Free for academic non-profit institutions. Other users need a Commercial license

Aliases for MIR202 Gene

Subcategory (RNA class) for MIR202 Gene


Quality Score for this RNA gene is


Aliases for MIR202 Gene

  • MicroRNA 202 2 3
  • Hsa-Mir-202 3
  • MIRN202 3

External Ids for MIR202 Gene

Previous HGNC Symbols for MIR202 Gene

  • MIRN202

Previous GeneCards Identifiers for MIR202 Gene

  • GC10M134912
  • GC10M135061

Summaries for MIR202 Gene

Entrez Gene Summary for MIR202 Gene

  • microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs that are involved in post-transcriptional regulation of gene expression in multicellular organisms by affecting both the stability and translation of mRNAs. miRNAs are transcribed by RNA polymerase II as part of capped and polyadenylated primary transcripts (pri-miRNAs) that can be either protein-coding or non-coding. The primary transcript is cleaved by the Drosha ribonuclease III enzyme to produce an approximately 70-nt stem-loop precursor miRNA (pre-miRNA), which is further cleaved by the cytoplasmic Dicer ribonuclease to generate the mature miRNA and antisense miRNA star (miRNA*) products. The mature miRNA is incorporated into a RNA-induced silencing complex (RISC), which recognizes target mRNAs through imperfect base pairing with the miRNA and most commonly results in translational inhibition or destabilization of the target mRNA. The RefSeq represents the predicted microRNA stem-loop. [provided by RefSeq, Sep 2009]

GeneCards Summary for MIR202 Gene

MIR202 (MicroRNA 202) is an RNA Gene, and is affiliated with the miRNA class.

fRNAdb sequence ontologies for MIR202 Gene

  • pre_miRNA: The 60-70 nucleotide region remain after Drosha processing of the primary transcript, that folds back upon itself to form a hairpin sructure.

View fRNAdb secondary structures for MIR202

No data available for UniProtKB/Swiss-Prot , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary and piRNA Summary for MIR202 Gene

Genomics for MIR202 Gene

Genomic Location for MIR202 Gene

133,247,511 bp from pter
133,247,620 bp from pter
110 bases
Minus strand

Genomic View for MIR202 Gene

UCSC Golden Path with GeneCards custom track
Cytogenetic band:
Genomic Location for MIR202 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for MIR202 Gene

ORGUL Member Location for MIR202 Gene

ORGUL Member Location for MIR202 gene

No data available for Regulatory Elements for MIR202 Gene

Proteins for MIR202 Gene

Post-translational modifications for MIR202 Gene

No Post-translational modifications

No data available for DME Specific Peptides for MIR202 Gene

Domains for MIR202 Gene

Gene Families for MIR202 Gene

Graphical View of Domain Structure for InterPro Entry

genes like me logo Genes that share domains with MIR202: view

No data available for Protein Domains , Suggested Antigen Peptide Sequences and UniProtKB/Swiss-Prot for MIR202 Gene

Function for MIR202 Gene

No data available for Molecular function , Enzyme Numbers (IUBMB) , Gene Ontology (GO) - Molecular Function , Phenotypes , Animal Models , miRNA , Transcription Factor Targeting and HOMER Transcription for MIR202 Gene

Localization for MIR202 Gene

No data available for Subcellular locations from UniProtKB/Swiss-Prot , Subcellular locations from COMPARTMENTS and Gene Ontology (GO) - Cellular Components for MIR202 Gene

Pathways for MIR202 Gene

SuperPathways for MIR202 Gene

No Data Available

Interacting Proteins for MIR202 Gene

Gene Ontology (GO) - Biological Process for MIR202 Gene


No data available for Pathways by source for MIR202 Gene

Transcripts for MIR202 Gene

fRNAdb Secondary structures for MIR202 Gene

  • hsa-miR-202-3p_MIMAT0002811_Homo_sapiens_miR-202-3p_mature

mRNA/cDNA for MIR202 Gene

(2) Ensembl transcripts including schematic representations, and UCSC links where relevant :

Alternative Splicing Database (ASD) splice patterns (SP) for MIR202 Gene

No ASD Table

Relevant External Links for MIR202 Gene

GeneLoc Exon Structure for
ECgene alternative splicing isoforms for

Expression for MIR202 Gene

mRNA differential expression in normal tissues according to GTEx for MIR202 Gene

This gene is overexpressed in Testis (29.0), Adrenal Gland (16.8), and Ovary (6.6).

Primer Products

In Situ Assay Products

No data available for mRNA expression in normal human tissues , mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , Protein differential expression in normal tissues , Protein expression , mRNA Expression by UniProt/SwissProt and Expression partners for MIR202 Gene

Orthologs for MIR202 Gene

Evolution for MIR202 Gene

Gene Tree for MIR202 (if available)
Gene Tree for MIR202 (if available)

No data available for Orthologs for MIR202 Gene

Paralogs for MIR202 Gene

No data available for Paralogs for MIR202 Gene

Variants for MIR202 Gene

Sequence variations from dbSNP and Humsavar for MIR202 Gene

SNP ID Clin Chr 10 pos Sequence Context AA Info Type MAF
rs557838536 -- 133,247,872(+) TCTCT(-/GAGCCGGGAGTTCTGCTGCTGCCGAGC)GAGCT upstream-variant-2KB

Structural Variations from Database of Genomic Variants (DGV) for MIR202 Gene

Variant ID Type Subtype PubMed ID
nsv896182 CNV Loss 21882294
dgv856n71 CNV Loss 21882294
nsv528260 CNV Loss 19592680
dgv327e1 CNV Complex 17122850
dgv328e1 CNV Complex 17122850
nsv896258 CNV Loss 21882294
nsv832036 CNV Loss 17160897
nsv832038 CNV Gain+Loss 17160897
dgv878n71 CNV Loss 21882294
dgv879n71 CNV Loss 21882294
dgv880n71 CNV Loss 21882294
nsv832039 CNV Loss 17160897
nsv470980 CNV Loss 18288195
dgv2e196 CNV Duplication 17116639
dgv882n71 CNV Loss 21882294
essv9566 CNV CNV 17122850
nsv8750 CNV Gain+Loss 18304495
dgv883n71 CNV Loss 21882294
dgv884n71 CNV Loss 21882294
dgv885n71 CNV Loss 21882294
nsv516968 CNV Loss 19592680
dgv886n71 CNV Gain 21882294
nsv896301 CNV Gain 21882294
dgv887n71 CNV Gain 21882294
essv20368 CNV CNV 17122850
nsv428243 CNV Gain 18775914
nsv509381 CNV Insertion 20534489
dgv888n71 CNV Loss 21882294

Relevant External Links for MIR202 Gene

HapMap Linkage Disequilibrium report

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for MIR202 Gene

Disorders for MIR202 Gene

Relevant External Links for MIR202

Human Genome Epidemiology (HuGE) Navigator

No disorders were found for MIR202 Gene.

No data available for MalaCards , OMIM , UniProtKB/Swiss-Prot , University of Copenhagen DISEASES , Novoseek inferred disease relationships and Genatlas for MIR202 Gene

Publications for MIR202 Gene

  1. Identification of hundreds of conserved and nonconserved human microRNAs. (PMID: 15965474) Bentwich I. … Bentwich Z. (Nat. Genet. 2005) 3
  2. miRBase: microRNA sequences, targets and gene nomenclature. (PMID: 16381832) Griffiths-Jones S. … Enright A.J. (Nucleic Acids Res. 2006) 3
  3. A mammalian microRNA expression atlas based on small RNA library sequencing. (PMID: 17604727) Landgraf P. … Tuschl T. (Cell 2007) 3
  4. Genetic polymorphisms in the precursor MicroRNA flanking region and non-small cell lung cancer survival. (PMID: 20889907) Hu Z. … Shen H. (Am. J. Respir. Crit. Care Med. 2011) 3
  5. Targetome profiling, pathway analysis and genetic association study implicate miR-202 in lymphomagenesis. (PMID: 23334589) Hoffman A.E. … Zhu Y. (Cancer Epidemiol. Biomarkers Prev. 2013) 3

Products for MIR202 Gene

Sources for MIR202 Gene

Back to Top