Aliases for MIR3690 Gene
Subcategory (RNA class) for MIR3690 Gene
Quality Score for this RNA gene is
Aliases for MIR3690 Gene
External Ids for MIR3690 Gene
- HGNC: 38967
- Entrez Gene: 100500894
- Ensembl: ENSG00000265658
- miRBase: hsa-mir-3690-1
- miRBase: hsa-mir-3690-2
Previous HGNC Symbols for MIR3690 Gene
- MIR3690-2
- MIR3690-1
Previous GeneCards Identifiers for MIR3690 Gene
- GC0XU901663
- GC00U934026
- GC0XP001417
- GC0XP001297
- GC0XP001300
Summaries for MIR3690 Gene
-
microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs that are involved in post-transcriptional regulation of gene expression in multicellular organisms by affecting both the stability and translation of mRNAs. miRNAs are transcribed by RNA polymerase II as part of capped and polyadenylated primary transcripts (pri-miRNAs) that can be either protein-coding or non-coding. The primary transcript is cleaved by the Drosha ribonuclease III enzyme to produce an approximately 70-nt stem-loop precursor miRNA (pre-miRNA), which is further cleaved by the cytoplasmic Dicer ribonuclease to generate the mature miRNA and antisense miRNA star (miRNA*) products. The mature miRNA is incorporated into a RNA-induced silencing complex (RISC), which recognizes target mRNAs through imperfect base pairing with the miRNA and most commonly results in translational inhibition or destabilization of the target mRNA. The RefSeq represents the predicted microRNA stem-loop. [provided by RefSeq, Sep 2009]
GeneCards Summary for MIR3690 Gene
MIR3690 (MicroRNA 3690) is an RNA Gene, and is affiliated with the miRNA class.
Additional gene information for MIR3690 Gene
- Monarch Initiative
- Search for MIR3690 at DataMed
- Search for MIR3690 at HumanCyc
No data available for CIViC summary , UniProtKB/Swiss-Prot , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for MIR3690 Gene
Genomics for MIR3690 Gene
GeneHancer (GH) Regulatory Elements for MIR3690 Gene
GeneHancer (GH) Identifier | GH Type | GH Score |
GH Sources | Gene Association Score | Total Score | TSS distance (kb) | Number of Genes Away | Size (kb) | Transcription Factor Binding Sites |
Gene Targets |
---|---|---|---|---|---|---|---|---|---|---|
GH0XI001268 | Promoter | 1.4 | EPDnew Ensembl | 0.3 | -24.9 | -24917 | 0.4 | MXI1 MAZ USF2 MAX CEBPB SMARCB1 RFX5 POLR2A NFYB RCOR1 | CSF2RA MIR3690 | |
GH0XI001279 | Enhancer | 0.3 | Ensembl | 0.4 | -13.9 | -13917 | 1.2 | RUNX3 | CSF2RA MIR3690 | |
GH0XI001274 | Enhancer | 0.2 | Ensembl | 0.4 | -19.3 | -19345 | 1.7 | CSF2RA MIR3690 | ||
GH0XI001273 | Enhancer | 0.2 | Ensembl | 0.3 | -20.4 | -20417 | 0.2 | CSF2RA MIR3690 |
Regulatory Element Products
Genomic Locations for MIR3690 Gene
- chrX:1,293,918-1,293,992
- (GRCh38/hg38)
- Size:
- 75 bases
- Orientation:
- Plus strand
- chrX:1,412,811-1,412,885
- (GRCh37/hg19)
Genomic View for MIR3690 Gene
- Cytogenetic band:
-
- Xp22.33 by Ensembl
- Xp22.33 and Yp11.2 by Entrez Gene
- Xp22.32 and Yp11.3 by HGNC


RefSeq DNA sequence for MIR3690 Gene
Proteins for MIR3690 Gene
Post-translational modifications for MIR3690 Gene
Antibody Products
- Search GeneTex for Antibodies for MIR3690
Protein Products
- Search Origene for Purified Proteins, MassSpec and Protein Over-expression Lysates for MIR3690
- Origene Custom Protein Services for MIR3690
- Search GeneTex for Proteins for MIR3690
No data available for DME Specific Peptides for MIR3690 Gene
Domains & Families for MIR3690 Gene
Gene Families for MIR3690 Gene
Graphical View of Domain Structure for InterPro Entry
No data available for Protein Domains , Suggested Antigen Peptide Sequences and UniProtKB/Swiss-Prot for MIR3690 Gene
Function for MIR3690 Gene
Animal Model Products
- Taconic Biosciences: Generate A Custom CRISPR Mouse Model For Your Study
- Cyagen custom Knockout/knockin (KOKI) mouse models for MIR3690
-
- Search ViGene Biosciences for MIR3690
CRISPR Products
- Browse CRISPR knockouts for MIR3690
- Applied Biological Materials CRISPR for MIR3690
-
Vectors and viruses for KO, Activation, Repression, and more
Inhibitory RNA Products
- Search ViGene Biosciences for MIR3690
Clone Products
- GenScript: Custom all cDNA clones Services for MIR3690
- VectorBuilder custom plasmid, inducible vectors for MIR3690
- VectorBuilder custom lentivirus, adenovirus, AAV vector/virus packaging for MIR3690
-
VectorBuilder Other custom vectors
- Mammalian expression: PiggyBac
- Mammalian Tet-on expression: plasmid
- Mammalian conditional (Cre-Lox): plasmid and PiggyBac
- Mammalian shRNA knockdown: lentiviral, adenoviral, AAV, and PiggyBac
- CRISPR: plasmid gRNA, lentiviral gRNA, and donor plasmid
- Bacterial expression: pET, pBAD, and pCS
- Yeast expression
- Applied Biological Materials Clones for MIR3690
-
Vectors and viruses for ORF, Lenti, Retro, Adenovirus, AAV, and more
No data available for Molecular function , Enzyme Numbers (IUBMB) , Phenotypes From GWAS Catalog , Gene Ontology (GO) - Molecular Function , Phenotypes , Human Phenotype Ontology , Animal Models , miRNA , Transcription Factor Targets and HOMER Transcription for MIR3690 Gene
Localization for MIR3690 Gene
No data available for Subcellular locations from UniProtKB/Swiss-Prot , Subcellular locations from COMPARTMENTS , Subcellular locations from the Human Protein Atlas (HPA) and Gene Ontology (GO) - Cellular Components for MIR3690 Gene
Transcripts for MIR3690 Gene
mRNA/cDNA for MIR3690 Gene
- (1) Ensembl transcripts including schematic representations, and UCSC links where relevant :
CRISPR Products
- Browse CRISPR knockouts for MIR3690
- Applied Biological Materials CRISPR for MIR3690
-
Vectors and viruses for KO, Activation, Repression, and more
Inhibitory RNA Products
- Search ViGene Biosciences for MIR3690
Clone Products
- GenScript: Custom all cDNA clones Services for MIR3690
- VectorBuilder custom plasmid, inducible vectors for MIR3690
- VectorBuilder custom lentivirus, adenovirus, AAV vector/virus packaging for MIR3690
-
VectorBuilder Other custom vectors
- Mammalian expression: PiggyBac
- Mammalian Tet-on expression: plasmid
- Mammalian conditional (Cre-Lox): plasmid and PiggyBac
- Mammalian shRNA knockdown: lentiviral, adenoviral, AAV, and PiggyBac
- CRISPR: plasmid gRNA, lentiviral gRNA, and donor plasmid
- Bacterial expression: pET, pBAD, and pCS
- Yeast expression
- Applied Biological Materials Clones for MIR3690
-
Vectors and viruses for ORF, Lenti, Retro, Adenovirus, AAV, and more
Expression for MIR3690 Gene
NURSA nuclear receptor signaling pathways regulating expression of MIR3690 Gene:
MIR3690Primer Products
No data available for mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , mRNA differential expression in normal tissues , Protein differential expression in normal tissues , Protein expression , Protein tissue co-expression partners , mRNA Expression by UniProt/SwissProt , Evidence on tissue expression from TISSUES and Phenotype-based relationships between genes and organs from Gene ORGANizer for MIR3690 Gene
Orthologs for MIR3690 Gene
No data available for Orthologs for MIR3690 Gene
Paralogs for MIR3690 Gene
No data available for Paralogs for MIR3690 Gene
Variants for MIR3690 Gene
SNP ID | Clin | Chr 0X pos | Variation | AA Info | Type |
---|---|---|---|---|---|
rs377345813 | uncertain-significance, Surfactant metabolism dysfunction, pulmonary, 4 | 1,294,454(+) | ACAGAAAGGTCGGTGAGA/ACAGAAAGGTCGGTGAGACAGAAAGGTCGGTGAGA | downstream_transcript_variant | |
rs189869234 | likely-benign, not specified | 1,294,321(+) | G/A | downstream_transcript_variant | |
rs111232301 | -- | 1,294,181(+) | C/A/G | downstream_transcript_variant | |
rs111278186 | -- | 1,293,222(+) | TTT/TTTCTTT | upstream_transcript_variant | |
rs111311869 | -- | 1,293,135(+) | G/T | upstream_transcript_variant |
Variant ID | Type | Subtype | PubMed ID |
---|---|---|---|
dgv4561e59 | CNV | duplication | 20981092 |
esv21933 | CNV | gain+loss | 19812545 |
esv2671552 | CNV | deletion | 23128226 |
esv2739657 | CNV | deletion | 23290073 |
esv2739658 | CNV | deletion | 23290073 |
esv29996 | CNV | loss | 17803354 |
nsv1077571 | CNV | duplication | 25765185 |
nsv1078698 | CNV | duplication | 25765185 |
nsv1115919 | CNV | duplication | 24896259 |
nsv1119378 | CNV | duplication | 24896259 |
nsv1141657 | CNV | duplication | 24896259 |
nsv1146849 | CNV | duplication | 26484159 |
nsv1153650 | CNV | duplication | 26484159 |
Additional Variant Information for MIR3690 Gene
- SNPedia medical, phenotypic, and genealogical associations of SNPs for
- MIR3690
No data available for Polymorphic Variants from UniProtKB/Swiss-Prot and Variation tolerance for MIR3690 Gene
Disorders for MIR3690 Gene
Additional Disease Information for MIR3690
No disorders were found for MIR3690 Gene.
No data available for MalaCards , UniProtKB/Swiss-Prot and Genatlas for MIR3690 Gene
Publications for MIR3690 Gene
- miRBase: integrating microRNA annotation and deep-sequencing data. (PMID: 21037258) Kozomara A … Griffiths-Jones S (Nucleic acids research 2011) 3 58
- Analysis of microRNA transcriptome by deep sequencing of small RNA libraries of peripheral blood. (PMID: 20459673) Vaz C … Bhattacharya A (BMC genomics 2010) 3 58
- miRBase: microRNA sequences, targets and gene nomenclature. (PMID: 16381832) Griffiths-Jones S … Enright AJ (Nucleic acids research 2006) 3 58
Products for MIR3690 Gene
- Browse R&D Systems for Antibodies
- Browse R&D Systems for Human Recombinant Proteins
- Browse R&D Systems for biochemical assays
- Browse Primary Antibodies
- Browse Proteins and Enzymes
- Browse ELISAs
- Browse Activity Assays
- Browse cDNA Clones
- Browse Cell Culture Products
- Browse Cell Selection and Detection Kits
- Browse DNA Damage and Repair Kits
- Browse ELISpot/FluoroSpot Kits and Development Modules
- Browse Flow Cytometry Kits
- Browse Immunoprecipitation Assays
- Browse Luminex Assays
- Browse Peptides
- Browse Proteome Profiler Antibody Arrays
- Browse Small Molecules
- Browse OriGene Antibodies
- Custom Antibody Services
- Browse OriGene ELISA Kits
- Custom Assay Services
- Search Origene for Purified Proteins, MassSpec and Protein Over-expression Lysates for MIR3690
- Origene Custom Protein Services for MIR3690
- Browse OriGene Inhibitory RNA Products For MIR3690
- Browse OriGene qPCR primer pairs and template standards
- Browse CRISPR knockouts for MIR3690
- Custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
- Browse OriGene miRNA Products For MIR3690
- GenScript: Custom all cDNA clones Services for MIR3690
- GenScript Custom Purified and Recombinant Proteins Services for MIR3690
- GenScript Custom Assay Services for MIR3690
- GenScript Custom overexpressing Cell Line Services for MIR3690
- Browse GenScript CRISPR for MIR3690
- Design optimal peptide antigens
- CloneReady with Over 120,000 Genes
- Gene Synthesis: Any Gene in Any Vector
- Vector-based siRNA and miRNA, Ready for Transfection
- Gene Mutant Library, Variants up to 10^11
- Plasmid Preparation
- GenScript Custom Peptide Services for MIR3690
- Browse Sino Biological cDNA Clones
- Browse Sino Biological Cell Lysates
- Browse Sino Biological Recombinant Proteins
- Browse Sino Biological Antibodies
- Browse Sino Biological Assays
- Browse Sino Biological ELISA Kits
- Browse Sino Biological ELISA Pair Sets
- Browse Sino Biological CRO Services
- Browse Sino Biological Control Vectors
- Sino Biological Transfection Reagent
- Sino Biological Anti-His Tag Antibody
- Novus Biologicals
- Novus Biologicals Tissue Microarrays
- Browse Antibodies at Cloud-Clone Corp.
- Browse Proteins at Cloud-Clone Corp.
- Browse Assay Kits at Cloud-Clone Corp.
- Browse Knockouts at Cloud-Clone Corp.
- Browse Knockins at Cloud-Clone Corp.
- Cloud-Clone Corp. disease models service
- Browse cDNA clones at Cloud-Clone Corp.
- Browse primers at Cloud-Clone Corp.
- Cloud-Clone Corp. primary cells service
- Cyagen custom Knockout/knockin (KOKI) mouse models for MIR3690
- VectorBuilder custom plasmid, inducible vectors for MIR3690
- VectorBuilder custom lentivirus, adenovirus, AAV vector/virus packaging for MIR3690
- VectorBuilder Other custom vectors
- Mammalian expression: PiggyBac
- Mammalian Tet-on expression: plasmid
- Mammalian conditional (Cre-Lox): plasmid and PiggyBac
- Mammalian shRNA knockdown: lentiviral, adenoviral, AAV, and PiggyBac
- CRISPR: plasmid gRNA, lentiviral gRNA, and donor plasmid
- Bacterial expression: pET, pBAD, and pCS
- Yeast expression
- Search GeneTex for Antibodies for MIR3690
- Search GeneTex for Proteins for MIR3690
Sources for MIR3690 Gene
- (1) GeneCards
- (2) HGNC
- (3) EntrezGene
- (4) Swiss-Prot
- (5) Ensembl
- (6) OMIM
- (7) GeneLoc
- (8) Gene Wiki
- (9) UCSC
- (10) PhosphoSitePlus
- (11) GO
- (12) TrEMBL
- (13) InterPro
- (14) ProtoNet
- (15) Blocks
- (16) MGI
- (17) IUBMB
- (18) KEGG
- (19) MINT
- (20) STRING
- (21) IntAct
- (22) Novoseek
- (23) PharmGKB
- (24) DrugBank
- (25) HMDB
- (26) UniGene
- (27) AceView
- (28) ASD
- (29) ECgene
- (30) GeneAnnot
- (31) CGAP SAGE
- (32) SOURCE
- (33) HomoloGene
- (34) PanEnsembl
- (35) euGenes
- (36) SGD
- (37) FlyBase
- (38) WormBase
- (39) Pseudogene
- (40) DGV
- (41) dbSNP
- (42) GenAtlas
- (43) HGMD
- (44) GAD
- (45) BGMUT
- (46) HuGE
- (47) Atlas
- (48) Cell Signaling Technology
- (49) GenBank
- (50) H-invDB
- (51) HORDE
- (52) HUGE
- (53) IMGT
- (54) Leiden
- (55) miRBase
- (56) DME
- (57) OriGene
- (58) PubMed
- (59) R&D Systems
- (60) TGDB
- (61) Tocris
- (62) Abcam
- (63) Novus Biologicals
- (64) ProSpec
- (65) Sino Biological
- (66) GenScript
- (67) Qiagen
- (68) Cloud-Clone Corp.
- (69) OCA
- (70) Proteopedia
- (71) MOPED
- (72) neXtProt
- (73) Reactome
- (74) GeneGo (Thomson Reuters)
- (75) fRNAdb
- (76) DISEASES
- (77) SIMAP
- (78) GenomeRNAi
- (79) LifeMap
- (80) miRTarBase
- (81) MalaCards
- (82) Invitrogen
- (83) BitterDB
- (84) Vector BioLabs
- (85) ESI-BIO
- (86) RefSeq
- (87) BioSystems
- (88) MaxQB
- (89) IUPHAR
- (90) BioGPS
- (91) Illumina
- (92) COMPARTMENTS
- (93) HOMER
- (94) PaxDb
- (95) ApexBio
- (96) Addgene
- (97) antibodies-online
- (98) CYP
- (99) NONCODE
- (100) SwitchGear Genomics
- (101) TreeFam
- (102) PathCards
- (103) GeneReviews
- (104) GeneTex
- (105) Taconic Biosciences
- (106) GTEx
- (107) ProteomicsDB
- (108) SCBT
- (109) DGIdb
- (110) ClinicalTrials
- (111) FDA Approved Drugs
- (112) RVIS
- (113) SIGNOR
- (114) diseasecard
- (115) NIH Rare Diseases
- (116) Orphanet
- (117) UMLS
- (118) GTR
- (119) Disease Ontology
- (120) Genetics Home Reference
- (121) MeSH
- (122) MedlinePlus
- (123) CDC
- (124) NINDS
- (125) NCBI Bookshelf
- (126) ClinVar
- (127) Gene Damage Index
- (128) ViGene Biosciences
- (129) HPO
- (130) UDN
- (131) VISTA
- (132) FANTOM5
- (133) ENCODE
- (134) ProSci
- (135) Horizon
- (136) NURSA
- (137) IID
- (138) Cyagen
- (139) VectorBuilder
- (140) SNPedia
- (141) BRCA Exchange
- (142) St John's Lab
- (143) CIViC
- (144) ProteoGenix
- (145) dbSUPER
- (146) TISSUES
- (147) Gene ORGANizer
- (148) abm
- (149) CrownBio
- (150) Human Protein Atlas
- (151) GWAS Catalog
- (152) Monarch Initiative
- (153) DataMed
- (154) HumanCyc
- (155) genomics-online
- (156) UCNEbase
- (157) EPDnew