Free for academic non-profit institutions. Other users need a Commercial license

Aliases for MIR3606 Gene

Subcategory (RNA class) for MIR3606 Gene

miRNA

Quality Score for this RNA gene is

3

Aliases for MIR3606 Gene

  • MicroRNA 3606 2 3 5
  • Hsa-Mir-3606 3
  • Mir-3606 3

External Ids for MIR3606 Gene

Previous GeneCards Identifiers for MIR3606 Gene

  • GC02U902314
  • GC02P189862

Summaries for MIR3606 Gene

Entrez Gene Summary for MIR3606 Gene

  • microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs that are involved in post-transcriptional regulation of gene expression in multicellular organisms by affecting both the stability and translation of mRNAs. miRNAs are transcribed by RNA polymerase II as part of capped and polyadenylated primary transcripts (pri-miRNAs) that can be either protein-coding or non-coding. The primary transcript is cleaved by the Drosha ribonuclease III enzyme to produce an approximately 70-nt stem-loop precursor miRNA (pre-miRNA), which is further cleaved by the cytoplasmic Dicer ribonuclease to generate the mature miRNA and antisense miRNA star (miRNA*) products. The mature miRNA is incorporated into a RNA-induced silencing complex (RISC), which recognizes target mRNAs through imperfect base pairing with the miRNA and most commonly results in translational inhibition or destabilization of the target mRNA. The RefSeq represents the predicted microRNA stem-loop. [provided by RefSeq, Sep 2009]

GeneCards Summary for MIR3606 Gene

MIR3606 (MicroRNA 3606) is an RNA Gene, and is affiliated with the miRNA class. Diseases associated with MIR3606 include Acrogeria, Gottron Type and Ehlers-Danlos Syndrome, Type Iv. Among its related pathways are Inflammatory Response Pathway and Focal Adhesion.

No data available for CIViC summary , UniProtKB/Swiss-Prot , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for MIR3606 Gene

Genomics for MIR3606 Gene

Regulatory Elements for MIR3606 Gene

Enhancers for MIR3606 Gene
GeneHancer Identifier Enhancer Score Enhancer Sources Gene-Enhancer Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor Binding Sites within enhancer Gene Targets for Enhancer
GH02G188995 0.5 ENCODE 0.7 +1.1 1078 2.2 CEBPA HLF MAFK MIR3606 ENSG00000228073
GH02G189013 0.8 Ensembl ENCODE 0.4 +19.1 19056 2.0 FOSL1 ZNF202 POLR2A SIN3A ZBTB33 MIR3606 ENSG00000228073
GH02G189002 0.7 ENCODE 0.4 +7.2 7197 1.6 JUN SIN3A EP300 JUND GATA3 GATA2 CREB1 FOS CUX1 MAFK MIR1245A MIR3606 ENSG00000228073
GH02G189020 0.9 Ensembl ENCODE 0.3 +26.4 26370 3.3 ZNF146 PKNOX1 BHLHE40 HLF FEZF1 ZNF843 OSR2 ZNF316 JUND PRDM6 COL5A2 WDR75 MIR3606 ENSG00000228073
GH02G189024 0.7 Ensembl ENCODE 0.3 +29.8 29788 1.6 CTCF RAD21 ZNF652 COL5A2 WDR75 MIR3606 ENSG00000228073
- Elite enhancer and/or Elite enhancer-gene association Download GeneHancer data dump

Enhancers around MIR3606 on UCSC Golden Path with GeneCards custom track

Genomic Location for MIR3606 Gene

Chromosome:
2
Start:
188,995,630 bp from pter
End:
188,995,692 bp from pter
Size:
63 bases
Orientation:
Plus strand

Genomic View for MIR3606 Gene

Genes around MIR3606 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
MIR3606 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for MIR3606 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for MIR3606 Gene

Proteins for MIR3606 Gene

Post-translational modifications for MIR3606 Gene

No Post-translational modifications

No data available for DME Specific Peptides for MIR3606 Gene

Domains & Families for MIR3606 Gene

Gene Families for MIR3606 Gene

Graphical View of Domain Structure for InterPro Entry

genes like me logo Genes that share domains with MIR3606: view

No data available for Protein Domains , Suggested Antigen Peptide Sequences and UniProtKB/Swiss-Prot for MIR3606 Gene

Function for MIR3606 Gene

Animal Model Products

No data available for Molecular function , Enzyme Numbers (IUBMB) , Gene Ontology (GO) - Molecular Function , Phenotypes , Human Phenotype Ontology , Animal Models , miRNA , Transcription Factor Targets and HOMER Transcription for MIR3606 Gene

Localization for MIR3606 Gene

No data available for Subcellular locations from UniProtKB/Swiss-Prot , Subcellular locations from COMPARTMENTS and Gene Ontology (GO) - Cellular Components for MIR3606 Gene

Drugs & Compounds for MIR3606 Gene

No Compound Related Data Available

Transcripts for MIR3606 Gene

mRNA/cDNA for MIR3606 Gene

(1) Ensembl transcripts including schematic representations, and UCSC links where relevant :

Alternative Splicing Database (ASD) splice patterns (SP) for MIR3606 Gene

No ASD Table

Relevant External Links for MIR3606 Gene

GeneLoc Exon Structure for
MIR3606
ECgene alternative splicing isoforms for
MIR3606

Expression for MIR3606 Gene

NURSA nuclear receptor signaling pathways regulating expression of MIR3606 Gene:

MIR3606
No Expression Related Data Available

No data available for mRNA expression in normal human tissues , mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , mRNA differential expression in normal tissues , Protein differential expression in normal tissues , Protein expression , Protein tissue co-expression partners , mRNA Expression by UniProt/SwissProt , Evidence on tissue expression from TISSUES and Phenotype-based relationships between genes and organs from Gene ORGANizer for MIR3606 Gene

Orthologs for MIR3606 Gene

Evolution for MIR3606 Gene

ENSEMBL:
Gene Tree for MIR3606 (if available)
TreeFam:
Gene Tree for MIR3606 (if available)

No data available for Orthologs for MIR3606 Gene

Paralogs for MIR3606 Gene

No data available for Paralogs for MIR3606 Gene

Variants for MIR3606 Gene

Sequence variations from dbSNP and Humsavar for MIR3606 Gene

SNP ID Clin Chr 02 pos Sequence Context AA Info Type
rs1057518075 Pathogenic 188,995,061(+) GGTTC(C/T)GAGGA upstream-variant-2KB, reference, stop-gained
rs121912928 Pathogenic 188,996,171(+) ACCAG(A/G)GCCTC downstream-variant-500B, reference, missense
rs397509370 Pathogenic 188,994,595(+) AACGC(A/G/T)TAAGT upstream-variant-2KB, splice-donor-variant
rs587779430 Pathogenic 188,994,077(+) AAGGC(-/GAAATGGTAAGCTGTCCCCACTCCTCAGC)CTTAT intron-variant, upstream-variant-2KB
rs587779453 Pathogenic 188,994,597(+) CGCGT(A/C)AGTTT intron-variant, upstream-variant-2KB

Structural Variations from Database of Genomic Variants (DGV) for MIR3606 Gene

Variant ID Type Subtype PubMed ID
dgv7234n54 CNV loss 21841781

Relevant External Links for MIR3606 Gene

SNPedia medical, phenotypic, and genealogical associations of SNPs for
MIR3606

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot and Variation tolerance for MIR3606 Gene

Disorders for MIR3606 Gene

MalaCards: The human disease database

(3) MalaCards diseases for MIR3606 Gene - From: GeneCards

Disorder Aliases PubMed IDs
acrogeria, gottron type
  • acrogeria
ehlers-danlos syndrome, type iv
  • ehlers-danlos syndrome, type iv, autosomal dominant
ehlers-danlos syndrome, type iii
  • ehlers-danlos syndrome, hypermobility type
- elite association - COSMIC cancer census association via MalaCards

Relevant External Links for MIR3606

Atlas of Genetics and Cytogenetics in Oncology and Haematology:
MIR3606
genes like me logo Genes that share disorders with MIR3606: view

No data available for UniProtKB/Swiss-Prot and Genatlas for MIR3606 Gene

Publications for MIR3606 Gene

  1. miRBase: integrating microRNA annotation and deep-sequencing data. (PMID: 21037258) Kozomara A. … Griffiths-Jones S. (Nucleic Acids Res. 2011) 3 64
  2. Ultra-high throughput sequencing-based small RNA discovery and discrete statistical biomarker analysis in a collection of cervical tumours and matched controls. (PMID: 20459774) Witten D. … Lui W.O. (BMC Biol. 2010) 3 64
  3. miRBase: microRNA sequences, targets and gene nomenclature. (PMID: 16381832) Griffiths-Jones S. … Enright A.J. (Nucleic Acids Res. 2006) 3 64

Products for MIR3606 Gene

Sources for MIR3606 Gene

Content
Loading form....