Free for academic non-profit institutions. Other users need a Commercial license

Aliases for MIR3690 Gene

Subcategory (RNA class) for MIR3690 Gene

miRNA

Quality Score for this RNA gene is

3

Aliases for MIR3690 Gene

  • MicroRNA 3690 2 3 5
  • MicroRNA 3690-2 2 3
  • MicroRNA 3690-1 2 3
  • Hsa-Mir-3690-1 3
  • Hsa-Mir-3690-2 3
  • Hsa-Mir-3690 3
  • Mir-3690-1 3
  • Mir-3690-2 3
  • MIR3690-1 3
  • MIR3690-2 3

External Ids for MIR3690 Gene

Previous HGNC Symbols for MIR3690 Gene

  • MIR3690-2
  • MIR3690-1

Previous GeneCards Identifiers for MIR3690 Gene

  • GC0XU901663
  • GC00U934026
  • GC0XP001417
  • GC0XP001297
  • GC0XP001300

Summaries for MIR3690 Gene

Entrez Gene Summary for MIR3690 Gene

  • microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs that are involved in post-transcriptional regulation of gene expression in multicellular organisms by affecting both the stability and translation of mRNAs. miRNAs are transcribed by RNA polymerase II as part of capped and polyadenylated primary transcripts (pri-miRNAs) that can be either protein-coding or non-coding. The primary transcript is cleaved by the Drosha ribonuclease III enzyme to produce an approximately 70-nt stem-loop precursor miRNA (pre-miRNA), which is further cleaved by the cytoplasmic Dicer ribonuclease to generate the mature miRNA and antisense miRNA star (miRNA*) products. The mature miRNA is incorporated into a RNA-induced silencing complex (RISC), which recognizes target mRNAs through imperfect base pairing with the miRNA and most commonly results in translational inhibition or destabilization of the target mRNA. The RefSeq represents the predicted microRNA stem-loop. [provided by RefSeq, Sep 2009]

GeneCards Summary for MIR3690 Gene

MIR3690 (MicroRNA 3690) is an RNA Gene, and is affiliated with the miRNA class.

Additional gene information for MIR3690 Gene

No data available for CIViC summary , UniProtKB/Swiss-Prot , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for MIR3690 Gene

Genomics for MIR3690 Gene

GeneHancer (GH) Regulatory Elements for MIR3690 Gene

Promoters and enhancers for MIR3690 Gene
GeneHancer (GH) Identifier GH Type GH
Score
GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites
Gene Targets
GH0XI001268 Promoter 1.4 EPDnew Ensembl 0.3 -24.9 -24917 0.4 MXI1 MAZ USF2 MAX CEBPB SMARCB1 RFX5 POLR2A NFYB RCOR1 CSF2RA MIR3690
GH0XI001279 Enhancer 0.3 Ensembl 0.4 -13.9 -13917 1.2 RUNX3 CSF2RA MIR3690
GH0XI001274 Enhancer 0.2 Ensembl 0.4 -19.3 -19345 1.7 CSF2RA MIR3690
GH0XI001273 Enhancer 0.2 Ensembl 0.3 -20.4 -20417 0.2 CSF2RA MIR3690
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data dump

GeneHancers around MIR3690 on UCSC Golden Path with GeneCards custom track

Genomic Locations for MIR3690 Gene

Genomic Locations for MIR3690 Gene
chrX:1,293,918-1,293,992
(GRCh38/hg38)
Size:
75 bases
Orientation:
Plus strand
chrX:1,412,811-1,412,885
(GRCh37/hg19)

Genomic View for MIR3690 Gene

Genes around MIR3690 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
MIR3690 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for MIR3690 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for MIR3690 Gene

Proteins for MIR3690 Gene

Post-translational modifications for MIR3690 Gene

No Post-translational modifications

No data available for DME Specific Peptides for MIR3690 Gene

Domains & Families for MIR3690 Gene

Gene Families for MIR3690 Gene

Graphical View of Domain Structure for InterPro Entry

genes like me logo Genes that share domains with MIR3690: view

No data available for Protein Domains , Suggested Antigen Peptide Sequences and UniProtKB/Swiss-Prot for MIR3690 Gene

Function for MIR3690 Gene

Animal Model Products

miRNA Products

Clone Products

No data available for Molecular function , Enzyme Numbers (IUBMB) , Phenotypes From GWAS Catalog , Gene Ontology (GO) - Molecular Function , Phenotypes , Human Phenotype Ontology , Animal Models , miRNA , Transcription Factor Targets and HOMER Transcription for MIR3690 Gene

Localization for MIR3690 Gene

No data available for Subcellular locations from UniProtKB/Swiss-Prot , Subcellular locations from COMPARTMENTS , Subcellular locations from the Human Protein Atlas (HPA) and Gene Ontology (GO) - Cellular Components for MIR3690 Gene

Pathways & Interactions for MIR3690 Gene

SuperPathways for MIR3690 Gene

No Data Available

Interacting Proteins for MIR3690 Gene

Gene Ontology (GO) - Biological Process for MIR3690 Gene

None

No data available for Pathways by source and SIGNOR curated interactions for MIR3690 Gene

Drugs & Compounds for MIR3690 Gene

No Compound Related Data Available

Transcripts for MIR3690 Gene

mRNA/cDNA for MIR3690 Gene

(1) Ensembl transcripts including schematic representations, and UCSC links where relevant :

miRNA Products

Clone Products

Alternative Splicing Database (ASD) splice patterns (SP) for MIR3690 Gene

No ASD Table

Relevant External Links for MIR3690 Gene

GeneLoc Exon Structure for
MIR3690
ECgene alternative splicing isoforms for
MIR3690

Expression for MIR3690 Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for MIR3690 Gene

NURSA nuclear receptor signaling pathways regulating expression of MIR3690 Gene:

MIR3690
genes like me logo Genes that share expression patterns with MIR3690: view

No data available for mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , mRNA differential expression in normal tissues , Protein differential expression in normal tissues , Protein expression , Protein tissue co-expression partners , mRNA Expression by UniProt/SwissProt , Evidence on tissue expression from TISSUES and Phenotype-based relationships between genes and organs from Gene ORGANizer for MIR3690 Gene

Orthologs for MIR3690 Gene

Evolution for MIR3690 Gene

ENSEMBL:
Gene Tree for MIR3690 (if available)
TreeFam:
Gene Tree for MIR3690 (if available)

No data available for Orthologs for MIR3690 Gene

Paralogs for MIR3690 Gene

No data available for Paralogs for MIR3690 Gene

Variants for MIR3690 Gene

Sequence variations from dbSNP and Humsavar for MIR3690 Gene

SNP ID Clin Chr 0X pos Variation AA Info Type
rs377345813 uncertain-significance, Surfactant metabolism dysfunction, pulmonary, 4 1,294,454(+) ACAGAAAGGTCGGTGAGA/ACAGAAAGGTCGGTGAGACAGAAAGGTCGGTGAGA downstream_transcript_variant
rs189869234 likely-benign, not specified 1,294,321(+) G/A downstream_transcript_variant
rs111232301 -- 1,294,181(+) C/A/G downstream_transcript_variant
rs111278186 -- 1,293,222(+) TTT/TTTCTTT upstream_transcript_variant
rs111311869 -- 1,293,135(+) G/T upstream_transcript_variant

Structural Variations from Database of Genomic Variants (DGV) for MIR3690 Gene

Variant ID Type Subtype PubMed ID
dgv4561e59 CNV duplication 20981092
esv21933 CNV gain+loss 19812545
esv2671552 CNV deletion 23128226
esv2739657 CNV deletion 23290073
esv2739658 CNV deletion 23290073
esv29996 CNV loss 17803354
nsv1077571 CNV duplication 25765185
nsv1078698 CNV duplication 25765185
nsv1115919 CNV duplication 24896259
nsv1119378 CNV duplication 24896259
nsv1141657 CNV duplication 24896259
nsv1146849 CNV duplication 26484159
nsv1153650 CNV duplication 26484159

Additional Variant Information for MIR3690 Gene

SNPedia medical, phenotypic, and genealogical associations of SNPs for
MIR3690

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot and Variation tolerance for MIR3690 Gene

Disorders for MIR3690 Gene

Additional Disease Information for MIR3690

No disorders were found for MIR3690 Gene.

No data available for MalaCards , UniProtKB/Swiss-Prot and Genatlas for MIR3690 Gene

Publications for MIR3690 Gene

  1. miRBase: integrating microRNA annotation and deep-sequencing data. (PMID: 21037258) Kozomara A … Griffiths-Jones S (Nucleic acids research 2011) 3 58
  2. Analysis of microRNA transcriptome by deep sequencing of small RNA libraries of peripheral blood. (PMID: 20459673) Vaz C … Bhattacharya A (BMC genomics 2010) 3 58
  3. miRBase: microRNA sequences, targets and gene nomenclature. (PMID: 16381832) Griffiths-Jones S … Enright AJ (Nucleic acids research 2006) 3 58

Products for MIR3690 Gene

Sources for MIR3690 Gene

Content
Loading form....