Free for academic non-profit institutions. Other users need a Commercial license

Aliases for MIR675 Gene

Subcategory (RNA class) for MIR675 Gene

miRNA

Quality Score for this RNA gene is

3

Aliases for MIR675 Gene

  • MicroRNA 675 2 3
  • Hsa-Mir-675 3
  • MIRN675 3

External Ids for MIR675 Gene

Previous HGNC Symbols for MIR675 Gene

  • MIRN675

Previous GeneCards Identifiers for MIR675 Gene

  • GC11M001981
  • GC11M002017

Summaries for MIR675 Gene

Entrez Gene Summary for MIR675 Gene

  • microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs that are involved in post-transcriptional regulation of gene expression in multicellular organisms by affecting both the stability and translation of mRNAs. miRNAs are transcribed by RNA polymerase II as part of capped and polyadenylated primary transcripts (pri-miRNAs) that can be either protein-coding or non-coding. The primary transcript is cleaved by the Drosha ribonuclease III enzyme to produce an approximately 70-nt stem-loop precursor miRNA (pre-miRNA), which is further cleaved by the cytoplasmic Dicer ribonuclease to generate the mature miRNA and antisense miRNA star (miRNA*) products. The mature miRNA is incorporated into a RNA-induced silencing complex (RISC), which recognizes target mRNAs through imperfect base pairing with the miRNA and most commonly results in translational inhibition or destabilization of the target mRNA. The RefSeq represents the predicted microRNA stem-loop. [provided by RefSeq, Sep 2009]

GeneCards Summary for MIR675 Gene

MIR675 (MicroRNA 675) is an RNA Gene, and is affiliated with the miRNA class.

fRNAdb sequence ontologies for MIR675 Gene - the ORGUL cluster for this gene includes several descriptions:

  • miRNA: Small, ~22-nt, RNA molecule that is the endogenous transcript of a miRNA gene. Micro RNAs are produced from precursor molecules (SO:0000647) that can form local hairpin structures, which ordinarily are processed (via the Dicer pathway) such that a single miRNA molecule accumulates from one arm of a hairpin precursor molecule. Micro RNAs may trigger the cleavage of their target molecules or act as translational repressors.

  • pre_miRNA: The 60-70 nucleotide region remain after Drosha processing of the primary transcript, that folds back upon itself to form a hairpin sructure.

No data available for UniProtKB/Swiss-Prot , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary and piRNA Summary for MIR675 Gene

Genomics for MIR675 Gene

Genomic Location for MIR675 Gene

Start:
1,996,730 bp from pter
End:
1,996,842 bp from pter
Size:
113 bases
Orientation:
Minus strand

Genomic View for MIR675 Gene

UCSC Golden Path with GeneCards custom track
Cytogenetic band:
Genomic Location for MIR675 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for MIR675 Gene

No data available for Regulatory Elements for MIR675 Gene

Proteins for MIR675 Gene

Post-translational modifications for MIR675 Gene

No Post-translational modifications

No data available for DME Specific Peptides for MIR675 Gene

Domains for MIR675 Gene

Gene Families for MIR675 Gene

HGNC:
  • MIR :ncRNAs / Micro RNAs

Graphical View of Domain Structure for InterPro Entry

genes like me logo Genes that share domains with MIR675: view

No data available for Protein Domains , Suggested Antigen Peptide Sequences and UniProtKB/Swiss-Prot for MIR675 Gene

Function for MIR675 Gene

No data available for Molecular function , Enzyme Numbers (IUBMB) , Gene Ontology (GO) - Molecular Function , Phenotypes , Animal Models , miRNA , Transcription Factor Targeting and HOMER Transcription for MIR675 Gene

Localization for MIR675 Gene

No data available for Subcellular locations from UniProtKB/Swiss-Prot , Subcellular locations from COMPARTMENTS and Gene Ontology (GO) - Cellular Components for MIR675 Gene

Pathways for MIR675 Gene

SuperPathways for MIR675 Gene

No Data Available

Interacting Proteins for MIR675 Gene

Gene Ontology (GO) - Biological Process for MIR675 Gene

None

No data available for Pathways by source for MIR675 Gene

Transcripts for MIR675 Gene

mRNA/cDNA for MIR675 Gene

(2) Ensembl transcripts including schematic representations, and UCSC links where relevant :

miRNA Products

Inhibitory RNA Products

  • Predesigned siRNA for gene silencing in human,mouse,rat for MIR675

Primer Products

  • QuantiTect SYBR Green Assays in human,mouse,rat
  • Pre-validated RT² qPCR Primer Assay in human,mouse,rat
  • QuantiFast Probe-based Assays in human,mouse,rat

Flow Cytometry Products

Alternative Splicing Database (ASD) splice patterns (SP) for MIR675 Gene

No ASD Table

Relevant External Links for MIR675 Gene

GeneLoc Exon Structure for
MIR675
ECgene alternative splicing isoforms for
MIR675

Expression for MIR675 Gene

No Expression Related Data Available

In Situ Assay Products

No data available for mRNA expression in normal human tissues , mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , mRNA differential expression in normal tissues , Protein differential expression in normal tissues , Protein expression , mRNA Expression by UniProt/SwissProt and Expression partners for MIR675 Gene

Orthologs for MIR675 Gene

Evolution for MIR675 Gene

ENSEMBL:
Gene Tree for MIR675 (if available)
TreeFam:
Gene Tree for MIR675 (if available)

No data available for Orthologs for MIR675 Gene

Paralogs for MIR675 Gene

No data available for Paralogs for MIR675 Gene

Variants for MIR675 Gene

Sequence variations from dbSNP and Humsavar for MIR675 Gene

SNP ID Clin Chr 11 pos Sequence Context AA Info Type MAF
rs55656542 -- 1,996,263(-) AGGCG(-/CGTCCGGCCTTCCTGGTGAGCGTGTCTGCCCTCCCTGCG)TCAGG downstream-variant-500B

Structural Variations from Database of Genomic Variants (DGV) for MIR675 Gene

Variant ID Type Subtype PubMed ID
nsv896727 CNV Gain 21882294
nsv896731 CNV Loss 21882294
nsv467645 CNV Gain 19166990
nsv469926 CNV Loss 18288195
dgv983n71 CNV Loss 21882294
esv29980 CNV Loss 17803354
nsv522320 CNV Loss 19592680
dgv987n71 CNV Loss 21882294
dgv988n71 CNV Loss 21882294
dgv989n71 CNV Loss 21882294
nsv896767 CNV Loss 21882294
nsv896768 CNV Gain 21882294
nsv896769 CNV Gain 21882294

Relevant External Links for MIR675 Gene

HapMap Linkage Disequilibrium report
MIR675

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for MIR675 Gene

Disorders for MIR675 Gene

No disorders were found for MIR675 Gene.

No data available for MalaCards , OMIM , UniProtKB/Swiss-Prot , University of Copenhagen DISEASES , Novoseek inferred disease relationships , Genatlas and External Links for MIR675 Gene

Publications for MIR675 Gene

  1. miRBase: microRNA sequences, targets and gene nomenclature. (PMID: 16381832) Griffiths-Jones S. … Enright A.J. (Nucleic Acids Res. 2006) 3
  2. The imprinted H19 noncoding RNA is a primary microRNA precursor. (PMID: 17237358) Cai X. … Cullen B.R. (RNA 2007) 3
  3. Hidden layers of human small RNAs. (PMID: 18402656) Kawaji H. … Hayashizaki Y. (BMC Genomics 2008) 3
  4. Oncofetal H19-derived miR-675 regulates tumor suppressor RB in human colorectal cancer. (PMID: 19926638) Tsang W.P. … Kwok T.T. (Carcinogenesis 2010) 3
  5. Type II collagen expression is regulated by tissue-specific miR-675 in human articular chondrocytes. (PMID: 20529846) Dudek K.A. … Murphy C.L. (J. Biol. Chem. 2010) 3

Products for MIR675 Gene

Sources for MIR675 Gene

Back to Top

Content