Free for academic non-profit institutions. Other users need a Commercial license

Aliases for MIR3165 Gene

Subcategory (RNA class) for MIR3165 Gene


Quality Score for this RNA gene is


Aliases for MIR3165 Gene

  • MicroRNA 3165 2 3 5
  • Hsa-Mir-3165 3
  • Mir-3165 3

External Ids for MIR3165 Gene

Previous GeneCards Identifiers for MIR3165 Gene

  • GC11U901529
  • GC11M071783

Summaries for MIR3165 Gene

Entrez Gene Summary for MIR3165 Gene

  • microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs that are involved in post-transcriptional regulation of gene expression in multicellular organisms by affecting both the stability and translation of mRNAs. miRNAs are transcribed by RNA polymerase II as part of capped and polyadenylated primary transcripts (pri-miRNAs) that can be either protein-coding or non-coding. The primary transcript is cleaved by the Drosha ribonuclease III enzyme to produce an approximately 70-nt stem-loop precursor miRNA (pre-miRNA), which is further cleaved by the cytoplasmic Dicer ribonuclease to generate the mature miRNA and antisense miRNA star (miRNA*) products. The mature miRNA is incorporated into a RNA-induced silencing complex (RISC), which recognizes target mRNAs through imperfect base pairing with the miRNA and most commonly results in translational inhibition or destabilization of the target mRNA. The RefSeq represents the predicted microRNA stem-loop. [provided by RefSeq, Sep 2009]

GeneCards Summary for MIR3165 Gene

MIR3165 (MicroRNA 3165) is an RNA Gene, and is affiliated with the miRNA class.

No data available for UniProtKB/Swiss-Prot , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for MIR3165 Gene

Genomics for MIR3165 Gene

Regulatory Elements for MIR3165 Gene

Enhancers for MIR3165 Gene
GeneHancer Identifier Enhancer Score Enhancer Sources Gene-Enhancer Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor Binding Sites within enhancer Gene Targets for Enhancer
GH11F072068 1.2 FANTOM5 ENCODE 0.8 +2.3 2255 2.5 TBP KLF17 RAD21 RFX5 YY1 ZNF121 ZNF366 RCOR1 FOS EGR2 FAM86C1 IL18BP LRTOMT MIR3165 GC11M072049
GH11F072075 1.1 Ensembl ENCODE 0.8 -3.1 -3140 0.7 HDGF PKNOX1 ZNF76 KLF17 RAD21 YY1 ZNF335 GLIS2 ZNF143 KLF7 ENSG00000248671 ALG1L9P LRTOMT MIR3165
GH11F072071 0.8 ENCODE 0.8 -0.4 -441 2.2 JUN KLF17 ZNF384 ZNF664 ZNF316 GATA3 ZFHX2 FOS NFE2 TCF7L2 FAM86C1 MIR3165 LRTOMT
GH11F072074 0.4 Ensembl 0.8 -2.6 -2599 0.2 WT1 OR7E128P FAM86C1 MIR3165 LRTOMT
GH11F072077 0.8 Ensembl 0.4 -5.1 -5099 0.8 BCOR SREBF2 SIN3A CEBPG DMAP1 ZNF121 ZNF335 GLIS2 PATZ1 FOS FAM86C1 LRTOMT MIR3165
- Elite enhancer and/or Elite enhancer-gene association Download GeneHancer data dump

Enhancers around MIR3165 on UCSC Golden Path with GeneCards custom track

Genomic Location for MIR3165 Gene

72,072,228 bp from pter
72,072,302 bp from pter
75 bases
Minus strand

Genomic View for MIR3165 Gene

Genes around MIR3165 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
MIR3165 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for MIR3165 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for MIR3165 Gene

ORGUL Member Location for MIR3165 Gene

ORGUL Member Location for MIR3165 gene

Proteins for MIR3165 Gene

Post-translational modifications for MIR3165 Gene

No Post-translational modifications

No data available for DME Specific Peptides for MIR3165 Gene

Domains & Families for MIR3165 Gene

Gene Families for MIR3165 Gene

Graphical View of Domain Structure for InterPro Entry

genes like me logo Genes that share domains with MIR3165: view

No data available for Protein Domains , Suggested Antigen Peptide Sequences and UniProtKB/Swiss-Prot for MIR3165 Gene

Function for MIR3165 Gene

Animal Model Products

miRNA Products

Clone Products

Flow Cytometry Products

No data available for Molecular function , Enzyme Numbers (IUBMB) , Gene Ontology (GO) - Molecular Function , Phenotypes , Human Phenotype Ontology , Animal Models , miRNA , Transcription Factor Targets and HOMER Transcription for MIR3165 Gene

Localization for MIR3165 Gene

No data available for Subcellular locations from UniProtKB/Swiss-Prot , Subcellular locations from COMPARTMENTS and Gene Ontology (GO) - Cellular Components for MIR3165 Gene

Pathways & Interactions for MIR3165 Gene

SuperPathways for MIR3165 Gene

No Data Available

Interacting Proteins for MIR3165 Gene

Gene Ontology (GO) - Biological Process for MIR3165 Gene


No data available for Pathways by source and SIGNOR curated interactions for MIR3165 Gene

Transcripts for MIR3165 Gene

mRNA/cDNA for MIR3165 Gene

(1) Ensembl transcripts including schematic representations, and UCSC links where relevant :

miRNA Products

Clone Products

Flow Cytometry Products

Alternative Splicing Database (ASD) splice patterns (SP) for MIR3165 Gene

No ASD Table

Relevant External Links for MIR3165 Gene

GeneLoc Exon Structure for
ECgene alternative splicing isoforms for

Expression for MIR3165 Gene

NURSA nuclear receptor signaling pathways regulating expression of MIR3165 Gene:

No Expression Related Data Available

No data available for mRNA expression in normal human tissues , mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , mRNA differential expression in normal tissues , Protein differential expression in normal tissues , Protein expression , Protein tissue co-expression partners and mRNA Expression by UniProt/SwissProt for MIR3165 Gene

Orthologs for MIR3165 Gene

Evolution for MIR3165 Gene

Gene Tree for MIR3165 (if available)
Gene Tree for MIR3165 (if available)

No data available for Orthologs for MIR3165 Gene

Paralogs for MIR3165 Gene

No data available for Paralogs for MIR3165 Gene

Variants for MIR3165 Gene

Sequence variations from dbSNP and Humsavar for MIR3165 Gene

SNP ID Clin Chr 11 pos Sequence Context AA Info Type
rs11235432 -- 72,072,896(+) AATTA(C/G)CTGGG intron-variant, upstream-variant-2KB
rs113251317 -- 72,073,966(+) GCAGG(C/T)GGATC intron-variant, upstream-variant-2KB
rs11606798 -- 72,073,325(+) aaaaa(C/G)TTGCC intron-variant, upstream-variant-2KB
rs116203303 -- 72,073,680(+) GAAGT(C/T)ACAGG intron-variant, upstream-variant-2KB
rs141971998 -- 72,074,194(+) ATCTC(-/AAAACAAAAACAAAGACAAA)AAAAA intron-variant, upstream-variant-2KB

Structural Variations from Database of Genomic Variants (DGV) for MIR3165 Gene

Variant ID Type Subtype PubMed ID
nsv428262 CNV gain+loss 18775914

Relevant External Links for MIR3165 Gene

SNPedia medical, phenotypic, and genealogical associations of SNPs for

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot and Variation tolerance for MIR3165 Gene

Disorders for MIR3165 Gene

Relevant External Links for MIR3165

Atlas of Genetics and Cytogenetics in Oncology and Haematology:

No disorders were found for MIR3165 Gene.

No data available for MalaCards , UniProtKB/Swiss-Prot and Genatlas for MIR3165 Gene

Publications for MIR3165 Gene

  1. miRBase: integrating microRNA annotation and deep-sequencing data. (PMID: 21037258) Kozomara A. … Griffiths-Jones S. (Nucleic Acids Res. 2011) 3 64
  2. Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene. (PMID: 21199797) Persson H. … Rovira C. (Cancer Res. 2011) 3 64
  3. Characterization of the Melanoma miRNAome by Deep Sequencing. (PMID: 20300190) Stark M.S. … Hayward N.K. (PLoS ONE 2010) 3 64
  4. miRBase: microRNA sequences, targets and gene nomenclature. (PMID: 16381832) Griffiths-Jones S. … Enright A.J. (Nucleic Acids Res. 2006) 3 64

Products for MIR3165 Gene

Sources for MIR3165 Gene

Loading form....