Free for academic non-profit institutions. Other users need a Commercial license

Aliases for MKS1 Gene

Aliases for MKS1 Gene

  • Meckel Syndrome, Type 1 2 3 5
  • POC12 Centriolar Protein Homolog (Chlamydomonas) 2
  • POC12 Centriolar Protein Homolog 3
  • Meckel Syndrome Type 1 Protein 3
  • JBTS28 3
  • BBS13 3
  • POC12 3
  • MES 3
  • MKS 3

External Ids for MKS1 Gene

Previous HGNC Symbols for MKS1 Gene

  • MKS

Previous GeneCards Identifiers for MKS1 Gene

  • GC17U990060
  • GC17M053638
  • GC17M056282
  • GC17M051643

Summaries for MKS1 Gene

Entrez Gene Summary for MKS1 Gene

  • The protein encoded by this gene localizes to the basal body and is required for formation of the primary cilium in ciliated epithelial cells. Mutations in this gene result in Meckel syndrome type 1 and in Bardet-Biedl syndrome type 13. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2009]

GeneCards Summary for MKS1 Gene

MKS1 (Meckel Syndrome, Type 1) is a Protein Coding gene. Diseases associated with MKS1 include Meckel Syndrome 1 and Bardet-Biedl Syndrome 13. Among its related pathways are Organelle biogenesis and maintenance and Regulation of PLK1 Activity at G2/M Transition.

UniProtKB/Swiss-Prot for MKS1 Gene

  • Component of the tectonic-like complex, a complex localized at the transition zone of primary cilia and acting as a barrier that prevents diffusion of transmembrane proteins between the cilia and plasma membranes. Involved in centrosome migration to the apical cell surface during early ciliogenesis. Required for ciliary structure and function, including a role in regulating length and appropriate number through modulating centrosome duplication. Required for cell branching morphology.

Gene Wiki entry for MKS1 Gene

No data available for Tocris Summary , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for MKS1 Gene

Genomics for MKS1 Gene

Regulatory Elements for MKS1 Gene

Enhancers for MKS1 Gene
GeneHancer Identifier Enhancer Score Enhancer Sources Gene-Enhancer Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor Binding Sites within enhancer Gene Targets for Enhancer
GH17F058249 1 ENCODE 11.4 -30.2 -30218 1.0 CREB3L1 MLX ARID4B SIN3A DMAP1 ZNF48 ZNF143 ZNF263 MXD4 MIER2 MKS1 EPX LOC105371841 MPO
GH17F058184 1 Ensembl ENCODE 11 +35.0 35019 0.7 HDAC1 ZNF133 ZMYM3 MAX ZNF316 SCRT2 NFE2 FOS ZNF600 STAT1 MSX2P1 OR4D1 MKS1 LPO SUPT4H1 GC17M057928 EPX
GH17F058503 1 Ensembl ENCODE 9.7 -285.4 -285366 2.4 MTA2 USF2 EP300 YY1 RELA SP1 RAD51 POLR2A EED IKZF1 TRIM37 RAD51C RNF43 C17orf47 SEPT4 SUPT4H1 MKS1 PIR59993 MTMR4
- Elite enhancer and/or Elite enhancer-gene association Download GeneHancer data dump

Enhancers around MKS1 on UCSC Golden Path with GeneCards custom track

Promoters for MKS1 Gene
Ensembl Regulatory Elements (ENSRs) TSS Distance (bp) Size (bp) Binding Sites for Transcription Factors within promoters
ENSR00001536999 504 1400 HDGF PKNOX1 WRNIP1 ARID4B SIN3A YBX1 DMAP1 YY1 SLC30A9 ZNF143

Genomic Location for MKS1 Gene

58,205,436 bp from pter
58,219,605 bp from pter
14,170 bases
Minus strand

Genomic View for MKS1 Gene

Genes around MKS1 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
MKS1 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for MKS1 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for MKS1 Gene

Proteins for MKS1 Gene

  • Protein details for MKS1 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Recommended name:
    Meckel syndrome type 1 protein
    Protein Accession:
    Secondary Accessions:
    • B7WNX4
    • F5H885
    • Q284T0
    • Q96G13

    Protein attributes for MKS1 Gene

    559 amino acids
    Molecular mass:
    64528 Da
    Quaternary structure:
    • Part of the tectonic-like complex (also named B9 complex) (By similarity). Interacts with TCTN3 and AHI1 (By similarity). Interacts with FLNA.
    • Sequence=AAH10061.1; Type=Erroneous initiation; Note=Translation N-terminally extended.; Evidence={ECO:0000305}; Sequence=BAA91105.1; Type=Erroneous initiation; Note=Translation N-terminally extended.; Evidence={ECO:0000305};

    Alternative splice isoforms for MKS1 Gene


neXtProt entry for MKS1 Gene

Post-translational modifications for MKS1 Gene

  • Ubiquitination at Lys 246 and Lys 507
  • Modification sites at PhosphoSitePlus

No data available for DME Specific Peptides for MKS1 Gene

Domains & Families for MKS1 Gene

Gene Families for MKS1 Gene

Protein Domains for MKS1 Gene


Suggested Antigen Peptide Sequences for MKS1 Gene

GenScript: Design optimal peptide antigens:

Graphical View of Domain Structure for InterPro Entry



  • Contains 1 B9 domain.
  • Contains 1 B9 domain.
genes like me logo Genes that share domains with MKS1: view

Function for MKS1 Gene

Molecular function for MKS1 Gene

UniProtKB/Swiss-Prot Function:
Component of the tectonic-like complex, a complex localized at the transition zone of primary cilia and acting as a barrier that prevents diffusion of transmembrane proteins between the cilia and plasma membranes. Involved in centrosome migration to the apical cell surface during early ciliogenesis. Required for ciliary structure and function, including a role in regulating length and appropriate number through modulating centrosome duplication. Required for cell branching morphology.

Gene Ontology (GO) - Molecular Function for MKS1 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005515 protein binding IPI 17185389
genes like me logo Genes that share ontologies with MKS1: view
genes like me logo Genes that share phenotypes with MKS1: view

Human Phenotype Ontology for MKS1 Gene

HPO Id HPO Name Alternative Ids Definition Synonyms

Animal Models for MKS1 Gene

MGI Knock Outs for MKS1:
  • Mks1 tm1a(EUCOMM)Wtsi

Animal Model Products

Inhibitory RNA Products

Flow Cytometry Products

No data available for Enzyme Numbers (IUBMB) , miRNA , Transcription Factor Targets and HOMER Transcription for MKS1 Gene

Localization for MKS1 Gene

Subcellular locations from UniProtKB/Swiss-Prot for MKS1 Gene

Cytoplasm, cytoskeleton, cilium basal body. Cytoplasm, cytoskeleton, microtubule organizing center, centrosome. Note=Localizes at the transition zone, a region between the basal body and the ciliary axoneme. {ECO:0000250}.

Subcellular locations from

Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for MKS1 gene
Compartment Confidence
cytoskeleton 5
cytosol 5
nucleus 1

Gene Ontology (GO) - Cellular Components for MKS1 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005737 cytoplasm IEA,IDA 17185389
GO:0005813 centrosome IDA 19208769
GO:0005814 centriole IEA --
GO:0005815 microtubule organizing center IEA --
GO:0005829 cytosol TAS --
genes like me logo Genes that share ontologies with MKS1: view

Pathways & Interactions for MKS1 Gene

genes like me logo Genes that share pathways with MKS1: view

Gene Ontology (GO) - Biological Process for MKS1 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0001843 neural tube closure IEA --
GO:0007368 determination of left/right symmetry IEA --
GO:0008589 regulation of smoothened signaling pathway IEA --
GO:0010669 epithelial structure maintenance IEA --
GO:0030030 cell projection organization IEA --
genes like me logo Genes that share ontologies with MKS1: view

No data available for SIGNOR curated interactions for MKS1 Gene

Transcripts for MKS1 Gene

Unigene Clusters for MKS1 Gene

Meckel syndrome, type 1:
Representative Sequences:

Inhibitory RNA Products

Flow Cytometry Products

Alternative Splicing Database (ASD) splice patterns (SP) for MKS1 Gene

ExUns: 1 ^ 2 ^ 3 ^ 4 ^ 5 ^ 6a · 6b · 6c ^ 7 ^ 8a · 8b ^ 9a · 9b · 9c ^ 10 ^ 11a · 11b ^ 12 ^ 13a · 13b
SP1: - - - - - - -
SP2: -
SP5: -

Relevant External Links for MKS1 Gene

GeneLoc Exon Structure for
ECgene alternative splicing isoforms for

Expression for MKS1 Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and SAGE for MKS1 Gene

mRNA expression in embryonic tissues and stem cells from LifeMap Discovery

Protein differential expression in normal tissues from HIPED for MKS1 Gene

This gene is overexpressed in Adipocyte (53.4) and Retina (15.5).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, PaxDb, MaxQB, and MOPED for MKS1 Gene

Protein tissue co-expression partners for MKS1 Gene

- Elite partner

NURSA nuclear receptor signaling pathways regulating expression of MKS1 Gene:


SOURCE GeneReport for Unigene cluster for MKS1 Gene:

genes like me logo Genes that share expression patterns with MKS1: view

No data available for mRNA differential expression in normal tissues and mRNA Expression by UniProt/SwissProt for MKS1 Gene

Orthologs for MKS1 Gene

This gene was present in the common ancestor of animals.

Orthologs for MKS1 Gene

Organism Taxonomy Gene Similarity Type Details
(Pan troglodytes)
Mammalia MKS1 34 35
  • 99.34 (n)
(Canis familiaris)
Mammalia MKS1 34 35
  • 90.88 (n)
(Bos Taurus)
Mammalia LOC101905689 34
  • 89.37 (n)
MKS1 35
  • 86 (a)
(Mus musculus)
Mammalia Mks1 34 16 35
  • 86.8 (n)
(Rattus norvegicus)
Mammalia Mks1 34
  • 86.08 (n)
(Ornithorhynchus anatinus)
Mammalia MKS1 35
  • 78 (a)
(Monodelphis domestica)
Mammalia MKS1 35
  • 77 (a)
(Gallus gallus)
Aves MKS1 34 35
  • 72.38 (n)
tropical clawed frog
(Silurana tropicalis)
Amphibia mks1 34
  • 63.76 (n)
Str.19301 34
African clawed frog
(Xenopus laevis)
Amphibia Xl.13433 34
(Danio rerio)
Actinopterygii mks1 34 35
  • 63.99 (n)
fruit fly
(Drosophila melanogaster)
Insecta CG15730 35
  • 18 (a)
sea squirt
(Ciona savignyi)
Ascidiacea -- 35
  • 42 (a)
Species where no ortholog for MKS1 was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • lizard (Anolis carolinensis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)
  • worm (Caenorhabditis elegans)

Evolution for MKS1 Gene

Gene Tree for MKS1 (if available)
Gene Tree for MKS1 (if available)

Paralogs for MKS1 Gene

No data available for Paralogs for MKS1 Gene

Variants for MKS1 Gene

Sequence variations from dbSNP and Humsavar for MKS1 Gene

SNP ID Clin Chr 17 pos Sequence Context AA Info Type
rs137853105 Bardet-Biedl syndrome 13 (BBS13) [MIM:615990], Pathogenic 58,206,479(-) CACTG(G/T)CTGCA intron-variant, reference, missense
rs199910690 Pathogenic 58,206,158(+) GGGCT(C/T)GACGG reference, synonymous-codon, missense, utr-variant-3-prime
rs386834043 Pathogenic 58,206,554(-) GAGAG(-/CAGAAACCTGAGGCTGTCCCAATGGCATG)CCACA intron-variant
rs386834044 Pathogenic 58,206,501(-) AGGCA(-/GGCA)CTGTC intron-variant, reference, frameshift-variant
rs386834048 Pathogenic 58,216,088(-) GAGGA(A/G)GTATT nc-transcript-variant, reference, synonymous-codon, utr-variant-5-prime

Structural Variations from Database of Genomic Variants (DGV) for MKS1 Gene

Variant ID Type Subtype PubMed ID
nsv457858 CNV loss 19166990
nsv517229 CNV gain+loss 19592680
nsv575797 CNV loss 21841781

Variation tolerance for MKS1 Gene

Residual Variation Intolerance Score: 72.4% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 2.35; 41.77% of all genes are more intolerant (likely to be disease-causing)

Relevant External Links for MKS1 Gene

Human Gene Mutation Database (HGMD)
SNPedia medical, phenotypic, and genealogical associations of SNPs for

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for MKS1 Gene

Disorders for MKS1 Gene

MalaCards: The human disease database

(15) MalaCards diseases for MKS1 Gene - From: OMIM, ClinVar, GeneTests, Orphanet, Swiss-Prot, DISEASES, and GeneCards

Disorder Aliases PubMed IDs
meckel syndrome 1
  • meckel syndrome
bardet-biedl syndrome 13
  • bbs13
malignant spiradenoma
  • malignant eccrine spiradenoma
joubert syndrome 1
  • joubert syndrome
mckusick-kaufman syndrome
  • mckusick kaufman syndrome
- elite association - COSMIC cancer census association via MalaCards
Search MKS1 in MalaCards View complete list of genes associated with diseases


  • Bardet-Biedl syndrome 13 (BBS13) [MIM:615990]: A syndrome characterized by usually severe pigmentary retinopathy, early-onset obesity, polydactyly, hypogenitalism, renal malformation and mental retardation. Secondary features include diabetes mellitus, hypertension and congenital heart disease. Bardet-Biedl syndrome inheritance is autosomal recessive, but three mutated alleles (two at one locus, and a third at a second locus) may be required for clinical manifestation of some forms of the disease. {ECO:0000269 PubMed:18327255}. Note=The disease is caused by mutations affecting the gene represented in this entry.
  • Meckel syndrome 1 (MKS1) [MIM:249000]: A disorder characterized by a combination of renal cysts and variably associated features including developmental anomalies of the central nervous system (typically encephalocele), hepatic ductal dysplasia and cysts, and polydactyly. {ECO:0000269 PubMed:16415886, ECO:0000269 PubMed:19466712}. Note=The disease is caused by mutations affecting the gene represented in this entry.

Relevant External Links for MKS1

Genetic Association Database (GAD)
Human Genome Epidemiology (HuGE) Navigator
Atlas of Genetics and Cytogenetics in Oncology and Haematology:
genes like me logo Genes that share disorders with MKS1: view

No data available for Genatlas for MKS1 Gene

Publications for MKS1 Gene

  1. Functional interactions between the ciliopathy-associated Meckel syndrome 1 (MKS1) protein and two novel MKS1-related (MKSR) proteins. (PMID: 19208769) Bialas N.J. … Leroux M.R. (J. Cell Sci. 2009) 3 4 22 64
  2. Hypomorphic mutations in syndromic encephalocele genes are associated with Bardet-Biedl syndrome. (PMID: 18327255) Leitch C.C. … Katsanis N. (Nat. Genet. 2008) 2 3 4 64
  3. The Meckel-Gruber syndrome proteins MKS1 and meckelin interact and are required for primary cilium formation. (PMID: 17185389) Dawe H.R. … Johnson C.A. (Hum. Mol. Genet. 2007) 3 4 22 64
  4. Spectrum of MKS1 and MKS3 mutations in Meckel syndrome: a genotype-phenotype correlation. Mutation in brief #960. Online. (PMID: 17397051) Khaddour R. … AttiAc-Bitach T. (Hum. Mutat. 2007) 3 22 46 64
  5. A disease causing deletion of 29 base pairs in intron 15 in the MKS1 gene is highly associated with the campomelic variant of the Meckel-Gruber syndrome. (PMID: 17935508) Auber B. … Rehder H. (Clin. Genet. 2007) 3 22 46 64

Products for MKS1 Gene

Sources for MKS1 Gene

Loading form....