Free for academic non-profit institutions. Other users need a Commercial license

Aliases for MIR1283-1 Gene

Subcategory (RNA class) for MIR1283-1 Gene


Quality Score for this RNA gene is


Aliases for MIR1283-1 Gene

  • MicroRNA 1283-1 2 3
  • Hsa-Mir-1283-1 3
  • Mir-1283-1 3
  • MIRN1283-1 3

External Ids for MIR1283-1 Gene

Previous HGNC Symbols for MIR1283-1 Gene

  • MIRN1283-1

Previous GeneCards Identifiers for MIR1283-1 Gene

  • GC00U923158
  • GC19P058887
  • GC19P054191

Summaries for MIR1283-1 Gene

Entrez Gene Summary for MIR1283-1 Gene

  • microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs that are involved in post-transcriptional regulation of gene expression in multicellular organisms by affecting both the stability and translation of mRNAs. miRNAs are transcribed by RNA polymerase II as part of capped and polyadenylated primary transcripts (pri-miRNAs) that can be either protein-coding or non-coding. The primary transcript is cleaved by the Drosha ribonuclease III enzyme to produce an approximately 70-nt stem-loop precursor miRNA (pre-miRNA), which is further cleaved by the cytoplasmic Dicer ribonuclease to generate the mature miRNA and antisense miRNA star (miRNA*) products. The mature miRNA is incorporated into a RNA-induced silencing complex (RISC), which recognizes target mRNAs through imperfect base pairing with the miRNA and most commonly results in translational inhibition or destabilization of the target mRNA. The RefSeq represents the predicted microRNA stem-loop. [provided by RefSeq, Sep 2009]

GeneCards Summary for MIR1283-1 Gene

MIR1283-1 (MicroRNA 1283-1) is an RNA Gene, and is affiliated with the miRNA class.

No data available for UniProtKB/Swiss-Prot , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for MIR1283-1 Gene

Genomics for MIR1283-1 Gene

Genomic Location for MIR1283-1 Gene

53,688,481 bp from pter
53,688,567 bp from pter
87 bases
Plus strand

Genomic View for MIR1283-1 Gene

UCSC Golden Path with GeneCards custom track
Cytogenetic band:
Genomic Location for MIR1283-1 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for MIR1283-1 Gene

No data available for Regulatory Elements for MIR1283-1 Gene

Proteins for MIR1283-1 Gene

Post-translational modifications for MIR1283-1 Gene

No Post-translational modifications

No data available for DME Specific Peptides for MIR1283-1 Gene

Domains & Families for MIR1283-1 Gene

Gene Families for MIR1283-1 Gene

Graphical View of Domain Structure for InterPro Entry

genes like me logo Genes that share domains with MIR1283-1: view

No data available for Protein Domains , Suggested Antigen Peptide Sequences and UniProtKB/Swiss-Prot for MIR1283-1 Gene

Function for MIR1283-1 Gene

No data available for Molecular function , Enzyme Numbers (IUBMB) , Gene Ontology (GO) - Molecular Function , Phenotypes , Animal Models , miRNA , Transcription Factor Targets and HOMER Transcription for MIR1283-1 Gene

Localization for MIR1283-1 Gene

No data available for Subcellular locations from UniProtKB/Swiss-Prot , Subcellular locations from COMPARTMENTS and Gene Ontology (GO) - Cellular Components for MIR1283-1 Gene

Pathways & Interactions for MIR1283-1 Gene

SuperPathways for MIR1283-1 Gene

No Data Available

Interacting Proteins for MIR1283-1 Gene

Gene Ontology (GO) - Biological Process for MIR1283-1 Gene


No data available for Pathways by source and SIGNOR curated interactions for MIR1283-1 Gene

Drugs & Compounds for MIR1283-1 Gene

No Compound Related Data Available

Transcripts for MIR1283-1 Gene

mRNA/cDNA for MIR1283-1 Gene

(2) Ensembl transcripts including schematic representations, and UCSC links where relevant :

Alternative Splicing Database (ASD) splice patterns (SP) for MIR1283-1 Gene

No ASD Table

Relevant External Links for MIR1283-1 Gene

GeneLoc Exon Structure for
ECgene alternative splicing isoforms for

Expression for MIR1283-1 Gene

mRNA expression in normal human tissues for MIR1283-1 Gene

genes like me logo Genes that share expression patterns with MIR1283-1: view

Primer Products

In Situ Assay Products

No data available for mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , mRNA differential expression in normal tissues , Protein differential expression in normal tissues , Protein expression , mRNA Expression by UniProt/SwissProt and Protein tissue co-expression partners for MIR1283-1 Gene

Orthologs for MIR1283-1 Gene

This gene was present in the common ancestor of human and chimp.

Orthologs for MIR1283-1 Gene

Organism Taxonomy Gene Similarity Type Details
(Pan troglodytes)
Mammalia ptr-mir-1283 36
  • 94 (a)
Species with no ortholog for MIR1283-1:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • chicken (Gallus gallus)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • cow (Bos Taurus)
  • dog (Canis familiaris)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • fruit fly (Drosophila melanogaster)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • lizard (Anolis carolinensis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • mouse (Mus musculus)
  • oppossum (Monodelphis domestica)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • platypus (Ornithorhynchus anatinus)
  • rainbow trout (Oncorhynchus mykiss)
  • rat (Rattus norvegicus)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea squirt (Ciona intestinalis)
  • sea squirt (Ciona savignyi)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • tropical clawed frog (Silurana tropicalis)
  • wheat (Triticum aestivum)
  • worm (Caenorhabditis elegans)
  • zebrafish (Danio rerio)

Evolution for MIR1283-1 Gene

Gene Tree for MIR1283-1 (if available)
Gene Tree for MIR1283-1 (if available)

Paralogs for MIR1283-1 Gene

No data available for Paralogs for MIR1283-1 Gene

Variants for MIR1283-1 Gene

Sequence variations from dbSNP and Humsavar for MIR1283-1 Gene

SNP ID Clin Chr 19 pos Sequence Context AA Info Type MAF
rs1988088 -- 53,688,615(-) AAGCA(C/G/T)GCTCT downstream-variant-500B
rs7249017 -- 53,688,114(+) AGATC(A/C/T)CATTT upstream-variant-2KB
rs7249114 -- 53,688,113(+) TAGAT(C/T)ACATT upstream-variant-2KB
rs11274495 -- 53,688,263(+) TTCTG(-/TTTGAGAACAAAACTCGGGAG)GATTG upstream-variant-2KB
rs12977118 -- 53,687,570(+) AAAAa(A/T)atata upstream-variant-2KB

Structural Variations from Database of Genomic Variants (DGV) for MIR1283-1 Gene

Variant ID Type Subtype PubMed ID
esv2718812 CNV Deletion 23290073
nsv912385 CNV Gain 21882294
dgv3999n71 CNV Gain 21882294
nsv458781 CNV Gain 19166990
esv2718833 CNV Deletion 23290073

Relevant External Links for MIR1283-1 Gene

HapMap Linkage Disequilibrium report

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot and Variation tolerance for MIR1283-1 Gene

Disorders for MIR1283-1 Gene

Relevant External Links for MIR1283-1

Atlas of Genetics and Cytogenetics in Oncology and Haematology:
genes like me logo Genes that share disorders with MIR1283-1: view

No data available for MalaCards , UniProtKB/Swiss-Prot and Genatlas for MIR1283-1 Gene

Publications for MIR1283-1 Gene

  1. The human ATF1 rs11169571 polymorphism increases essential hypertension risk through modifying miRNA binding. (PMID: 26149214) Yang S. … Yang P. (FEBS Lett. 2015) 67
  2. miRBase: integrating microRNA annotation and deep-sequencing data. (PMID: 21037258) Kozomara A. … Griffiths-Jones S. (Nucleic Acids Res. 2011) 67
  3. Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells. (PMID: 18285502) Morin R.D. … Marra M.A. (Genome Res. 2008) 67
  4. miRBase: microRNA sequences, targets and gene nomenclature. (PMID: 16381832) Griffiths-Jones S. … Enright A.J. (Nucleic Acids Res. 2006) 67
  5. Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis. (PMID: 16954537) Berezikov E. … Cuppen E. (Genome Res. 2006) 67

Products for MIR1283-1 Gene

Sources for MIR1283-1 Gene

Back to Top
