Free for academic non-profit institutions. Other users need a Commercial license

Aliases for MIR1283-1 Gene

Subcategory (RNA class) for MIR1283-1 Gene

miRNA

Quality Score for this RNA gene is

3

Aliases for MIR1283-1 Gene

  • MicroRNA 1283-1 2 3 5
  • Hsa-Mir-1283-1 3
  • Mir-1283-1 3
  • MIRN1283-1 3

External Ids for MIR1283-1 Gene

Previous HGNC Symbols for MIR1283-1 Gene

  • MIRN1283-1

Previous GeneCards Identifiers for MIR1283-1 Gene

  • GC00U923158
  • GC19P058887
  • GC19P054191

Summaries for MIR1283-1 Gene

Entrez Gene Summary for MIR1283-1 Gene

  • microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs that are involved in post-transcriptional regulation of gene expression in multicellular organisms by affecting both the stability and translation of mRNAs. miRNAs are transcribed by RNA polymerase II as part of capped and polyadenylated primary transcripts (pri-miRNAs) that can be either protein-coding or non-coding. The primary transcript is cleaved by the Drosha ribonuclease III enzyme to produce an approximately 70-nt stem-loop precursor miRNA (pre-miRNA), which is further cleaved by the cytoplasmic Dicer ribonuclease to generate the mature miRNA and antisense miRNA star (miRNA*) products. The mature miRNA is incorporated into a RNA-induced silencing complex (RISC), which recognizes target mRNAs through imperfect base pairing with the miRNA and most commonly results in translational inhibition or destabilization of the target mRNA. The RefSeq represents the predicted microRNA stem-loop. [provided by RefSeq, Sep 2009]

GeneCards Summary for MIR1283-1 Gene

MIR1283-1 (MicroRNA 1283-1) is an RNA Gene, and is affiliated with the miRNA class.

No data available for UniProtKB/Swiss-Prot , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for MIR1283-1 Gene

Genomics for MIR1283-1 Gene

Regulatory Elements for MIR1283-1 Gene

Enhancers for MIR1283-1 Gene
GeneHancer Identifier Enhancer Score Enhancer Sources Gene-Enhancer Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor Binding Sites within enhancer Gene Targets for Enhancer
GH19F053659 0.7 ENCODE 13 -27.2 -27206 2.7 SOX13 ELF3 KLF1 PKNOX1 SAP130 NR2F6 KLF8 CREM GATAD2A SOX5 MIR515-2 MIR1283-1 MIR519C MIR520A MIR519B MIR526B MIR518F MIR520B MIR525 MIR518B
GH19F053844 1.4 FANTOM5 Ensembl ENCODE 11.1 +156.8 156813 1.0 ZNF121 ZNF263 ZNF366 HLF EED CEBPB ZBTB17 LOC105372457 ENSG00000232220 PRKCG MIR935 CACNG6 MIR1283-1 MIR519C MIR520A MIR515-1 MIR519E
GH19F053840 1.2 Ensembl ENCODE 11.1 +154.1 154120 4.0 PKNOX1 ARID4B SIN3A YBX1 ZNF121 FOS SP3 JUNB REST TBX21 LOC105372457 ENSG00000232220 PRKCG MIR935 CACNG6 MIR515-2 MIR519C MIR1283-1 MIR520A MIR515-1
- Elite enhancer/Elite enhancer-gene association Download Table
Download GeneHancer data dump

Enhancers around MIR1283-1 on UCSC Golden Path with GeneCards custom track

Genomic Location for MIR1283-1 Gene

Chromosome:
19
Start:
53,688,481 bp from pter
End:
53,688,567 bp from pter
Size:
87 bases
Orientation:
Plus strand

Genomic View for MIR1283-1 Gene

Genes around MIR1283-1 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
MIR1283-1 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for MIR1283-1 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for MIR1283-1 Gene

Proteins for MIR1283-1 Gene

Post-translational modifications for MIR1283-1 Gene

No Post-translational modifications

No data available for DME Specific Peptides for MIR1283-1 Gene

Domains & Families for MIR1283-1 Gene

Gene Families for MIR1283-1 Gene

Graphical View of Domain Structure for InterPro Entry

genes like me logo Genes that share domains with MIR1283-1: view

No data available for Protein Domains , Suggested Antigen Peptide Sequences and UniProtKB/Swiss-Prot for MIR1283-1 Gene

Function for MIR1283-1 Gene

Animal Model Products

miRNA Products

Clone Products

Flow Cytometry Products

No data available for Molecular function , Enzyme Numbers (IUBMB) , Gene Ontology (GO) - Molecular Function , Phenotypes , Human Phenotype Ontology , Animal Models , miRNA , Transcription Factor Targets and HOMER Transcription for MIR1283-1 Gene

Localization for MIR1283-1 Gene

No data available for Subcellular locations from UniProtKB/Swiss-Prot , Subcellular locations from COMPARTMENTS and Gene Ontology (GO) - Cellular Components for MIR1283-1 Gene

Pathways & Interactions for MIR1283-1 Gene

SuperPathways for MIR1283-1 Gene

No Data Available

Interacting Proteins for MIR1283-1 Gene

Gene Ontology (GO) - Biological Process for MIR1283-1 Gene

None

No data available for Pathways by source and SIGNOR curated interactions for MIR1283-1 Gene

Transcripts for MIR1283-1 Gene

mRNA/cDNA for MIR1283-1 Gene

(1) Ensembl transcripts including schematic representations, and UCSC links where relevant :

miRNA Products

Clone Products

Flow Cytometry Products

Alternative Splicing Database (ASD) splice patterns (SP) for MIR1283-1 Gene

No ASD Table

Relevant External Links for MIR1283-1 Gene

GeneLoc Exon Structure for
MIR1283-1
ECgene alternative splicing isoforms for
MIR1283-1

Expression for MIR1283-1 Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and SAGE for MIR1283-1 Gene

genes like me logo Genes that share expression patterns with MIR1283-1: view

No data available for mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , mRNA differential expression in normal tissues , Protein differential expression in normal tissues , Protein expression , Protein tissue co-expression partners and mRNA Expression by UniProt/SwissProt for MIR1283-1 Gene

Orthologs for MIR1283-1 Gene

This gene was present in the common ancestor of human and chimp.

Orthologs for MIR1283-1 Gene

Organism Taxonomy Gene Similarity Type Details
chimpanzee
(Pan troglodytes)
Mammalia ptr-mir-1283 35
  • 94 (a)
OneToOne
Species where no ortholog for MIR1283-1 was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • chicken (Gallus gallus)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • cow (Bos Taurus)
  • dog (Canis familiaris)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • fruit fly (Drosophila melanogaster)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • lizard (Anolis carolinensis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • mouse (Mus musculus)
  • oppossum (Monodelphis domestica)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • platypus (Ornithorhynchus anatinus)
  • rainbow trout (Oncorhynchus mykiss)
  • rat (Rattus norvegicus)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea squirt (Ciona intestinalis)
  • sea squirt (Ciona savignyi)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • tropical clawed frog (Silurana tropicalis)
  • wheat (Triticum aestivum)
  • worm (Caenorhabditis elegans)
  • zebrafish (Danio rerio)

Evolution for MIR1283-1 Gene

ENSEMBL:
Gene Tree for MIR1283-1 (if available)
TreeFam:
Gene Tree for MIR1283-1 (if available)

Paralogs for MIR1283-1 Gene

No data available for Paralogs for MIR1283-1 Gene

Variants for MIR1283-1 Gene

Sequence variations from dbSNP and Humsavar for MIR1283-1 Gene

SNP ID Clin Chr 19 pos Sequence Context AA Info Type
rs10425076 -- 53,686,587(+) CTCGG(C/T)AATAC downstream-variant-500B, upstream-variant-2KB
rs10425697 -- 53,686,713(+) ACCTA(A/G)CTCTC downstream-variant-500B, upstream-variant-2KB
rs10425934 -- 53,686,849(+) cgccc(A/G)gctaa downstream-variant-500B, upstream-variant-2KB
rs11274495 -- 53,688,263(+) TTCTG(-/TTTGAGAACAAAACTCGGGAG)GATTG upstream-variant-2KB
rs113614840 -- 53,686,927(+) GTAAT(C/T)CACCT downstream-variant-500B, upstream-variant-2KB

Structural Variations from Database of Genomic Variants (DGV) for MIR1283-1 Gene

Variant ID Type Subtype PubMed ID
esv2718812 CNV deletion 23290073
esv2718833 CNV deletion 23290073
esv2762049 CNV gain 21179565
nsv458781 CNV gain 19166990
nsv580107 CNV gain 21841781
nsv580108 CNV gain 21841781
nsv961246 CNV duplication 23825009

Relevant External Links for MIR1283-1 Gene

SNPedia medical, phenotypic, and genealogical associations of SNPs for
MIR1283-1

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot and Variation tolerance for MIR1283-1 Gene

Disorders for MIR1283-1 Gene

Relevant External Links for MIR1283-1

Atlas of Genetics and Cytogenetics in Oncology and Haematology:
MIR1283-1

No disorders were found for MIR1283-1 Gene.

No data available for MalaCards , UniProtKB/Swiss-Prot and Genatlas for MIR1283-1 Gene

Publications for MIR1283-1 Gene

  1. The human ATF1 rs11169571 polymorphism increases essential hypertension risk through modifying miRNA binding. (PMID: 26149214) Yang S. … Yang P. (FEBS Lett. 2015) 3 64
  2. miRBase: integrating microRNA annotation and deep-sequencing data. (PMID: 21037258) Kozomara A. … Griffiths-Jones S. (Nucleic Acids Res. 2011) 3 64
  3. Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells. (PMID: 18285502) Morin R.D. … Marra M.A. (Genome Res. 2008) 3 64
  4. miRBase: microRNA sequences, targets and gene nomenclature. (PMID: 16381832) Griffiths-Jones S. … Enright A.J. (Nucleic Acids Res. 2006) 3 64
  5. Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis. (PMID: 16954537) Berezikov E. … Cuppen E. (Genome Res. 2006) 3 64

Products for MIR1283-1 Gene

Sources for MIR1283-1 Gene

Content
Loading form....