)
Ascidiacea -- 34
  • 50 (a)
OneToOne
Species where no ortholog for MMAB was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • fruit fly (Drosophila melanogaster)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • lizard (Anolis carolinensis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • tropical clawed frog (Silurana tropicalis)
  • wheat (Triticum aestivum)

Evolution for MMAB Gene

ENSEMBL:
Gene Tree for MMAB (if available)
TreeFam:
Gene Tree for MMAB (if available)

Paralogs for MMAB Gene

(5) SIMAP similar genes for MMAB Gene using alignment to 7 proteins:

genes like me logo Genes that share paralogs with MMAB: view

No data available for Paralogs for MMAB Gene

Variants for MMAB Gene

Sequence variations from dbSNP and Humsavar for MMAB Gene

SNP ID Clin Chr 12 pos Variation AA Info Type
rs104895295 pathogenic, Hyperimmunoglobulin D with periodic fever, Mevalonic aciduria 109,574,881(-) A/C/G upstream_transcript_variant
rs104895307 not-provided, Hyperimmunoglobulin D with periodic fever 109,574,859(-) A/T upstream_transcript_variant
rs104895309 not-provided, Hyperimmunoglobulin D with periodic fever 109,574,807(-) AGGATTCCCAGGAGCCATGTTGTCAGAAGTCCTACTGGTGTCTGCTCCGGGGAAAGTCATCCTTCATGGAGAACATGCCGTGGTACATGGCAAGG/AGG upstream_transcript_variant
rs104895322 pathogenic, not-provided, Mevalonic aciduria, Hyperimmunoglobulin D with periodic fever 109,574,894(-) T/TT upstream_transcript_variant
rs104895328 not-provided, Hyperimmunoglobulin D with periodic fever 109,574,844(-) G/C upstream_transcript_variant

Structural Variations from Database of Genomic Variants (DGV) for MMAB Gene

Variant ID Type Subtype PubMed ID
esv3630719 CNV gain 21293372
nsv560118 CNV loss 21841781

Variation tolerance for MMAB Gene

Residual Variation Intolerance Score: 72% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 8.62; 86.25% of all genes are more intolerant (likely to be disease-causing)

Additional Variant Information for MMAB Gene

Human Gene Mutation Database (HGMD)
MMAB
SNPedia medical, phenotypic, and genealogical associations of SNPs for
MMAB

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for MMAB Gene

Disorders for MMAB Gene

MalaCards: The human disease database

(3) MalaCards diseases for MMAB Gene - From: HGMD, OMIM, ClinVar, GTR, Orphanet, Swiss-Prot, DISEASES, Novoseek, and GeneCards

Disorder Aliases PubMed IDs
methylmalonic aciduria, cblb type
  • methylmalonic acidemia, cblb type
isolated methylmalonic acidemia
  • isolated methylmalonic aciduria
organic acidemia
  • organic acid metabolism disorder
- elite association - COSMIC cancer census association via MalaCards
Search MMAB in MalaCards View complete list of genes associated with diseases

UniProtKB/Swiss-Prot

MMAB_HUMAN
  • Methylmalonic aciduria type cblB (MMAB) [MIM:251110]: A disorder of methylmalonate and cobalamin metabolism due to defective synthesis of adenosylcobalamin. {ECO:0000269 PubMed:12471062, ECO:0000269 PubMed:15781192, ECO:0000269 PubMed:17957493}. Note=The disease is caused by mutations affecting the gene represented in this entry.

Additional Disease Information for MMAB

Genetic Association Database
(GAD)
Human Genome Epidemiology Navigator
(HuGE)
ATLAS of Genetics and Cytogenetics in Oncology and Haematology
genes like me logo Genes that share disorders with MMAB: view

No data available for Genatlas for MMAB Gene

Publications for MMAB Gene

  1. Identification of the human and bovine ATP:Cob(I)alamin adenosyltransferase cDNAs based on complementation of a bacterial mutant. (PMID: 12514191) Leal NA … Bobik TA (The Journal of biological chemistry 2003) 2 3 4 22 58
  2. Identification of the gene responsible for the cblB complementation group of vitamin B12-dependent methylmalonic aciduria. (PMID: 12471062) Dobson CM … Gravel RA (Human molecular genetics 2002) 2 3 4 22 58
  3. Genetic analysis of three genes causing isolated methylmalonic acidemia: identification of 21 novel allelic variants. (PMID: 15781192) Martínez MA … Pérez B (Molecular genetics and metabolism 2005) 3 4 22 58
  4. Protein destabilization and loss of protein-protein interaction are fundamental mechanisms in cblA-type methylmalonic aciduria. (PMID: 28497574) Plessl T … Froese DS (Human mutation 2017) 3 4 58
  5. Evaluating the discriminative power of multi-trait genetic risk scores for type 2 diabetes in a northern Swedish population. (PMID: 20571754) Fontaine-Bisson B … Franks PW (Diabetologia 2010) 3 44 58

Products for MMAB Gene

Sources for MMAB Gene

Content
Loading form....