Free for academic non-profit institutions. Other users need a Commercial license

Aliases for MIR1229 Gene

Subcategory (RNA class) for MIR1229 Gene


Quality Score for this RNA gene is


Aliases for MIR1229 Gene

  • MicroRNA 1229 2 3 5
  • Hsa-Mir-1229 3
  • MIRN1229 3

External Ids for MIR1229 Gene

Previous HGNC Symbols for MIR1229 Gene

  • MIRN1229

Previous GeneCards Identifiers for MIR1229 Gene

  • GC00U923116
  • GC05M179161
  • GC05M179225

Summaries for MIR1229 Gene

Entrez Gene Summary for MIR1229 Gene

  • microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs that are involved in post-transcriptional regulation of gene expression in multicellular organisms by affecting both the stability and translation of mRNAs. miRNAs are transcribed by RNA polymerase II as part of capped and polyadenylated primary transcripts (pri-miRNAs) that can be either protein-coding or non-coding. The primary transcript is cleaved by the Drosha ribonuclease III enzyme to produce an approximately 70-nt stem-loop precursor miRNA (pre-miRNA), which is further cleaved by the cytoplasmic Dicer ribonuclease to generate the mature miRNA and antisense miRNA star (miRNA*) products. The mature miRNA is incorporated into a RNA-induced silencing complex (RISC), which recognizes target mRNAs through imperfect base pairing with the miRNA and most commonly results in translational inhibition or destabilization of the target mRNA. The RefSeq represents the predicted microRNA stem-loop. [provided by RefSeq, Sep 2009]

GeneCards Summary for MIR1229 Gene

MIR1229 (MicroRNA 1229) is an RNA Gene, and is affiliated with the miRNA class.

No data available for UniProtKB/Swiss-Prot , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for MIR1229 Gene

Genomics for MIR1229 Gene

Regulatory Elements for MIR1229 Gene

Enhancers for MIR1229 Gene
GeneHancer Identifier Enhancer Score Enhancer Sources Gene-Enhancer Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor Binding Sites within enhancer Gene Targets for Enhancer
- Elite enhancer/Elite enhancer-gene association

Enhancers around MIR1229 on UCSC Golden Path with GeneCards custom track

Genomic Location for MIR1229 Gene

179,798,278 bp from pter
179,798,346 bp from pter
69 bases
Minus strand

Genomic View for MIR1229 Gene

Genes around MIR1229 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
MIR1229 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for MIR1229 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for MIR1229 Gene

ORGUL Member Location for MIR1229 Gene

ORGUL Member Location for MIR1229 gene

Proteins for MIR1229 Gene

Post-translational modifications for MIR1229 Gene

No Post-translational modifications

No data available for DME Specific Peptides for MIR1229 Gene

Domains & Families for MIR1229 Gene

Gene Families for MIR1229 Gene

Graphical View of Domain Structure for InterPro Entry

genes like me logo Genes that share domains with MIR1229: view

No data available for Protein Domains , Suggested Antigen Peptide Sequences and UniProtKB/Swiss-Prot for MIR1229 Gene

Function for MIR1229 Gene

Animal Model Products

miRNA Products

Clone Products

Flow Cytometry Products

No data available for Molecular function , Enzyme Numbers (IUBMB) , Gene Ontology (GO) - Molecular Function , Phenotypes , Human Phenotype Ontology , Animal Models , miRNA , Transcription Factor Targets and HOMER Transcription for MIR1229 Gene

Localization for MIR1229 Gene

No data available for Subcellular locations from UniProtKB/Swiss-Prot , Subcellular locations from COMPARTMENTS and Gene Ontology (GO) - Cellular Components for MIR1229 Gene

Pathways & Interactions for MIR1229 Gene

SuperPathways for MIR1229 Gene

No Data Available

Interacting Proteins for MIR1229 Gene

Gene Ontology (GO) - Biological Process for MIR1229 Gene


No data available for Pathways by source and SIGNOR curated interactions for MIR1229 Gene

Drugs & Compounds for MIR1229 Gene

No Compound Related Data Available

Transcripts for MIR1229 Gene

mRNA/cDNA for MIR1229 Gene

(1) Ensembl transcripts including schematic representations, and UCSC links where relevant :

Alternative Splicing Database (ASD) splice patterns (SP) for MIR1229 Gene

No ASD Table

Relevant External Links for MIR1229 Gene

GeneLoc Exon Structure for
ECgene alternative splicing isoforms for

Expression for MIR1229 Gene

mRNA expression in normal human tissues for MIR1229 Gene

NURSA nuclear receptor signaling pathways regulating expression of MIR1229 Gene:

genes like me logo Genes that share expression patterns with MIR1229: view

No data available for mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , mRNA differential expression in normal tissues , Protein differential expression in normal tissues , Protein expression , Protein tissue co-expression partners and mRNA Expression by UniProt/SwissProt for MIR1229 Gene

Orthologs for MIR1229 Gene

Evolution for MIR1229 Gene

Gene Tree for MIR1229 (if available)
Gene Tree for MIR1229 (if available)

No data available for Orthologs for MIR1229 Gene

Paralogs for MIR1229 Gene

No data available for Paralogs for MIR1229 Gene

Variants for MIR1229 Gene

Sequence variations from dbSNP and Humsavar for MIR1229 Gene

SNP ID Clin Chr 05 pos Sequence Context AA Info Type
rs369267917 -- 179,799,788(+) CAGAC(-/ATGTCTGATGCACAGGCAATGAGAACAGGC)CAGGT upstream-variant-2KB
rs537018538 -- 179,799,787(+) GCAGA(-/CATGTCTGATGCACAGGCAATGAGAACAGG)CCAGG upstream-variant-2KB

Structural Variations from Database of Genomic Variants (DGV) for MIR1229 Gene

Variant ID Type Subtype PubMed ID
dgv10240n54 CNV loss 21841781
dgv10241n54 CNV loss 21841781
nsv469579 CNV loss 16826518
nsv518964 CNV loss 19592680
nsv600659 CNV loss 21841781
nsv600660 CNV loss 21841781
nsv600661 CNV loss 21841781
nsv823361 CNV loss 20364138

Relevant External Links for MIR1229 Gene

SNPedia medical, phenotypic, and genealogical associations of SNPs for

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot and Variation tolerance for MIR1229 Gene

Disorders for MIR1229 Gene

Relevant External Links for MIR1229

Atlas of Genetics and Cytogenetics in Oncology and Haematology:

No disorders were found for MIR1229 Gene.

No data available for MalaCards , UniProtKB/Swiss-Prot and Genatlas for MIR1229 Gene

Publications for MIR1229 Gene

  1. Mammalian mirtron genes. (PMID: 17964270) Berezikov E. … Lai E.C. (Mol. Cell 2007) 3 65
  2. miRBase: microRNA sequences, targets and gene nomenclature. (PMID: 16381832) Griffiths-Jones S. … Enright A.J. (Nucleic Acids Res. 2006) 3 65

Products for MIR1229 Gene

Sources for MIR1229 Gene

Loading form....