Free for academic non-profit institutions. Other users need a Commercial license

Aliases for MLLT6 Gene

Aliases for MLLT6 Gene

  • MLLT6, PHD Finger Containing 2 3 5
  • Myeloid/Lymphoid Or Mixed-Lineage Leukemia, Translocated To, 6 2 3
  • Myeloid/Lymphoid Or Mixed-Lineage Leukemia; Translocated To, 6 2 3
  • ALL1-Fused Gene From Chromosome 17 Protein 3 4
  • MLLT6, PHD Finger Domain Containing 2 3
  • Trithorax Homolog 2 3
  • AF17 3 4
  • Myeloid/Lymphoid Or Mixed-Lineage Leukemia (Trithorax (Drosophila) Homolog); Translocated To, 6 2
  • Myeloid/Lymphoid Or Mixed-Lineage Leukemia (Trithorax Homolog, Drosophila); Translocated To, 6 3
  • Myeloid/Lymphoid Or Mixed-Lineage Leukemia (Trithorax Homolog); Translocated To, 6 3
  • Protein AF-17 3

External Ids for MLLT6 Gene

Previous GeneCards Identifiers for MLLT6 Gene

  • GC17P036347
  • GC17P038855
  • GC17P036772
  • GC17P037236
  • GC17P034115
  • GC17P036861
  • GC17P032658

Summaries for MLLT6 Gene

GeneCards Summary for MLLT6 Gene

MLLT6 (MLLT6, PHD Finger Containing) is a Protein Coding gene. Diseases associated with MLLT6 include Myeloid/Lymphoid Or Mixed Lineage Leukemia and Leukemia, Acute Myeloid. An important paralog of this gene is MLLT10.

Additional gene information for MLLT6 Gene

No data available for Entrez Gene Summary , CIViC summary , UniProtKB/Swiss-Prot , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for MLLT6 Gene

Genomics for MLLT6 Gene

Regulatory Elements for MLLT6 Gene

Enhancers for MLLT6 Gene
GeneHancer Identifier Enhancer Score Enhancer Sources Gene-Enhancer Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor Binding Sites within enhancer Gene Targets for Enhancer
GH17H038740 1.6 FANTOM5 Ensembl ENCODE dbSUPER 15.9 +37.0 37014 3.6 PKNOX1 KLF1 NFIB ZSCAN4 BMI1 ZIC2 ZNF121 GLIS2 ZNF366 POLR2A C17orf98 PCGF2 MLLT6 FBXO47 PIP4K2B SOCS7 PSMB3 CISD3 LOC100287808 RNA5SP440
GH17H038724 1.4 ENCODE dbSUPER 16.7 +23.9 23921 10.8 HDGF ARNT ARID4B SIN3A FEZF1 DMAP1 ZNF2 YY1 ZNF143 ZNF207 PCGF2 MED1 CDK12 RPL23 LOC105371762 MLLT6 LINC02079 PGAP3 STARD3 PSMB3
GH17H038677 1.3 Ensembl ENCODE 12.7 -28.3 -28341 0.8 PKNOX1 ATF1 ARNT ARID4B SIN3A FEZF1 DMAP1 GATA2 ZNF143 ZNF207 MLLT6 PCGF2 CISD3 PSMB3 PIP4K2B CWC25 EPOP GC17M038684
GH17H038735 1.2 ENCODE dbSUPER 11.6 +29.8 29830 0.5 HDGF ZSCAN4 ARID4B ZNF76 KLF17 SIN3A ZNF2 RAD21 GLIS2 ZNF143 MLLT6 CWC25 GC17M038732 RNA5SP440 LOC100287808
GH17H038674 1.1 ENCODE 12.6 -30.8 -30820 1.7 MLX ZFP64 ARID4B SIN3A DMAP1 ZNF2 SLC30A9 ZNF143 SP3 SP5 PCGF2 PIP4K2B MLLT6 CISD3 PSMB3 CWC25 GC17M038673 EPOP
- Elite enhancer and/or Elite enhancer-gene association Download GeneHancer data dump

Enhancers around MLLT6 on UCSC Golden Path with GeneCards custom track

Promoters for MLLT6 Gene
Ensembl Regulatory Elements (ENSRs) TSS Distance (bp) Size (bp) Binding Sites for Transcription Factors within promoters
ENSR00000093804 -1242 5001 MLX ZFP64 FEZF1 DMAP1 YY1 SLC30A9 ZNF143 SP3 NFYC SSRP1

Genomic Locations for MLLT6 Gene

Genomic Locations for MLLT6 Gene
24,262 bases
Plus strand

Genomic View for MLLT6 Gene

Genes around MLLT6 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
MLLT6 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for MLLT6 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for MLLT6 Gene

Proteins for MLLT6 Gene

  • Protein details for MLLT6 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Recommended name:
    Protein AF-17
    Protein Accession:
    Secondary Accessions:
    • Q59F28
    • Q96IU3
    • Q9H5F6
    • Q9UF49

    Protein attributes for MLLT6 Gene

    1093 amino acids
    Molecular mass:
    112076 Da
    Quaternary structure:
    No Data Available
    • Sequence=AAH07237.1; Type=Erroneous initiation; Evidence={ECO:0000305}; Sequence=BAB15670.1; Type=Erroneous initiation; Evidence={ECO:0000305};

neXtProt entry for MLLT6 Gene

Post-translational modifications for MLLT6 Gene

  • Modification sites at PhosphoSitePlus
  • Modification sites at neXtProt

Other Protein References for MLLT6 Gene

No data available for DME Specific Peptides for MLLT6 Gene

Domains & Families for MLLT6 Gene

Gene Families for MLLT6 Gene

Human Protein Atlas (HPA):
  • Cancer-related genes
  • Predicted intracellular proteins

Suggested Antigen Peptide Sequences for MLLT6 Gene

Graphical View of Domain Structure for InterPro Entry

genes like me logo Genes that share domains with MLLT6: view

No data available for UniProtKB/Swiss-Prot for MLLT6 Gene

Function for MLLT6 Gene

Molecular function for MLLT6 Gene

GENATLAS Biochemistry:
AF-17 protein,fused with HRX (MLL),in acute lymphoblastic leukemia and monoblastic leukemia with granulocytic sarcomas,with translocation t(11;17)(q23;q21),may be the same as TCF11

Phenotypes From GWAS Catalog for MLLT6 Gene

Gene Ontology (GO) - Molecular Function for MLLT6 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005515 protein binding IPI 16713569
GO:0046872 metal ion binding IEA --
genes like me logo Genes that share ontologies with MLLT6: view
genes like me logo Genes that share phenotypes with MLLT6: view

Animal Model Products

CRISPR Products

Inhibitory RNA Products

Clone Products

No data available for Enzyme Numbers (IUBMB) , Human Phenotype Ontology , Animal Models , Transcription Factor Targets and HOMER Transcription for MLLT6 Gene

Localization for MLLT6 Gene

Subcellular locations from UniProtKB/Swiss-Prot for MLLT6 Gene

Subcellular locations from

Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for MLLT6 gene
Compartment Confidence
nucleus 5
cytosol 2

Subcellular locations from the

Human Protein Atlas (HPA)

Gene Ontology (GO) - Cellular Components for MLLT6 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005634 nucleus IEA --
genes like me logo Genes that share ontologies with MLLT6: view

Pathways & Interactions for MLLT6 Gene

SuperPathways for MLLT6 Gene

No Data Available

Gene Ontology (GO) - Biological Process for MLLT6 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0006355 regulation of transcription, DNA-templated TAS 8058765
GO:0007588 excretion IEA --
GO:0010765 positive regulation of sodium ion transport IEA --
GO:0035811 negative regulation of urine volume IEA --
GO:0035812 renal sodium excretion IEA --
genes like me logo Genes that share ontologies with MLLT6: view

No data available for Pathways by source and SIGNOR curated interactions for MLLT6 Gene

Drugs & Compounds for MLLT6 Gene

No Compound Related Data Available

Transcripts for MLLT6 Gene

Unigene Clusters for MLLT6 Gene

Myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 6:
Representative Sequences:

CRISPR Products

Inhibitory RNA Products

Clone Products

Alternative Splicing Database (ASD) splice patterns (SP) for MLLT6 Gene

No ASD Table

Relevant External Links for MLLT6 Gene

GeneLoc Exon Structure for
ECgene alternative splicing isoforms for

Expression for MLLT6 Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for MLLT6 Gene

Protein differential expression in normal tissues from HIPED for MLLT6 Gene

This gene is overexpressed in Brain (65.1).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB and MOPED for MLLT6 Gene

NURSA nuclear receptor signaling pathways regulating expression of MLLT6 Gene:

SOURCE GeneReport for Unigene cluster for MLLT6 Gene:

Evidence on tissue expression from TISSUES for MLLT6 Gene

  • Intestine(4.5)
  • Skin(4.3)
  • Spleen(4.3)
  • Nervous system(3.5)
  • Lung(2.6)
  • Kidney(2.1)
genes like me logo Genes that share expression patterns with MLLT6: view

Primer Products

No data available for mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , mRNA differential expression in normal tissues , Protein tissue co-expression partners , mRNA Expression by UniProt/SwissProt and Phenotype-based relationships between genes and organs from Gene ORGANizer for MLLT6 Gene

Orthologs for MLLT6 Gene

This gene was present in the common ancestor of animals.

Orthologs for MLLT6 Gene

Organism Taxonomy Gene Similarity Type Details
(Pan troglodytes)
Mammalia MLLT6 33
  • 99.83 (n)
(Canis familiaris)
Mammalia MLLT6 33
  • 92.78 (n)
(Bos Taurus)
Mammalia MLLT6 33
  • 92.31 (n)
(Mus musculus)
Mammalia Mllt6 33 16
  • 88.47 (n)
(Rattus norvegicus)
Mammalia Mllt6 33
  • 88.33 (n)
(Gallus gallus)
Aves MLLT6 33
  • 69.9 (n)
tropical clawed frog
(Silurana tropicalis)
Amphibia mllt6 33
  • 63.16 (n)
(Caenorhabditis elegans)
Secernentea zfp-1 35
  • 60 (a)
Species where no ortholog for MLLT6 was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • fruit fly (Drosophila melanogaster)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • lizard (Anolis carolinensis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • oppossum (Monodelphis domestica)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • platypus (Ornithorhynchus anatinus)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea squirt (Ciona intestinalis)
  • sea squirt (Ciona savignyi)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)
  • zebrafish (Danio rerio)

Evolution for MLLT6 Gene

Gene Tree for MLLT6 (if available)
Gene Tree for MLLT6 (if available)

Paralogs for MLLT6 Gene

Paralogs for MLLT6 Gene

genes like me logo Genes that share paralogs with MLLT6: view

Variants for MLLT6 Gene

Sequence variations from dbSNP and Humsavar for MLLT6 Gene

SNP ID Clin Chr 17 pos Sequence Context AA Info Type
rs1000002940 -- 38,703,962(+) AGCCG(A/T)CGGGG upstream-variant-2KB, utr-variant-3-prime
rs1000007336 -- 38,722,027(+) CAGAA(C/T)GGGTT upstream-variant-2KB, reference, synonymous-codon
rs1000096086 -- 38,714,429(+) TTGAG(A/G)CTTTG intron-variant
rs1000192790 -- 38,703,913(+) CCCCT(C/T)CTGGG upstream-variant-2KB, utr-variant-3-prime
rs1000297533 -- 38,726,355(+) TGTGA(-/GTGTGTGTGTGCGTGCATGTGTGT)GTGTG cds-indel

Structural Variations from Database of Genomic Variants (DGV) for MLLT6 Gene

Variant ID Type Subtype PubMed ID
nsv953894 CNV deletion 24416366
nsv833438 CNV loss 17160897
nsv470585 CNV loss 18288195
nsv1146669 OTHER inversion 26484159
nsv1126456 CNV deletion 24896259
nsv1071381 CNV deletion 25765185
esv21810 CNV gain 19812545

Variation tolerance for MLLT6 Gene

Residual Variation Intolerance Score: 8.63% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 3.49; 55.22% of all genes are more intolerant (likely to be disease-causing)

Relevant External Links for MLLT6 Gene

Human Gene Mutation Database (HGMD)
SNPedia medical, phenotypic, and genealogical associations of SNPs for

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for MLLT6 Gene

Disorders for MLLT6 Gene

MalaCards: The human disease database

(2) MalaCards diseases for MLLT6 Gene - From: HGMD, DISEASES, and GeneCards

Disorder Aliases PubMed IDs
myeloid/lymphoid or mixed lineage leukemia
  • mll
leukemia, acute myeloid
  • leukemia, acute myeloid, somatic
- elite association - COSMIC cancer census association via MalaCards
Search MLLT6 in MalaCards View complete list of genes associated with diseases

  • Note=A chromosomal aberration involving MLLT6 is associated with acute leukemias. Translocation t(11;17)(q23;q21) with KMT2A/MLL1. The result is a rogue activator protein.

Relevant External Links for MLLT6

Atlas of Genetics and Cytogenetics in Oncology and Haematology:
genes like me logo Genes that share disorders with MLLT6: view

No data available for Genatlas for MLLT6 Gene

Publications for MLLT6 Gene

  1. Leucine-zipper dimerization motif encoded by the AF17 gene fused to ALL-1 (MLL) in acute leukemia. (PMID: 8058765) Prasad R … Canaani E (Proceedings of the National Academy of Sciences of the United States of America 1994) 2 3 4 60
  2. Af17 deficiency increases sodium excretion and decreases blood pressure. (PMID: 21546577) Chen L … Zhang W (Journal of the American Society of Nephrology : JASN 2011) 2 3 60
  3. Complete sequencing and characterization of 21,243 full-length human cDNAs. (PMID: 14702039) Ota T … Sugano S (Nature genetics 2004) 3 4 60
  4. Architecture of the human interactome defines protein communities and disease networks. (PMID: 28514442) Huttlin EL … Harper JW (Nature 2017) 3 60
  5. Control of a neuronal morphology program by an RNA-binding zinc finger protein, Unkempt. (PMID: 25737280) Murn J … Shi Y (Genes & development 2015) 3 60

Products for MLLT6 Gene

Sources for MLLT6 Gene

Loading form....