Set Analyses:
Advanced Search

Advanced Search

 
Search By
Section (entire)
for


 
or upload a file of gene symbols


Category   Symbol Source: HGNC EntrezGene Ensembl GeneCards RNA genes CroW21
GIFtS

MIR5694 Gene

RNA gene   GIFtS: 12
GCID: GC14M067910

microRNA 5694

  Search for MIR5694
in our new
 Human Malady Compendium 
Biological research products
for MIR5694
    

(According to 1HGNC, 2Entrez Gene,
3UniProtKB/Swiss-Prot, 4UniProtKB/TrEMBL, 5OMIM, 6GeneLoc, 7Ensembl, 8DME, 9miRBase, and/or 10fRNAdb)
About This Section

Subcategory (RNA class): miRNA

Quality score for this RNA gene is 3

Aliases
MicroRNA 56941 2
Hsa-Mir-56941

External Ids:    HGNC: 435301   Entrez Gene: 1008470642   Ensembl: ENSG000002659937   
ORGUL members:         
miRBase: MI0019301    

Export aliases for MIR5694 gene to outside databases

Previous GC identifer: GC14U901321


(According to Entrez Gene, Tocris Bioscience, Wikipedia's Gene Wiki, PharmGKB,
UniProtKB/Swiss-Prot, and/or UniProtKB/TrEMBL)
About This Section

Entrez Gene summary for MIR5694:
microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs that are involved in post-transcriptional regulation of gene
expression in multicellular organisms by affecting both the stability and translation of mRNAs. miRNAs are transcribed
by RNA polymerase II as part of capped and polyadenylated primary transcripts (pri-miRNAs) that can be either
protein-coding or non-coding. The primary transcript is cleaved by the Drosha ribonuclease III enzyme to produce an
approximately 70-nt stem-loop precursor miRNA (pre-miRNA), which is further cleaved by the cytoplasmic Dicer
ribonuclease to generate the mature miRNA and antisense miRNA star (miRNA*) products. The mature miRNA is incorporated
into a RNA-induced silencing complex (RISC), which recognizes target mRNAs through imperfect base pairing with the
miRNA and most commonly results in translational inhibition or destabilization of the target mRNA. The RefSeq
represents the predicted microRNA stem-loop. (provided by RefSeq, Sep 2009)




(According to GeneLoc and/or HGNC, and/or
Entrez Gene (NCBI build 37),
and/or miRBase,
Genomic Views according to UCSC (hg19) and Ensembl (release 69), Regulatory elements and Epigenetics data according to QIAGEN, SABiosciences, and/or SwitchGear Genomics)
About This Section
Regulatory elements:
   Search SABiosciences Regulatory transcription factor binding sites for MIR5694
         Other transcription factors

Browse SwitchGear Promoter luciferase reporter plasmids
   Search SABiosciences Chromatin IP Primers for MIR5694

Epigenetics:
QIAGEN PyroMark CpG Assay predesigned Pyrosequencing DNA Methylation assays in human, mouse, rat MIR5694


Genomic Location:
Genomic View: UCSC Golden Path with GeneCards custom track

Ensembl cytogenetic band:  14q24.1   HGNC chromosome: 14

MIR5694 Gene in genomic location: bands according to Ensembl, locations according to (and/or Entrez Gene and/or Ensembl if different)
MIR5694 gene location

GeneLoc information about chromosome 14         GeneLoc Exon Structure

GeneLoc location for GC14M067910:  view genomic region     (about GC identifiers)

Start:
67,908,572 bp from pter      End:
67,908,647 bp from pter
Size:
76 bases      Orientation:
minus strand

(According to 1UniProtKB, HORDE, neXtProt, Ensembl, and/or Reactome, Modification sites according to 2PhosphoSitePlus, Specific Peptides from DME, Protein expression images according to data from SPIRE MOPED and PaxDb, RefSeq according to NCBI, PDB rendering according to OCA and/or Proteopedia, Recombinant Proteins from EMD Millipore, R&D Systems, GenScript, Enzo Life Sciences, OriGene, Novus Biologicals, Sino Biological, ProSpec, and/or Uscn,
Biochemical Assays by EMD Millipore, R&D Systems, OriGene, GenScript, Cell Signaling Technology, Enzo Life Sciences, and/or Uscn, Ontologies according to Gene Ontology Consortium 01 Mar 2013 and Entrez Gene, Antibodies by EMD Millipore, R&D Systems, GenScript, Cell Signaling Technology, OriGene, Novus Biologicals, Thermo Fisher Scientific, Abcam, and/or Uscn)
About This Section

UniProtKB: --


(According to InterPro, ProtoNet, UniProtKB, and/or BLOCKS, Sets of similar genes according to GeneDecks)
About This Section
  --

(According to 1UniProtKB, Genatlas, LifeMap Discovery™, IUBMB, and/or 2DME, Human phenotypes from GenomeRNAi, Animal models from MGI Mar 06 2013,
bound targets from SABiosciences, miRNA Gene Targets from miRTarBase shRNA from OriGene, RNAi from EMD Millipore, siRNAs from OriGene, QIAGEN, microRNA from QIAGEN, Gene Editing from DNA2.0, Clones from EMD Millipore, OriGene, SwitchGear Genomics, GenScript, Sino Biological, DNA2.0, and Vector BioLabs, Cell Lines from GenScript, LifeMap BioReagents, In Situ Hybridization Assays from Advanced Cell Diagnostics, Ontologies according to Gene Ontology Consortium 01 Mar 2013 via Entrez Gene.)
About This Section

miRNA
Products:
    
Browse 3'-UTR reporter clones for miRNA target validation
Browse MicroRNA Expression Plasmids
QIAGEN Custom miScript Target Protector blocks miRNA-binding site of human, mouse, rat MIR5694
Search QIAGEN for miScript miRNA Assays for microRNAs that regulate MIR5694
Browse SwitchGear 3'UTR luciferase reporter plasmids
Inhib. RNA
Products:
    
Browse for Gene Knock-down Tools from EMD Millipore
Browse OriGene 29mer shRNA kits
Browse OriGene siRNA
Search QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat MIR5694

Gene Editing
Products:
DNA2.0 Custom Protein Engineering Service for MIR5694

Clone
Products:
     
Browse Clones for the Expression of Recombinant Proteins Available from EMD Millipore
Browse OriGene untagged/tagged cDNA clones in CMV expression vector
OriGene custom cloning services – gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
GenScript Custom all cDNA clones Services for MIR5694
Browse Sino Biological Human cDNA Clones
DNA2.0 Custom Codon Optimized Gene Synthesis Service for MIR5694
Search Vector BioLabs for ready-to-use adenovirus/AAV for human, mouse, rat MIR5694 

Cell Line
Products:
     
GenScript Custom overexpressing Cell Line Services for MIR5694
Search LifeMap BioReagents cell lines for MIR5694

In Situ Assay
Products:
   

 
Search Advanced Cell Diagnostics for RNAscope RNA in situ hybridization assays for MIR5694


(Pathways according to EMD Millipore, R&D Systems, Cell Signaling Technology, KEGG, PharmGKB, BioSystems, Reactome, Tocris Bioscience, GeneGo (Thomson Reuters), QIAGEN, and/or UniProtKB, Sets of similar genes according to GeneDecks, Interaction Networks according to SABiosciences, and/or STRING, Interactions according to 1UniProtKB, 2MINT, 3I2D, and/or 4STRING, with links to IntAct and Ensembl, Ontologies according to Gene Ontology Consortium 01 Mar 2013 via Entrez Gene).
About This Section



Interactions:

    Search SABiosciences Gene Network CentralTM Interacting Genes and Proteins Networks for MIR5694

(Chemical Compounds according to UniProtKB, Enzo Life Sciences, EMD Millipore, Tocris Bioscience HMDB, BitterDB, and/or Novoseek, and Drugs according to DrugBank, Enzo Life Sciences, and/or PharmGKB, with drugs/clinical trials/news search links to CenterWatch)
About This Section
Browse Small Molecules at EMD Millipore
Browse drugs & compounds from Enzo Life Sciences

Browse Tocris compounds for MIR5694
Search CenterWatch for drugs/clinical trials and news about MIR5694 

(Secondary structures according to fRNAdb,
GenBank/EMBL/DDBJ Accessions according to
Unigene (Build 235 Homo sapiens; Mar 10 2013) or GenBank,
RefSeq according to Entrez Gene,
DOTS (version 10), and/or AceView, transcript ids from Ensembl with links to UCSC,
exon structure from GeneLoc, alternative splicing isoforms according to ASD and/or ECgene,
RNAi Products from EMD Millipore,
siRNAs from OriGene, QIAGEN, shRNA from OriGene, microRNA from QIAGEN,
Tagged/untagged cDNA clones from OriGene, SwitchGear Genomics, GenScript, DNA2.0, Vector BioLabs, Primers from OriGene, SABiosciences, and/or QIAGEN )
About This Section

1 Ensembl transcript including schematic representation, and UCSC links where relevant:
ENST00000581190(miRNA)

miRNA
Products:
     
Browse 3'-UTR reporter clones for miRNA target validation
Browse OriGene MicroRNA Expression Plasmids
QIAGEN Custom miScript Target Protector blocks miRNA-binding site of human, mouse, rat MIR5694
Search QIAGEN for miScript miRNA Assays for microRNAs that regulate MIR5694
Browse SwitchGear 3'UTR luciferase reporter plasmids
Inhib. RNA
Products:
     
Browse for Gene Knock-down Tools from EMD Millipore
Browse OriGene 29mer shRNA kits
Browse OriGene siRNA
Search QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat MIR5694
Clone
Products:
     
Browse OriGene untagged/tagged cDNA clones in CMV expression vector
OriGene custom cloning services – gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
GenScript Custom all cDNA clones Services for MIR5694
DNA2.0 Custom Codon Optimized Gene Synthesis Service for MIR5694
Search Vector BioLabs for ready-to-use adenovirus/AAV for human, mouse, rat MIR5694 
Primer
Products:
    
Browse OriGene genome-wide validated SYBR primer pairs
Browse OriGene validated miRNA SYBR primer pairs
Search SABiosciences RT2 qPCR Primer Assays in human, mouse, rat MIR5694
  Search QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat MIR5694
  Search QIAGEN QuantiFast Probe-based Assays in human, mouse, rat MIR5694

GeneLoc Exon Structure


(RNA expression data according to H-InvDB, NONCODE, miRBase, and RNAdb, Expression images according to data from BioGPS, Illumina Human BodyMap, and CGAP SAGE, Sets of similar genes according to GeneDecks, in vivo and in vitro expression data from LifeMap Discovery™, plus additional links to Genevestigator, and/or SOURCE, and/or BioGPS, and/or UniProtKB,
PCR Arrays from SABiosciences, Primers from OriGene, SABiosciences, and/or QIAGEN, In Situ Hybridization Assays from Advanced Cell Diagnostics)
About This Section

Expression evidence for MIR5694:none

See probesets specificity/sensitivity at GeneAnnot
CGAP TAG: --
    SABiosciences Custom PCR Arrays for MIR5694

Primer
Products:
Browse OriGene genome-wide validated SYBR primer pairs
Browse OriGene validated miRNA SYBR primer pairs
Search SABiosciences RT2 qPCR Primer Assays in human, mouse, rat MIR5694
Search QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat MIR5694
Search QIAGEN QuantiFast Probe-based Assays in human, mouse, rat MIR5694
In Situ
Assay Products:
 

 
Search Advanced Cell Diagnostics for RNAscope RNA in situ hybridization assays for MIR5694

(Orthologs according to 1,2HomoloGene (2older version, for species not in 1newer version), 3euGenes, 4SGD , 5MGI Mar 06 2013, with possible further links to Flybase and/or WormBase, and/or 6Ensembl pan taxonomic compara , Gene Trees according to Ensembl and TreeFam)
About This Section
  --

ENSEMBL Gene Tree for MIR5694 (if available)
TreeFam Gene Tree for MIR5694 (if available) 

(Paralogs according to 1HomoloGene,
2Ensembl, and 3SIMAP, Pseudogenes according to 4Pseudogene.org Build 68)
About This Section
  --

(SNPs/Variants according to the 1NCBI SNP Database, 2Ensembl, 3PupaSUITE, UniProtKB, and DNA2.0, Linkage Disequilibrium by HapMap, Structural Variations(CNVs/InDels/Inversions) from the Database of Genomic Variants, Mutations from the Human Gene Mutation Database (HGMD) and the Locus Specific Mutation Databases (LSDB), Blood group antigen gene mutations by BGMUT, Resequencing Primers from QIAGEN, Cancer Mutation PCR Arrays and Assays and Copy Number PCR Arrays from SABiosciences)
About This Section

10/49 NCBI SNPs in MIR5694 are shown (see all 49    About this table
Genomic DataTranscription Related DataAllele Frequencies
SNP IDValidClinical
significance
Chr 14 posSequence#AA
Chg
TypeMore#Allele
freq
PopTotal
sample
More
----------
rs178367631,2
C,F,H,--67908233(+) CTCCAA/GTGGGC 1 -- ds500113Minor allele frequency- G:0.07NA NS EA 1290
rs1438176621,2
--67908309(+) TCAACA/TTTATT 1 -- ds50010--------
rs1819264261,2
--67908356(+) CTATTA/TGAATC 1 -- ds50010--------
rs1407738361,2
--67908399(+) TGGTG-/GGCGGGCCTCATCCAATCTGT
TGGAGGTGAGGCCTGAATAGAACC
GAAAA
1 -- ds50010--------
rs1130752391,2
--67908401(+) GTGGGC/TGGGCC 1 -- ds50011Minor allele frequency- T:0.50CSA 2
rs1903604271,2
--67908402(+) TGGGCA/GGGCCT 1 -- ds50010--------
rs1817220841,2
--67908486(+) CCTGAC/TTGTCC 1 -- ds50010--------
rs1167412901,2
F,--67908503(+) CGGGAC/TGTCAG 1 -- ds50011Minor allele frequency- T:0.09WA 118
rs1867929791,2
--67908630(+) CAGTCC/TCATGA 1 -- nc-transcript-variant0--------
rs1158117181,2
C,--67908631(+) AGTCCC/TATGAT 1 -- nc-transcript-variant0--------

HapMap Linkage Disequilibrium report for MIR5694 (67908572 - 67908647 bp)
Structural Variations (Copy Number Variations, Insertions/Deletions, Inversions)
      Database of Genomic Variants (DGV) variations for MIR5694: --

SABiosciences Cancer Mutation PCR Assays
Search QIAGEN SeqTarget long-range PCR primers in human, mouse, rat for resequencing MIR5694
DNA2.0 Custom Variant and Variant Library Synthesis for MIR5694

(in which this Gene is Involved, According to MalaCards, OMIM, UniProtKB, the University of Copenhagen DISEASES database, Genatlas, GeneTests, GAD, HuGE Navigator, and/or TGDB.)
About This Section
  --

(in PubMed. Associations of this gene to articles via 1Entrez Gene, 2UniProtKB/Swiss-Prot, 3HGNC, 4GAD, 5PharmGKB, 6HMDB, 7DrugBank, 8UniProtKB/TrEMBL, 9 Novoseek, and/or 10fRNAdb)
About This Section

PubMed articles for MIR5694 gene integrated from 9 sources:
(articles sorted by number of sources associating them with MIR5694)
    Utopia: connect your pdf to the dynamic
world of online information

  1. MicroRNAs associated with metastatic prostate cancer. (PubMed id 21980368)1 Watahiki A....Wang Y. (2011)
  2. miRBase: microRNA sequences, targets and gene nomencl ature. (PubMed id 16381832)1 Griffiths-Jones S....Enright A.J. (2006)

(in PubMed, OMIM, and NCBI Bookshelf)
About This Section
 ANDOR
Aliases
Free Text  

  Query String
PubMed
OMIM
NCBI Bookshelf
  (Note: In FireFox, select the above section and copy using Ctrl-C)

(According to Entrez Gene, HGNC, AceView, euGenes, Ensembl, miRBase, ECgene, Kegg, and/or H-InvDB)
About This Section
Entrez Gene: 100847064 HGNC: 43530 Ensembl:ENSG00000265993 euGenes: HUgn100847064 ECgene: MIR5694
H-InvDB: MIR5694

(According to HUGE)
About This Section
  --

(According to PharmGKB, ATLAS, HORDE, IMGT, LEIDEN, UniProtKB/Swiss-Prot, and/or UniProtKB/TrEMBL,
Wikipedia and/or GeneReviews via UniProtKB/Swiss-Prot)
About This Section
  --

(Patent information from GeneIP,
Licensable technologies from WIS Yeda, Salk, Tufts,
IP news from LifeMap Sciences, Inc.)
About This Section
Patent Information for MIR5694 gene:
Search GeneIP for patents involving MIR5694

GeneCards and IP:
Japan Patent Office Licenses GeneCards     European Patent Office Licenses GeneCards     Improving the IP Search



(Antibodies, recombinant proteins, and assays from EMD Millipore, R&D Systems, OriGene, QIAGEN, GenScript, Cell Signaling Technology, SABiosciences, Novus Biologicals, Sino Biological, Enzo Life Sciences, Abcam, ProSpec, Uscn, Thermo Fisher Scientific, Gene Editing from DNA2.0, Clones from EMD Millipore, OriGene, GenScript, Sino Biological, DNA2.0, SwitchGear Genomics, Vector BioLabs, Cell lines from GenScript and LifeMap BioReagents, PCR Arrays from SABiosciences, Drugs and/or compounds from EMD Millipore, Tocris Bioscience, and/or Enzo Life Sciences),
In Situ Hybridization Assays from
Advanced Cell Diagnostics
About This Section

 
 EMD Millipore Custom Antibody & Bulk Services
 EMD Millipore Preclinical / Clinical Development Services
 EMD Millipore Immunoassay Services
 EMD Millipore Target Screening & Profiling Services

  
 Browse Antibodies   Browse Cell Culture Products  
 Browse ELISAs   Browse Flow Cytometry Kits  
 Browse Primer Pairs   Browse Kinase Activity Assays/Reagents  
 Browse ELISpot Kits/Development Modules   Browse TFB/Immunoprecipitation Assays  
 Browse Apoptosis Detection Kits/Reagents   Browse Ubiquitin Proteasome Pathway (UPP) Assay Kits/Reagents  
 Browse DNA Damage/Repair Kits/Reagents   Browse Multiplex/Array Assay Kits/Reagents  
 Browse Cell Selection/Detection Kits/Reagents   Browse Secondary Antibodies/Controls/Staining Reagents  
 Browse Phosphatase Activity Assays/Reagents   Browse Recombinant/Natural Proteins  
 Browse OriGene Antibodies   Browse OriGene shRNA RFPs  
 Browse OriGene 29mer shRNA kits in GFP-retroviral vector   Browse OriGene genome-wide validated SYBR primer pairs  
 Browse OriGene Protein Over-expression Lysates   Browse OriGene Fluorogenic Cell Assay Kits  
 Browse OriGene siRNAs   Browse 3'-UTR reporter clones for miRNA target validation  
 Browse OriGene untagged cDNA clones in CMV expression vector   Browse OriGene Myc/DDK tagged cDNA clones in CMV expression vector  
 Browse OriGene GFP tagged cDNA clones in CMV expression vector   Browse OriGene MicroRNA Expression Plasmids  
 Browse OriGene basic RS shRNAs   Browse OriGene validated miRNA SYBR primer pairs  
 Browse OriGene full length recombinant human proteins expressed in human HEK293 cells   OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling  
 OriGene Custom Antibody Services for MIR5694   OriGene Custom Protein Services for MIR5694  
 OriGene Custom Immunoassay Development  

 
 
 QIAGEN Custom miScript Target Protector blocks miRNA-binding site of in human, mouse, rat MIR5694
 Search QIAGEN SeqTarget long-range PCR primers in human, mouse, rat for resequencing MIR5694
 QIAGEN PyroMark CpG Assay predesigned Pyrosequencing DNA Methylation assays in human, mouse, rat MIR5694
 Search QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat MIR5694
 Search QIAGEN QuantiFast Probe-based Assays in human, mouse, rat MIR5694
 Search QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat MIR5694
 GenScript Custom Purified and Recombinant Proteins Services for MIR5694 GenScript Custom cDNA clones with any tag delivered in your preferred vector Services for MIR5694
 GenScript Custom Assay Services for MIR5694 GenScript Custom Superior Antibodies Services for MIR5694
 GenScript Custom overexpressing Cell Line Services for MIR5694 CloneReady with Over 120,000 Genes
 Gene Synthesis: Any Gene in Any Vector Vector-based siRNA and miRNA, Ready for Transfection
 Gene Mutant Library, Variants up to 10^11 Plasmid Preparation
 Custom Peptide Services
 Search for Antibodies & Assays

 Search Regulatory tfbs for MIR5694
 Search Chromatin IP Primers for MIR5694
 Search RT2 qPCR Primer Assays in human, mouse, rat MIR5694
 Search GNC Networks for MIR5694
 SABiosciences Custom PCR Arrays for MIR5694
 Search Tocris compounds for MIR5694
 Browse Sino Biological Proteins and Antibodies
 Browse Sino Biological cDNA Clones
 Antibodies/Proteins Production Services
 Rabbit Monoclonal Antibody Platform
 Bulk Purchasing
 Search www.enzolifesciences.com for proteins, assays, substrates, inhibitors & antibodies
 Novus Biologicals
 Novus Tissue Slides
 Search for Antibodies for MIR5694 at Abcam
 See all of Abcam's Antibodies, Kits and Proteins for MIR5694
 Custom Antibody / Protein Production Service
 Bulk Purchasing
 Advantages of Rabbit Monoclonal antibodies
 Abcam protocols and scientific support
 Browse ProSpec Recombinant Proteins




 Browse ELISAs, CLIAs, Proteins, and Antibodies at Uscn
 Search LifeMap BioReagents cell lines for MIR5694
 Gene Synthesis
 Protein Engineering
 Variant Library Synthesis
 Codon Optimization
 Protein Production and Purification
 Search Advanced Cell Diagnostics for RNAscope RNA in situ hybridization assays for MIR5694
 Browse SwitchGear 3'UTR luciferase reporter plasmids for MIR5694
 Browse SwitchGear Promoter luciferase reporter plasmids for MIR5694
 Search ThermoFisher Antibodies for MIR5694
 Search Vector BioLabs for ready-to-use adenovirus/AAV for human, mouse, rat MIR5694
       
GeneCards Homepage - Last full update: 19 Mar 2013 - Incrementals: 21 Mar 2013 , 15 Apr 2013 , 26 Apr 2013

View Random Gene

Category
VWF
(GIFTS: 73)
von Willebrand factor
GIFtS Group
The GeneCards human gene database gene index: 1 3 5 6 A B C D E F G H I J K L M N O P Q R S T U V W X Y Z 


Developed at the Crown Human Genome Center, Department of Molecular Genetics, the Weizmann Institute of Science

Hot genes      Disease genes      MIR5694 gene at Home site.
hostname: 356980-web2.xennexinc.com index build: 100 solr: 1.4