Free for academic non-profit institutions. Other users need a Commercial license

Aliases for MIR1283-1 Gene

Subcategory (RNA class) for MIR1283-1 Gene

miRNA

Quality Score for this RNA gene is

3

Aliases for MIR1283-1 Gene

  • MicroRNA 1283-1 2 3
  • Hsa-Mir-1283-1 3
  • MIRN1283-1 3

External Ids for MIR1283-1 Gene

Previous HGNC Symbols for MIR1283-1 Gene

  • MIRN1283-1

Previous GeneCards Identifiers for MIR1283-1 Gene

  • GC00U923158
  • GC19P058887
  • GC19P054191

Summaries for MIR1283-1 Gene

Entrez Gene Summary for MIR1283-1 Gene

  • microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs that are involved in post-transcriptional regulation of gene expression in multicellular organisms by affecting both the stability and translation of mRNAs. miRNAs are transcribed by RNA polymerase II as part of capped and polyadenylated primary transcripts (pri-miRNAs) that can be either protein-coding or non-coding. The primary transcript is cleaved by the Drosha ribonuclease III enzyme to produce an approximately 70-nt stem-loop precursor miRNA (pre-miRNA), which is further cleaved by the cytoplasmic Dicer ribonuclease to generate the mature miRNA and antisense miRNA star (miRNA*) products. The mature miRNA is incorporated into a RNA-induced silencing complex (RISC), which recognizes target mRNAs through imperfect base pairing with the miRNA and most commonly results in translational inhibition or destabilization of the target mRNA. The RefSeq represents the predicted microRNA stem-loop. [provided by RefSeq, Sep 2009]

GeneCards Summary for MIR1283-1 Gene

MIR1283-1 (MicroRNA 1283-1) is an RNA Gene, and is affiliated with the miRNA class.

No data available for UniProtKB/Swiss-Prot , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for MIR1283-1 Gene

Genomics for MIR1283-1 Gene

Genomic Location for MIR1283-1 Gene

Start:
53,688,481 bp from pter
End:
53,688,567 bp from pter
Size:
87 bases
Orientation:
Plus strand

Genomic View for MIR1283-1 Gene

UCSC Golden Path with GeneCards custom track
Cytogenetic band:
Genomic Location for MIR1283-1 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for MIR1283-1 Gene

No data available for Regulatory Elements for MIR1283-1 Gene

Proteins for MIR1283-1 Gene

Post-translational modifications for MIR1283-1 Gene

No Post-translational modifications

No data available for DME Specific Peptides for MIR1283-1 Gene

Domains for MIR1283-1 Gene

Gene Families for MIR1283-1 Gene

HGNC:
  • MIR :ncRNAs / Micro RNAs

Graphical View of Domain Structure for InterPro Entry

genes like me logo Genes that share domains with MIR1283-1: view

No data available for Protein Domains , Suggested Antigen Peptide Sequences and UniProtKB/Swiss-Prot for MIR1283-1 Gene

Function for MIR1283-1 Gene

Animal Model Products

No data available for Molecular function , Enzyme Numbers (IUBMB) , Gene Ontology (GO) - Molecular Function , Phenotypes , Animal Models , miRNA , Transcription Factor Targeting and HOMER Transcription for MIR1283-1 Gene

Localization for MIR1283-1 Gene

No data available for Subcellular locations from UniProtKB/Swiss-Prot , Subcellular locations from COMPARTMENTS and Gene Ontology (GO) - Cellular Components for MIR1283-1 Gene

Pathways for MIR1283-1 Gene

SuperPathways for MIR1283-1 Gene

No Data Available

Interacting Proteins for MIR1283-1 Gene

Gene Ontology (GO) - Biological Process for MIR1283-1 Gene

None

No data available for Pathways by source for MIR1283-1 Gene

Transcripts for MIR1283-1 Gene

mRNA/cDNA for MIR1283-1 Gene

(2) Ensembl transcripts including schematic representations, and UCSC links where relevant :

miRNA Products

  • QIAGEN qRT-PCR Assays for microRNAs that regulate MIR1283-1
    • Block miRNA regulation of MIR1283-1 using miScript Target Protectors

    Inhibitory RNA Products

    • Predesigned siRNA for gene silencing in human,mouse,rat for MIR1283-1

    Primer Products

    Flow Cytometry Products

    Alternative Splicing Database (ASD) splice patterns (SP) for MIR1283-1 Gene

    No ASD Table

    Relevant External Links for MIR1283-1 Gene

    GeneLoc Exon Structure for
    MIR1283-1
    ECgene alternative splicing isoforms for
    MIR1283-1

    Expression for MIR1283-1 Gene

    mRNA expression in normal human tissues for MIR1283-1 Gene

    genes like me logo Genes that share expressions with MIR1283-1: view

    In Situ Assay Products

    No data available for mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , mRNA differential expression in normal tissues , Protein expression and mRNA Expression by UniProt/SwissProt for MIR1283-1 Gene

    Orthologs for MIR1283-1 Gene

    This gene was present in the common ancestor of human and chimp.

    Orthologs for MIR1283-1 Gene

    Organism Taxonomy Gene Similarity Type Details
    chimpanzee
    (Pan troglodytes)
    Mammalia ptr-mir-1283 36
    • 94 (a)
    OneToOne
    Species with no ortholog for MIR1283-1:
    • A. gosspyii yeast (Ashbya gossypii)
    • Actinobacteria (Mycobacterium tuberculosis)
    • African clawed frog (Xenopus laevis)
    • African malaria mosquito (Anopheles gambiae)
    • Alicante grape (Vitis vinifera)
    • alpha proteobacteria (Wolbachia pipientis)
    • amoeba (Dictyostelium discoideum)
    • Archea (Pyrococcus horikoshii)
    • baker's yeast (Saccharomyces cerevisiae)
    • barley (Hordeum vulgare)
    • beta proteobacteria (Neisseria meningitidis)
    • bread mold (Neurospora crassa)
    • chicken (Gallus gallus)
    • Chromalveolata (Phytophthora infestans)
    • common water flea (Daphnia pulex)
    • corn (Zea mays)
    • cow (Bos Taurus)
    • dog (Canis familiaris)
    • E. coli (Escherichia coli)
    • filamentous fungi (Aspergillus nidulans)
    • Firmicute bacteria (Streptococcus pneumoniae)
    • fission yeast (Schizosaccharomyces pombe)
    • fruit fly (Drosophila melanogaster)
    • green algae (Chlamydomonas reinhardtii)
    • honey bee (Apis mellifera)
    • K. lactis yeast (Kluyveromyces lactis)
    • lizard (Anolis carolinensis)
    • loblloly pine (Pinus taeda)
    • malaria parasite (Plasmodium falciparum)
    • medicago trunc (Medicago Truncatula)
    • moss (Physcomitrella patens)
    • mouse (Mus musculus)
    • oppossum (Monodelphis domestica)
    • orangutan (Pongo pygmaeus)
    • pig (Sus scrofa)
    • platypus (Ornithorhynchus anatinus)
    • rainbow trout (Oncorhynchus mykiss)
    • rat (Rattus norvegicus)
    • rice (Oryza sativa)
    • rice blast fungus (Magnaporthe grisea)
    • schistosome parasite (Schistosoma mansoni)
    • sea anemone (Nematostella vectensis)
    • sea squirt (Ciona intestinalis)
    • sea squirt (Ciona savignyi)
    • sea urchin (Strongylocentrotus purpuratus)
    • sorghum (Sorghum bicolor)
    • soybean (Glycine max)
    • stem rust fungus (Puccinia graminis)
    • sugarcane (Saccharum officinarum)
    • thale cress (Arabidopsis thaliana)
    • tomato (Lycopersicon esculentum)
    • toxoplasmosis (Toxoplasma gondii)
    • Trichoplax (Trichoplax adhaerens)
    • tropical clawed frog (Silurana tropicalis)
    • wheat (Triticum aestivum)
    • worm (Caenorhabditis elegans)
    • zebrafish (Danio rerio)

    Evolution for MIR1283-1 Gene

    ENSEMBL:
    Gene Tree for MIR1283-1 (if available)
    TreeFam:
    Gene Tree for MIR1283-1 (if available)

    Paralogs for MIR1283-1 Gene

    No data available for Paralogs for MIR1283-1 Gene

    Variants for MIR1283-1 Gene

    Sequence variations from dbSNP and Humsavar for MIR1283-1 Gene

    SNP ID Clin Chr 19 pos Sequence Context AA Info Type MAF
    rs1988088 -- 53,688,615(-) AAGCA(C/T)GCTCT downstream-variant-500B
    rs7249017 -- 53,688,114(+) AGATC(A/C/T)CATTT upstream-variant-2KB
    rs7249114 -- 53,688,113(+) TAGAT(C/T)ACATT upstream-variant-2KB
    rs11274495 -- 53,688,263(+) TTCTG(-/TTTGAGAACAAAACTCGGGAG)GATTG upstream-variant-2KB
    rs12977118 -- 53,687,570(+) AAAAa(A/T)atata upstream-variant-2KB

    Structural Variations from Database of Genomic Variants (DGV) for MIR1283-1 Gene

    Variant ID Type Subtype PubMed ID
    esv2718812 CNV Deletion 23290073
    nsv912385 CNV Gain 21882294
    dgv3999n71 CNV Gain 21882294
    nsv458781 CNV Gain 19166990
    esv2718833 CNV Deletion 23290073

    Relevant External Links for MIR1283-1 Gene

    HapMap Linkage Disequilibrium report
    MIR1283-1

    No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for MIR1283-1 Gene

    Disorders for MIR1283-1 Gene

    No disorders were found for MIR1283-1 Gene.

    No data available for UniProtKB/Swiss-Prot for MIR1283-1 Gene

    Publications for MIR1283-1 Gene

    1. miRBase: microRNA sequences, targets and gene nomenclature. (PMID: 16381832) Griffiths-Jones S. … Enright A.J. (Nucleic Acids Res. 2006) 3
    2. Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis. (PMID: 16954537) Berezikov E. … Cuppen E. (Genome Res. 2006) 3
    3. Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells. (PMID: 18285502) Morin R.D. … Marra M.A. (Genome Res. 2008) 3

    Products for MIR1283-1 Gene

    Sources for MIR1283-1 Gene

    Back to Top

    Content