Free for academic non-profit institutions. Other users need a Commercial license

Aliases for MIR1229 Gene

Subcategory (RNA class) for MIR1229 Gene

Quality Score for this RNA gene is

Aliases for MIR1229 Gene

  • MicroRNA 1229 2 3
  • Hsa-Mir-1229 3
  • MIRN1229 3

External Ids for MIR1229 Gene

Previous HGNC Symbols for MIR1229 Gene

  • MIRN1229

Previous GeneCards Identifiers for MIR1229 Gene

  • GC00U923116
  • GC05M179161
  • GC05M179225

Summaries for MIR1229 Gene

Entrez Gene Summary for MIR1229 Gene

  • microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs that are involved in post-transcriptional regulation of gene expression in multicellular organisms by affecting both the stability and translation of mRNAs. miRNAs are transcribed by RNA polymerase II as part of capped and polyadenylated primary transcripts (pri-miRNAs) that can be either protein-coding or non-coding. The primary transcript is cleaved by the Drosha ribonuclease III enzyme to produce an approximately 70-nt stem-loop precursor miRNA (pre-miRNA), which is further cleaved by the cytoplasmic Dicer ribonuclease to generate the mature miRNA and antisense miRNA star (miRNA*) products. The mature miRNA is incorporated into a RNA-induced silencing complex (RISC), which recognizes target mRNAs through imperfect base pairing with the miRNA and most commonly results in translational inhibition or destabilization of the target mRNA. The RefSeq represents the predicted microRNA stem-loop. [provided by RefSeq, Sep 2009]

GeneCards Summary for MIR1229 Gene

MIR1229 (MicroRNA 1229) is an RNA Gene, and is affiliated with the miRNA class.

No data available for UniProtKB/Swiss-Prot , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for MIR1229 Gene

Genomics for MIR1229 Gene

Epigenetics Products

  • DNA Methylation CpG Assay Predesigned for Pyrosequencing in human,mouse,rat

Genomic Location for MIR1229 Gene

179,798,278 bp from pter
179,798,346 bp from pter
69 bases
Minus strand

Genomic View for MIR1229 Gene

UCSC Golden Path with GeneCards custom track
Cytogenetic band:
Genomic Location for MIR1229 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for MIR1229 Gene

ORGUL Member Location for MIR1229 Gene

ORGUL Member Location for MIR1229 gene

No data available for Regulatory Elements for MIR1229 Gene

Proteins for MIR1229 Gene

Post-translational modifications for MIR1229 Gene

No Post-translational modifications

No data available for DME Specific Peptides for MIR1229 Gene

Domains for MIR1229 Gene

Gene Families for MIR1229 Gene

  • MIR :ncRNAs / Micro RNAs

Graphical View of Domain Structure for InterPro Entry

genes like me logo Genes that share domains with MIR1229: view

No data available for Protein Domains , Suggested Antigen Peptide Sequences and UniProtKB/Swiss-Prot for MIR1229 Gene

Function for MIR1229 Gene

No data available for Molecular function , Enzyme Numbers (IUBMB) , Gene Ontology (GO) - Molecular Function , Phenotypes , Animal Models , miRNA , Transcription Factor Targeting and HOMER Transcription for MIR1229 Gene

Localization for MIR1229 Gene

No data available for Subcellular locations from UniProtKB/Swiss-Prot , Subcellular locations from COMPARTMENTS and Gene Ontology (GO) - Cellular Components for MIR1229 Gene

Pathways for MIR1229 Gene

SuperPathways for MIR1229 Gene

No Data Available

Interacting Proteins for MIR1229 Gene

Gene Ontology (GO) - Biological Process for MIR1229 Gene

No data available for Pathways by source for MIR1229 Gene

Transcripts for MIR1229 Gene

mRNA/cDNA for MIR1229 Gene

(2) Ensembl transcripts including schematic representations, and UCSC links where relevant :

Alternative Splicing Database (ASD) splice patterns (SP) for MIR1229 Gene

No ASD Table

Relevant External Links for MIR1229 Gene

GeneLoc Exon Structure for
ECgene alternative splicing isoforms for

Expression for MIR1229 Gene

mRNA expression in normal human tissues for MIR1229 Gene

genes like me logo Genes that share expressions with MIR1229: view

In Situ Assay Products

No data available for mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , mRNA differential expression in normal tissues , Protein differential expression in normal tissues , Protein expression , mRNA Expression by UniProt/SwissProt and Expression partners for MIR1229 Gene

Orthologs for MIR1229 Gene

Evolution for MIR1229 Gene

Gene Tree for MIR1229 (if available)
Gene Tree for MIR1229 (if available)

No data available for Orthologs for MIR1229 Gene

Paralogs for MIR1229 Gene

No data available for Paralogs for MIR1229 Gene

Variants for MIR1229 Gene

Sequence variations from dbSNP and Humsavar for MIR1229 Gene

SNP ID Clin Chr 05 pos Sequence Context AA Info Type MAF
rs369267917 -- 179,799,788(+) CAGAC(-/ATGTCTGATGCACAGGCAATGAGAACAGGC)CAGGT upstream-variant-2KB
rs537018538 -- 179,799,787(+) GCAGA(-/CATGTCTGATGCACAGGCAATGAGAACAGG)CCAGG upstream-variant-2KB

Structural Variations from Database of Genomic Variants (DGV) for MIR1229 Gene

Variant ID Type Subtype PubMed ID
nsv883270 CNV Loss 21882294
nsv483062 CNV Loss 15286789
nsv469579 CNV Loss 16826518
dgv6400n71 CNV Loss 21882294
nsv518964 CNV Loss 19592680
nsv883275 CNV Loss 21882294
nsv823361 CNV Loss 20364138
nsv883278 CNV Loss 21882294
dgv6401n71 CNV Loss 21882294
dgv6402n71 CNV Loss 21882294
dgv6403n71 CNV Loss 21882294

Relevant External Links for MIR1229 Gene

HapMap Linkage Disequilibrium report

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for MIR1229 Gene

Disorders for MIR1229 Gene

No disorders were found for MIR1229 Gene.

No data available for MalaCards , OMIM , UniProtKB/Swiss-Prot , University of Copenhagen DISEASES , Novoseek inferred disease relationships , Genatlas and External Links for MIR1229 Gene

Publications for MIR1229 Gene

  1. miRBase: microRNA sequences, targets and gene nomenclature. (PMID: 16381832) Griffiths-Jones S. … Enright A.J. (Nucleic Acids Res. 2006) 3
  2. Mammalian mirtron genes. (PMID: 17964270) Berezikov E. … Lai E.C. (Mol. Cell 2007) 3

Products for MIR1229 Gene

Sources for MIR1229 Gene

Back to Top