Free for academic non-profit institutions. Other users need a Commercial license

Aliases for MIR138-1 Gene

Subcategory (RNA class) for MIR138-1 Gene


Quality Score for this RNA gene is


Aliases for MIR138-1 Gene

  • MicroRNA 138-1 2 3 5
  • Hsa-Mir-138-1 3
  • Mir-138-1 3
  • MIRN138-1 3

External Ids for MIR138-1 Gene

ORGUL Members for MIR138-1 Gene

Previous HGNC Symbols for MIR138-1 Gene

  • MIRN138-1

Previous GeneCards Identifiers for MIR138-1 Gene

  • GC03P044133

Summaries for MIR138-1 Gene

Entrez Gene Summary for MIR138-1 Gene

  • microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs that are involved in post-transcriptional regulation of gene expression in multicellular organisms by affecting both the stability and translation of mRNAs. miRNAs are transcribed by RNA polymerase II as part of capped and polyadenylated primary transcripts (pri-miRNAs) that can be either protein-coding or non-coding. The primary transcript is cleaved by the Drosha ribonuclease III enzyme to produce an approximately 70-nt stem-loop precursor miRNA (pre-miRNA), which is further cleaved by the cytoplasmic Dicer ribonuclease to generate the mature miRNA and antisense miRNA star (miRNA*) products. The mature miRNA is incorporated into a RNA-induced silencing complex (RISC), which recognizes target mRNAs through imperfect base pairing with the miRNA and most commonly results in translational inhibition or destabilization of the target mRNA. The RefSeq represents the predicted microRNA stem-loop. [provided by RefSeq, Sep 2009]

GeneCards Summary for MIR138-1 Gene

MIR138-1 (MicroRNA 138-1) is an RNA Gene, and is affiliated with the miRNA class. Among its related pathways are Respiratory electron transport, ATP synthesis by chemiosmotic coupling, and heat production by uncoupling proteins..

No data available for UniProtKB/Swiss-Prot , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for MIR138-1 Gene

Genomics for MIR138-1 Gene

Regulatory Elements for MIR138-1 Gene

Enhancers for MIR138-1 Gene
GeneHancer Identifier Enhancer Score Enhancer Sources Gene-Enhancer Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor Binding Sites within enhancer Gene Targets for Enhancer
GH03F043997 1 FANTOM5 ENCODE 11.4 -115.3 -115345 2.3 SIN3A ZNF2 GLIS2 EGR1 ZNF207 EGR2 SP3 USF2 ZEB2 SREBF1 MIR138-1 RNU6-367P ENSG00000261786 ENSG00000271192 ENSG00000272121
GH03F043998 1 FANTOM5 ENCODE 11.4 -117.3 -117272 0.7 HDGF CTCF SUZ12 SIN3A EBF1 ZIC2 RAD21 ZNF2 HIC1 GLIS2 MIR138-1 ENSG00000261786 ENSG00000271192 ENSG00000272121
GH03F043996 0.2 ENCODE 11.4 -117.8 -117759 0.2 HDGF CTCF SUZ12 WRNIP1 SIN3A EBF1 ZIC2 ZNF2 RAD21 HIC1 MIR138-1 ENSG00000261786 ENSG00000271192 GC03M043165
GH03F043999 0.8 ENCODE 11.4 -118.0 -117999 0.2 CTCF RNF2 SUZ12 WRNIP1 TRIM22 SIN3A ZNF501 PATZ1 ZNF341 PRDM10 MIR138-1 ENSG00000271192 GC03M043165
GH03F043995 1 FANTOM5 11.4 -119.0 -119009 0.2 CTCF KLF1 USF1 SUZ12 SIN3A ZIC2 ZEB1 ZFHX2 GLIS2 POLR2A MIR138-1 ENSG00000271192 GC03M043165
- Elite enhancer/Elite enhancer-gene association Download Table
Download GeneHancer data dump

Enhancers around MIR138-1 on UCSC Golden Path with GeneCards custom track

Genomic Location for MIR138-1 Gene

44,114,212 bp from pter
44,114,310 bp from pter
99 bases
Plus strand

Genomic View for MIR138-1 Gene

Genes around MIR138-1 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
MIR138-1 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for MIR138-1 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for MIR138-1 Gene

Proteins for MIR138-1 Gene

Post-translational modifications for MIR138-1 Gene

No Post-translational modifications

No data available for DME Specific Peptides for MIR138-1 Gene

Domains & Families for MIR138-1 Gene

Gene Families for MIR138-1 Gene

Graphical View of Domain Structure for InterPro Entry

genes like me logo Genes that share domains with MIR138-1: view

No data available for Protein Domains , Suggested Antigen Peptide Sequences and UniProtKB/Swiss-Prot for MIR138-1 Gene

Function for MIR138-1 Gene

Animal Model Products

miRNA Products

Clone Products

Flow Cytometry Products

No data available for Molecular function , Enzyme Numbers (IUBMB) , Gene Ontology (GO) - Molecular Function , Phenotypes , Human Phenotype Ontology , Animal Models , miRNA , Transcription Factor Targets and HOMER Transcription for MIR138-1 Gene

Localization for MIR138-1 Gene

No data available for Subcellular locations from UniProtKB/Swiss-Prot , Subcellular locations from COMPARTMENTS and Gene Ontology (GO) - Cellular Components for MIR138-1 Gene

Pathways & Interactions for MIR138-1 Gene

genes like me logo Genes that share pathways with MIR138-1: view

Pathways by source for MIR138-1 Gene

1 BioSystems pathway for MIR138-1 Gene

Interacting Proteins for MIR138-1 Gene

Gene Ontology (GO) - Biological Process for MIR138-1 Gene


No data available for SIGNOR curated interactions for MIR138-1 Gene

Transcripts for MIR138-1 Gene

mRNA/cDNA for MIR138-1 Gene

(1) Ensembl transcripts including schematic representations, and UCSC links where relevant :

miRNA Products

Clone Products

Flow Cytometry Products

Alternative Splicing Database (ASD) splice patterns (SP) for MIR138-1 Gene

No ASD Table

Relevant External Links for MIR138-1 Gene

GeneLoc Exon Structure for
ECgene alternative splicing isoforms for

Expression for MIR138-1 Gene

mRNA expression in normal human tissues for MIR138-1 Gene

genes like me logo Genes that share expression patterns with MIR138-1: view

No data available for mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , mRNA differential expression in normal tissues , Protein differential expression in normal tissues , Protein expression , Protein tissue co-expression partners and mRNA Expression by UniProt/SwissProt for MIR138-1 Gene

Orthologs for MIR138-1 Gene

This gene was present in the common ancestor of chordates.

Orthologs for MIR138-1 Gene

Organism Taxonomy Gene Similarity Type Details
(Canis familiaris)
Mammalia cfa-mir-138a 35
  • 98 (a)
(Bos Taurus)
Mammalia bta-mir-138-1 35
  • 93 (a)
(Mus musculus)
Mammalia Mir138-1 35
  • 92 (a)
(Monodelphis domestica)
Mammalia -- 35
  • 82 (a)
(Ornithorhynchus anatinus)
Mammalia oan-mir-138-1 35
  • 42 (a)
(Gallus gallus)
Aves gga-mir-138-1 35
  • 81 (a)
(Anolis carolinensis)
Reptilia aca-mir-138-2 35
  • 84 (a)
(Danio rerio)
Actinopterygii CABZ01061343.1 35
  • 74 (a)
Species where no ortholog for MIR138-1 was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • chimpanzee (Pan troglodytes)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • fruit fly (Drosophila melanogaster)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rat (Rattus norvegicus)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea squirt (Ciona intestinalis)
  • sea squirt (Ciona savignyi)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • tropical clawed frog (Silurana tropicalis)
  • wheat (Triticum aestivum)
  • worm (Caenorhabditis elegans)

Evolution for MIR138-1 Gene

Gene Tree for MIR138-1 (if available)
Gene Tree for MIR138-1 (if available)

Paralogs for MIR138-1 Gene

No data available for Paralogs for MIR138-1 Gene

Variants for MIR138-1 Gene

Sequence variations from dbSNP and Humsavar for MIR138-1 Gene

SNP ID Clin Chr 03 pos Sequence Context AA Info Type
rs115784370 -- 44,114,717(+) GAAGG(G/T)AGGAC downstream-variant-500B
rs138283924 -- 44,114,521(+) GTAAC(A/G)TTAGC downstream-variant-500B
rs140870896 -- 44,114,159(+) CCTCC(A/G)GCAGC upstream-variant-2KB
rs142319973 -- 44,114,661(+) TGGGA(C/T)CTTTG downstream-variant-500B
rs143205667 -- 44,114,683(+) GTGAT(-/GGTAGCTTTGAATAGGGCAAAGTAGAGGGAA)GGTAG downstream-variant-500B

Structural Variations from Database of Genomic Variants (DGV) for MIR138-1 Gene

Variant ID Type Subtype PubMed ID
nsv834674 CNV gain 17160897

Relevant External Links for MIR138-1 Gene

SNPedia medical, phenotypic, and genealogical associations of SNPs for

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot and Variation tolerance for MIR138-1 Gene

Disorders for MIR138-1 Gene

Relevant External Links for MIR138-1

Atlas of Genetics and Cytogenetics in Oncology and Haematology:

No disorders were found for MIR138-1 Gene.

No data available for MalaCards , UniProtKB/Swiss-Prot and Genatlas for MIR138-1 Gene

Publications for MIR138-1 Gene

  1. Derepression of MicroRNA-138 Contributes to Loss of the Human Articular Chondrocyte Phenotype. (PMID: 26359943) Seidl C.I. … Murphy C.L. ( 2016) 3 64
  2. MicroRNAs regulate KDM5 histone demethylases in breast cancer cells. (PMID: 26621457) Denis H. … Deplus R. (Mol Biosyst 2016) 3 64
  3. MicroRNA-138 functions as a tumor suppressor in osteosarcoma by targeting differentiated embryonic chondrocyte gene 2. (PMID: 27095063) Jiang B. … Tian H. (J. Exp. Clin. Cancer Res. 2016) 3 64
  4. MicroRNA-138 inhibits proliferation of cervical cancer cells by targeting c-Met. (PMID: 27049264) Li B. … Ji H.K. (Eur Rev Med Pharmacol Sci 2016) 3 64
  5. MiR-138 Acts as a Tumor Suppressor by Targeting EZH2 and Enhances Cisplatin-Induced Apoptosis in Osteosarcoma Cells. (PMID: 27019355) Zhu Z. … Zhou X. (PLoS ONE 2016) 3 64

Products for MIR138-1 Gene

Sources for MIR138-1 Gene

Loading form....