Free for academic non-profit institutions. Other users need a Commercial license

Aliases for MIR4758 Gene

Subcategory (RNA class) for MIR4758 Gene

miRNA

Quality Score for this RNA gene is

8

Aliases for MIR4758 Gene

  • MicroRNA 4758 2 3 5
  • Hsa-Mir-4758 3

External Ids for MIR4758 Gene

Previous GeneCards Identifiers for MIR4758 Gene

  • GC20U900689
  • GC20M060910
  • GC20M060912

Summaries for MIR4758 Gene

Entrez Gene Summary for MIR4758 Gene

  • microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs that are involved in post-transcriptional regulation of gene expression in multicellular organisms by affecting both the stability and translation of mRNAs. miRNAs are transcribed by RNA polymerase II as part of capped and polyadenylated primary transcripts (pri-miRNAs) that can be either protein-coding or non-coding. The primary transcript is cleaved by the Drosha ribonuclease III enzyme to produce an approximately 70-nt stem-loop precursor miRNA (pre-miRNA), which is further cleaved by the cytoplasmic Dicer ribonuclease to generate the mature miRNA and antisense miRNA star (miRNA*) products. The mature miRNA is incorporated into a RNA-induced silencing complex (RISC), which recognizes target mRNAs through imperfect base pairing with the miRNA and most commonly results in translational inhibition or destabilization of the target mRNA. The RefSeq represents the predicted microRNA stem-loop. [provided by RefSeq, Sep 2009]

GeneCards Summary for MIR4758 Gene

MIR4758 (MicroRNA 4758) is an RNA Gene, and is affiliated with the miRNA class. Diseases associated with MIR4758 include prostate cancer susceptibility.

No data available for UniProtKB/Swiss-Prot , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for MIR4758 Gene

Genomics for MIR4758 Gene

Genomic Location for MIR4758 Gene

Chromosome:
20
Start:
62,332,487 bp from pter
End:
62,332,557 bp from pter
Size:
71 bases
Orientation:
Minus strand

Genomic View for MIR4758 Gene

Genes around MIR4758 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
MIR4758 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for MIR4758 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for MIR4758 Gene

ORGUL Member Location for MIR4758 Gene

ORGUL Member Location for MIR4758 gene

No data available for Regulatory Elements for MIR4758 Gene

Proteins for MIR4758 Gene

Post-translational modifications for MIR4758 Gene

No Post-translational modifications

No data available for DME Specific Peptides for MIR4758 Gene

Domains & Families for MIR4758 Gene

Gene Families for MIR4758 Gene

Graphical View of Domain Structure for InterPro Entry

genes like me logo Genes that share domains with MIR4758: view

No data available for Protein Domains , Suggested Antigen Peptide Sequences and UniProtKB/Swiss-Prot for MIR4758 Gene

Function for MIR4758 Gene

No data available for Molecular function , Enzyme Numbers (IUBMB) , Gene Ontology (GO) - Molecular Function , Phenotypes , Human Phenotype Ontology , Animal Models , miRNA , Transcription Factor Targets and HOMER Transcription for MIR4758 Gene

Localization for MIR4758 Gene

No data available for Subcellular locations from UniProtKB/Swiss-Prot , Subcellular locations from COMPARTMENTS and Gene Ontology (GO) - Cellular Components for MIR4758 Gene

Pathways & Interactions for MIR4758 Gene

SuperPathways for MIR4758 Gene

No Data Available

Interacting Proteins for MIR4758 Gene

Gene Ontology (GO) - Biological Process for MIR4758 Gene

None

No data available for Pathways by source and SIGNOR curated interactions for MIR4758 Gene

Drugs & Compounds for MIR4758 Gene

No Compound Related Data Available

Transcripts for MIR4758 Gene

mRNA/cDNA for MIR4758 Gene

(1) Ensembl transcripts including schematic representations, and UCSC links where relevant :

Alternative Splicing Database (ASD) splice patterns (SP) for MIR4758 Gene

No ASD Table

Relevant External Links for MIR4758 Gene

GeneLoc Exon Structure for
MIR4758
ECgene alternative splicing isoforms for
MIR4758

Expression for MIR4758 Gene

mRNA expression in normal human tissues for MIR4758 Gene

genes like me logo Genes that share expression patterns with MIR4758: view

In Situ Assay Products

No data available for mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , mRNA differential expression in normal tissues , Protein differential expression in normal tissues , Protein expression , mRNA Expression by UniProt/SwissProt and Protein tissue co-expression partners for MIR4758 Gene

Orthologs for MIR4758 Gene

Evolution for MIR4758 Gene

ENSEMBL:
Gene Tree for MIR4758 (if available)
TreeFam:
Gene Tree for MIR4758 (if available)

No data available for Orthologs for MIR4758 Gene

Paralogs for MIR4758 Gene

No data available for Paralogs for MIR4758 Gene

Variants for MIR4758 Gene

Sequence variations from dbSNP and Humsavar for MIR4758 Gene

SNP ID Clin Chr 20 pos Sequence Context AA Info Type
rs748266407 -- 62,334,416(+) TCTCC(-/AGGGAGGGTGAGGCCTCACGTGGGCCCATGGTG)AGGGA upstream-variant-2KB

Structural Variations from Database of Genomic Variants (DGV) for MIR4758 Gene

Variant ID Type Subtype PubMed ID
dgv4599n71 CNV Loss 21882294
dgv4601n71 CNV Loss 21882294
nsv518296 CNV Loss 19592680
nsv913047 CNV Loss 21882294
esv2422398 CNV Duplication 17116639
nsv470556 CNV Loss 18288195
nsv834024 CNV Gain 17160897
nsv913048 CNV Loss 21882294
dgv4602n71 CNV Loss 21882294
nsv913052 CNV Gain 21882294
nsv913053 CNV Gain+Loss 21882294
dgv4603n71 CNV Loss 21882294
nsv913059 CNV Loss 21882294
nsv817908 CNV Loss 17921354
nsv470557 CNV Gain 18288195
nsv520024 CNV Loss 19592680
nsv459059 CNV Loss 19166990
dgv518n27 CNV Loss 19166990
dgv4605n71 CNV Loss 21882294
nsv913066 CNV Loss 21882294
nsv913067 CNV Loss 21882294
nsv459065 CNV Gain 19166990

Relevant External Links for MIR4758 Gene

HapMap Linkage Disequilibrium report
MIR4758

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot and Variation tolerance for MIR4758 Gene

Disorders for MIR4758 Gene

MalaCards: The human disease database

(1) MalaCards diseases for MIR4758 Gene - From: GeneCards

Disorder Aliases PubMed IDs
prostate cancer susceptibility
- elite association - COSMIC cancer census association via MalaCards

Relevant External Links for MIR4758

Atlas of Genetics and Cytogenetics in Oncology and Haematology:
MIR4758
genes like me logo Genes that share disorders with MIR4758: view

No data available for UniProtKB/Swiss-Prot and Genatlas for MIR4758 Gene

Publications for MIR4758 Gene

  1. Identification of 23 new prostate cancer susceptibility loci using the iCOGS custom genotyping array. (PMID: 23535732) Eeles R.A. … Easton D.F. (Nat. Genet. 2013) 3 67
  2. Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene. (PMID: 21199797) Persson H. … Rovira C. (Cancer Res. 2011) 3
  3. miRBase: microRNA sequences, targets and gene nomenclature. (PMID: 16381832) Griffiths-Jones S. … Enright A.J. (Nucleic Acids Res. 2006) 3

Products for MIR4758 Gene

Sources for MIR4758 Gene

Back to Top

Content