Free for academic non-profit institutions. Other users need a Commercial license

Aliases for MIR4489 Gene

Subcategory (RNA class) for MIR4489 Gene


Quality Score for this RNA gene is


Aliases for MIR4489 Gene

  • MicroRNA 4489 2 3 5
  • Hsa-Mir-4489 3
  • Mir-4489 3

External Ids for MIR4489 Gene

Previous GeneCards Identifiers for MIR4489 Gene

  • GC11U901872
  • GC11P065419

Summaries for MIR4489 Gene

Entrez Gene Summary for MIR4489 Gene

  • microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs that are involved in post-transcriptional regulation of gene expression in multicellular organisms by affecting both the stability and translation of mRNAs. miRNAs are transcribed by RNA polymerase II as part of capped and polyadenylated primary transcripts (pri-miRNAs) that can be either protein-coding or non-coding. The primary transcript is cleaved by the Drosha ribonuclease III enzyme to produce an approximately 70-nt stem-loop precursor miRNA (pre-miRNA), which is further cleaved by the cytoplasmic Dicer ribonuclease to generate the mature miRNA and antisense miRNA star (miRNA*) products. The mature miRNA is incorporated into a RNA-induced silencing complex (RISC), which recognizes target mRNAs through imperfect base pairing with the miRNA and most commonly results in translational inhibition or destabilization of the target mRNA. The RefSeq represents the predicted microRNA stem-loop. [provided by RefSeq, Sep 2009]

GeneCards Summary for MIR4489 Gene

MIR4489 (MicroRNA 4489) is an RNA Gene, and is affiliated with the miRNA class.

No data available for UniProtKB/Swiss-Prot , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for MIR4489 Gene

Genomics for MIR4489 Gene

Regulatory Elements for MIR4489 Gene

Enhancers for MIR4489 Gene
GeneHancer Identifier Enhancer Score Enhancer Sources Gene-Enhancer Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor Binding Sites within enhancer Gene Targets for Enhancer
- Elite enhancer/Elite enhancer-gene association

Enhancers around MIR4489 on UCSC Golden Path with GeneCards custom track

Promoters for MIR4489 Gene
Ensembl Regulatory Elements (ENSRs) TSS Distance (bp) Size (bp) Binding Sites for Transcription Factors within promoters

ENSRs around MIR4489 on UCSC Golden Path with GeneCards custom track

Genomic Location for MIR4489 Gene

65,649,192 bp from pter
65,649,253 bp from pter
62 bases
Plus strand

Genomic View for MIR4489 Gene

Genes around MIR4489 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
MIR4489 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for MIR4489 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for MIR4489 Gene

Proteins for MIR4489 Gene

Post-translational modifications for MIR4489 Gene

No Post-translational modifications

No data available for DME Specific Peptides for MIR4489 Gene

Domains & Families for MIR4489 Gene

Gene Families for MIR4489 Gene

Graphical View of Domain Structure for InterPro Entry

genes like me logo Genes that share domains with MIR4489: view

No data available for Protein Domains , Suggested Antigen Peptide Sequences and UniProtKB/Swiss-Prot for MIR4489 Gene

Function for MIR4489 Gene

Animal Model Products

miRNA Products

Clone Products

Flow Cytometry Products

No data available for Molecular function , Enzyme Numbers (IUBMB) , Gene Ontology (GO) - Molecular Function , Phenotypes , Human Phenotype Ontology , Animal Models , miRNA , Transcription Factor Targets and HOMER Transcription for MIR4489 Gene

Localization for MIR4489 Gene

No data available for Subcellular locations from UniProtKB/Swiss-Prot , Subcellular locations from COMPARTMENTS and Gene Ontology (GO) - Cellular Components for MIR4489 Gene

Pathways & Interactions for MIR4489 Gene

SuperPathways for MIR4489 Gene

No Data Available

Interacting Proteins for MIR4489 Gene

Gene Ontology (GO) - Biological Process for MIR4489 Gene


No data available for Pathways by source and SIGNOR curated interactions for MIR4489 Gene

Drugs & Compounds for MIR4489 Gene

No Compound Related Data Available

Transcripts for MIR4489 Gene

mRNA/cDNA for MIR4489 Gene

(1) Ensembl transcripts including schematic representations, and UCSC links where relevant :

Alternative Splicing Database (ASD) splice patterns (SP) for MIR4489 Gene

No ASD Table

Relevant External Links for MIR4489 Gene

GeneLoc Exon Structure for
ECgene alternative splicing isoforms for

Expression for MIR4489 Gene

mRNA expression in normal human tissues for MIR4489 Gene

NURSA nuclear receptor signaling pathways regulating expression of MIR4489 Gene:

genes like me logo Genes that share expression patterns with MIR4489: view

No data available for mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , mRNA differential expression in normal tissues , Protein differential expression in normal tissues , Protein expression , Protein tissue co-expression partners and mRNA Expression by UniProt/SwissProt for MIR4489 Gene

Orthologs for MIR4489 Gene

Evolution for MIR4489 Gene

Gene Tree for MIR4489 (if available)
Gene Tree for MIR4489 (if available)

No data available for Orthologs for MIR4489 Gene

Paralogs for MIR4489 Gene

No data available for Paralogs for MIR4489 Gene

Variants for MIR4489 Gene

Sequence variations from dbSNP and Humsavar for MIR4489 Gene

SNP ID Clin Chr 11 pos Sequence Context AA Info Type
rs539929067 -- 65,647,206(+) GGCAA(-/GGCCGGAACTGGTGCCCTCG)GGTAA upstream-variant-2KB

Structural Variations from Database of Genomic Variants (DGV) for MIR4489 Gene

Variant ID Type Subtype PubMed ID
dgv1969n54 CNV loss 21841781
nsv951018 CNV deletion 24416366

Relevant External Links for MIR4489 Gene

SNPedia medical, phenotypic, and genealogical associations of SNPs for

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot and Variation tolerance for MIR4489 Gene

Disorders for MIR4489 Gene

Relevant External Links for MIR4489

Atlas of Genetics and Cytogenetics in Oncology and Haematology:

No disorders were found for MIR4489 Gene.

No data available for MalaCards , UniProtKB/Swiss-Prot and Genatlas for MIR4489 Gene

Publications for MIR4489 Gene

  1. Genome-wide association study identifies three novel susceptibility loci for severe Acne vulgaris. (PMID: 24927181) Navarini A.A. … Barker J.N. (Nat Commun 2014) 3 65
  2. miRBase: integrating microRNA annotation and deep-sequencing data. (PMID: 21037258) Kozomara A. … Griffiths-Jones S. (Nucleic Acids Res. 2011) 3 65
  3. Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene. (PMID: 21199797) Persson H. … Rovira C. (Cancer Res. 2011) 3 65
  4. Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs. (PMID: 20733160) Jima D.D. … Dave S.S. (Blood 2010) 3 65
  5. miRBase: microRNA sequences, targets and gene nomenclature. (PMID: 16381832) Griffiths-Jones S. … Enright A.J. (Nucleic Acids Res. 2006) 3 65

Products for MIR4489 Gene

Sources for MIR4489 Gene
