Free for academic non-profit institutions. Other users need a Commercial license

Aliases for MIR4758 Gene

Subcategory (RNA class) for MIR4758 Gene


Quality Score for this RNA gene is


Aliases for MIR4758 Gene

  • MicroRNA 4758 2 3
  • LAMA5 4 5
  • Laminin-10 Subunit Alpha 4
  • Laminin-11 Subunit Alpha 4
  • Laminin-15 Subunit Alpha 4
  • Laminin Subunit Alpha 5 5
  • Hsa-Mir-4758 3
  • KIAA0533 4
  • KIAA1907 4

External Ids for MIR4758 Gene

Previous GeneCards Identifiers for MIR4758 Gene

  • GC20U900689
  • GC20M060910
  • GC20M060912

Summaries for MIR4758 Gene

Entrez Gene Summary for MIR4758 Gene

  • microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs that are involved in post-transcriptional regulation of gene expression in multicellular organisms by affecting both the stability and translation of mRNAs. miRNAs are transcribed by RNA polymerase II as part of capped and polyadenylated primary transcripts (pri-miRNAs) that can be either protein-coding or non-coding. The primary transcript is cleaved by the Drosha ribonuclease III enzyme to produce an approximately 70-nt stem-loop precursor miRNA (pre-miRNA), which is further cleaved by the cytoplasmic Dicer ribonuclease to generate the mature miRNA and antisense miRNA star (miRNA*) products. The mature miRNA is incorporated into a RNA-induced silencing complex (RISC), which recognizes target mRNAs through imperfect base pairing with the miRNA and most commonly results in translational inhibition or destabilization of the target mRNA. The RefSeq represents the predicted microRNA stem-loop. [provided by RefSeq, Sep 2009]

GeneCards Summary for MIR4758 Gene

MIR4758 (MicroRNA 4758) is an RNA Gene, and is affiliated with the miRNA class. An important paralog of this gene is LAMA3.

UniProtKB/Swiss-Prot for MIR4758 Gene

  • Binding to cells via a high affinity receptor, laminin is thought to mediate the attachment, migration and organization of cells into tissues during embryonic development by interacting with other extracellular matrix components.

No data available for Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for MIR4758 Gene

Genomics for MIR4758 Gene

Regulatory Elements for MIR4758 Gene

Enhancers for MIR4758 Gene
GeneHancer Identifier Enhancer Score Enhancer Sources Gene-Enhancer Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor Binding Sites within enhancer Gene Targets for Enhancer
- Elite enhancer/Elite enhancer-gene association

Enhancers around MIR4758 on UCSC Golden Path with GeneCards custom track

Promoters for MIR4758 Gene
Ensembl Regulatory Elements (ENSRs) TSS Distance (bp) Size (bp) Binding Sites for Transcription Factors within promoters

ENSRs around MIR4758 on UCSC Golden Path with GeneCards custom track

Genomic Location for MIR4758 Gene

62,307,955 bp from pter
62,367,312 bp from pter
59,358 bases
Minus strand

Genomic View for MIR4758 Gene

Genes around MIR4758 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
MIR4758 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for MIR4758 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for MIR4758 Gene

ORGUL Member Location for MIR4758 Gene

ORGUL Member Location for MIR4758 gene

Proteins for MIR4758 Gene

  • Protein details for MIR4758 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Recommended name:
    Laminin subunit alpha-5
    Protein Accession:
    Secondary Accessions:
    • Q5U4N9
    • Q8TDF8
    • Q8WZA7
    • Q9H1P1

    Protein attributes for MIR4758 Gene

    3695 amino acids
    Molecular mass:
    399737 Da
    Quaternary structure:
    • Laminin is a complex glycoprotein, consisting of three different polypeptide chains (alpha, beta, gamma), which are bound to each other by disulfide bonds into a cross-shaped molecule comprising one long and three short arms with globules at each end. Alpha-5 is a subunit of laminin-10 (laminin-511), laminin-11 (laminin-521) and laminin-15 (laminin-523).
    • Laminin is a complex glycoprotein, consisting of three different polypeptide chains (alpha, beta, gamma), which are bound to each other by disulfide bonds into a cross-shaped molecule comprising one long and three short arms with globules at each end. Alpha-5 is a subunit of laminin-10 (laminin-511), laminin-11 (laminin-521) and laminin-15 (laminin-523).
    • Sequence=CAC22310.1; Type=Erroneous gene model prediction; Evidence={ECO:0000305};

    Alternative splice isoforms for MIR4758 Gene


neXtProt entry for MIR4758 Gene

Post-translational modifications for MIR4758 Gene

  • Ubiquitination at Lys 192
  • Glycosylation at Asn 95, Asn 143, Asn 243, Asn 452, Asn 479, Asn 900, Asn 921, Asn 959, Asn 1330, Asn 1529, Asn 1555, Asn 2019, Asn 2196, Asn 2209, Asn 2303, Asn 2423, Asn 2501, Asn 2568, Asn 2707, Asn 3107, Asn 3209, Asn 3257, Asn 3287, and Asn 3626
  • Modification sites at PhosphoSitePlus

Other Protein References for MIR4758 Gene

No data available for DME Specific Peptides for MIR4758 Gene

Domains & Families for MIR4758 Gene

Gene Families for MIR4758 Gene

Graphical View of Domain Structure for InterPro Entry



  • Domain G is globular and is part of the major cell-binding site located in the long arm of the laminin heterotrimer.
  • Domain G is globular and is part of the major cell-binding site located in the long arm of the laminin heterotrimer.
  • Contains 22 laminin EGF-like domains.
  • Contains 5 laminin G-like domains.
  • Contains 1 laminin IV type A domain.
  • Contains 1 laminin N-terminal domain.
genes like me logo Genes that share domains with MIR4758: view

No data available for Suggested Antigen Peptide Sequences for MIR4758 Gene

Function for MIR4758 Gene

Molecular function for MIR4758 Gene

UniProtKB/Swiss-Prot Function:
Binding to cells via a high affinity receptor, laminin is thought to mediate the attachment, migration and organization of cells into tissues during embryonic development by interacting with other extracellular matrix components.

Gene Ontology (GO) - Molecular Function for MIR4758 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005178 integrin binding IEA --
GO:0005198 structural molecule activity IC --
GO:0005515 protein binding IEA --
genes like me logo Genes that share ontologies with MIR4758: view

Animal Model Products

miRNA Products

Clone Products

Flow Cytometry Products

No data available for Enzyme Numbers (IUBMB) , Phenotypes , Human Phenotype Ontology , Animal Models , miRNA , Transcription Factor Targets and HOMER Transcription for MIR4758 Gene

Localization for MIR4758 Gene

Subcellular locations from UniProtKB/Swiss-Prot for MIR4758 Gene

Secreted, extracellular space, extracellular matrix, basement membrane. Note=Major component.

Gene Ontology (GO) - Cellular Components for MIR4758 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005576 extracellular region TAS --
GO:0005578 proteinaceous extracellular matrix IEA --
GO:0005604 basement membrane IEA --
GO:0005605 basal lamina IEA --
GO:0005610 laminin-5 complex IEA --
genes like me logo Genes that share ontologies with MIR4758: view

No data available for Subcellular locations from COMPARTMENTS for MIR4758 Gene

Pathways & Interactions for MIR4758 Gene

SuperPathways for MIR4758 Gene

No Data Available

Gene Ontology (GO) - Biological Process for MIR4758 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0001658 branching involved in ureteric bud morphogenesis IEA --
GO:0001738 morphogenesis of a polarized epithelium IEA --
GO:0001755 neural crest cell migration IEA --
GO:0001942 hair follicle development IEA --
GO:0007010 cytoskeleton organization NAS --
genes like me logo Genes that share ontologies with MIR4758: view

No data available for Pathways by source and SIGNOR curated interactions for MIR4758 Gene

Drugs & Compounds for MIR4758 Gene

No Compound Related Data Available

Transcripts for MIR4758 Gene

mRNA/cDNA for MIR4758 Gene

(15) Ensembl transcripts including schematic representations, and UCSC links where relevant :

Alternative Splicing Database (ASD) splice patterns (SP) for MIR4758 Gene

No ASD Table

Relevant External Links for MIR4758 Gene

GeneLoc Exon Structure for
ECgene alternative splicing isoforms for

Expression for MIR4758 Gene

mRNA expression in normal human tissues for MIR4758 Gene

NURSA nuclear receptor signaling pathways regulating expression of MIR4758 Gene:


mRNA Expression by UniProt/SwissProt for MIR4758 Gene:

Tissue specificity: Expressed in heart, lung, kidney, skeletal muscle, pancreas, retina and placenta. Little or no expression in brain and liver.
genes like me logo Genes that share expression patterns with MIR4758: view

No data available for mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , mRNA differential expression in normal tissues , Protein differential expression in normal tissues , Protein expression and Protein tissue co-expression partners for MIR4758 Gene

Orthologs for MIR4758 Gene

This gene was present in the common ancestor of chordates.

Orthologs for MIR4758 Gene

Organism Taxonomy Gene Similarity Type Details
(Bos Taurus)
Mammalia LAMA5 35
  • 82 (a)
(Canis familiaris)
Mammalia LAMA5 35
  • 56 (a)
(Monodelphis domestica)
Mammalia LAMA5 35
  • 68 (a)
(Mus musculus)
Mammalia Lama5 35
  • 79 (a)
(Ornithorhynchus anatinus)
Mammalia LAMA5 35
  • 59 (a)
(Gallus gallus)
Aves LAMA5 35
  • 60 (a)
(Anolis carolinensis)
Reptilia -- 35
  • 47 (a)
-- 35
  • 62 (a)
(Danio rerio)
Actinopterygii lama5 35
  • 50 (a)
Species where no ortholog for MIR4758 was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • chimpanzee (Pan troglodytes)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • fruit fly (Drosophila melanogaster)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rat (Rattus norvegicus)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea squirt (Ciona intestinalis)
  • sea squirt (Ciona savignyi)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • tropical clawed frog (Silurana tropicalis)
  • wheat (Triticum aestivum)
  • worm (Caenorhabditis elegans)

Evolution for MIR4758 Gene

Gene Tree for MIR4758 (if available)
Gene Tree for MIR4758 (if available)

Paralogs for MIR4758 Gene

Paralogs for MIR4758 Gene

genes like me logo Genes that share paralogs with MIR4758: view

Variants for MIR4758 Gene

Sequence variations from dbSNP and Humsavar for MIR4758 Gene

SNP ID Clin Chr 20 pos Sequence Context AA Info Type
rs748266407 -- 62,334,416(+) TCTCC(-/AGGGAGGGTGAGGCCTCACGTGGGCCCATGGTG)AGGGA upstream-variant-2KB

Structural Variations from Database of Genomic Variants (DGV) for MIR4758 Gene

Variant ID Type Subtype PubMed ID
dgv518n27 CNV loss 19166990
dgv7650n54 CNV loss 21841781
dgv7651n54 CNV loss 21841781
dgv7652n54 CNV loss 21841781
esv2422398 CNV duplication 17116639
nsv459059 CNV loss 19166990
nsv459065 CNV gain 19166990
nsv470556 CNV loss 18288195
nsv470557 CNV gain 18288195
nsv518296 CNV loss 19592680
nsv520024 CNV loss 19592680
nsv586496 CNV gain 21841781
nsv817908 CNV loss 17921354
nsv834024 CNV gain 17160897
nsv953301 CNV deletion 24416366

Relevant External Links for MIR4758 Gene

SNPedia medical, phenotypic, and genealogical associations of SNPs for

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot and Variation tolerance for MIR4758 Gene

Disorders for MIR4758 Gene

Relevant External Links for MIR4758

Atlas of Genetics and Cytogenetics in Oncology and Haematology:

No disorders were found for MIR4758 Gene.

No data available for MalaCards , UniProtKB/Swiss-Prot and Genatlas for MIR4758 Gene

Publications for MIR4758 Gene

  1. An enzyme assisted RP-RPLC approach for in-depth analysis of human liver phosphoproteome. (PMID: 24275569) Bian Y. … Zou H. (J. Proteomics 2014) 4 65
  2. Identification of 23 new prostate cancer susceptibility loci using the iCOGS custom genotyping array. (PMID: 23535732) Eeles R.A. … Easton D.F. (Nat. Genet. 2013) 3 65
  3. Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene. (PMID: 21199797) Persson H. … Rovira C. (Cancer Res. 2011) 3 65
  4. Initial characterization of the human central proteome. (PMID: 21269460) Burkard T.R. … Colinge J. (BMC Syst. Biol. 2011) 4 65
  5. Glycoproteomics analysis of human liver tissue by combination of multiple enzyme digestion and hydrazide chemistry. (PMID: 19159218) Chen R. … Zou H. (J. Proteome Res. 2009) 4 65

Products for MIR4758 Gene

Sources for MIR4758 Gene
