Free for academic non-profit institutions. Other users need a Commercial license

Aliases for MIMT1 Gene

Subcategory (RNA class) for MIMT1 Gene


Quality Score for this RNA gene is


Aliases for MIMT1 Gene

  • MER1 Repeat Containing Imprinted Transcript 1 (Non-Protein Coding) 2 3
  • Long Intergenic Non-Protein Coding RNA 67 2 3
  • Non-Protein Coding RNA 67 2
  • NCRNA00067 3
  • LINC00067 3
  • MIM1 3

External Ids for MIMT1 Gene

ORGUL Members for MIMT1 Gene

Previous GeneCards Identifiers for MIMT1 Gene

  • GC19U900733
  • GC19P057352
  • GC19P053661

Summaries for MIMT1 Gene

GeneCards Summary for MIMT1 Gene

MIMT1 (MER1 Repeat Containing Imprinted Transcript 1 (Non-Protein Coding)) is an RNA Gene, and is affiliated with the lncRNA class.

No data available for Entrez Gene Summary , UniProtKB/Swiss-Prot , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for MIMT1 Gene

Genomics for MIMT1 Gene

Regulatory Elements for MIMT1 Gene

Genomic Location for MIMT1 Gene

56,840,902 bp from pter
56,848,556 bp from pter
7,655 bases
Plus strand

Genomic View for MIMT1 Gene

UCSC Golden Path with GeneCards custom track
Cytogenetic band:
Genomic Location for MIMT1 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for MIMT1 Gene

Proteins for MIMT1 Gene

Post-translational modifications for MIMT1 Gene

No Post-translational modifications

No data available for DME Specific Peptides for MIMT1 Gene

Domains for MIMT1 Gene

Graphical View of Domain Structure for InterPro Entry

No data available for Gene Families , Protein Domains , Suggested Antigen Peptide Sequences and UniProtKB/Swiss-Prot for MIMT1 Gene

Function for MIMT1 Gene

No data available for Molecular function , Enzyme Numbers (IUBMB) , Gene Ontology (GO) - Molecular Function , Phenotypes , Animal Models , miRNA , Transcription Factor Targets and HOMER Transcription for MIMT1 Gene

Localization for MIMT1 Gene

No data available for Subcellular locations from UniProtKB/Swiss-Prot , Subcellular locations from COMPARTMENTS and Gene Ontology (GO) - Cellular Components for MIMT1 Gene

Pathways for MIMT1 Gene

SuperPathways for MIMT1 Gene

No Data Available

Interacting Proteins for MIMT1 Gene

Gene Ontology (GO) - Biological Process for MIMT1 Gene


No data available for Pathways by source for MIMT1 Gene

Transcripts for MIMT1 Gene

mRNA/cDNA for MIMT1 Gene

(4) Additional mRNA sequences :
(3) Ensembl transcripts including schematic representations, and UCSC links where relevant :

Unigene Clusters for MIMT1 Gene

MER1 repeat containing imprinted transcript 1 (non-protein coding):
Representative Sequences:

Alternative Splicing Database (ASD) splice patterns (SP) for MIMT1 Gene

No ASD Table

Relevant External Links for MIMT1 Gene

GeneLoc Exon Structure for
ECgene alternative splicing isoforms for

Expression for MIMT1 Gene

mRNA expression in normal human tissues for MIMT1 Gene

mRNA differential expression in normal tissues according to GTEx for MIMT1 Gene

This gene is overexpressed in Testis (9.0) and Brain - Nucleus accumbens (basal ganglia) (4.4).

SOURCE GeneReport for Unigene cluster for MIMT1 Gene Hs.467337

genes like me logo Genes that share expressions with MIMT1: view

Primer Products

  • QuantiTect SYBR Green Assays in human,mouse,rat
  • Pre-validated RT² qPCR Primer Assay in human,mouse,rat
  • QuantiFast Probe-based Assays in human,mouse,rat

In Situ Assay Products

No data available for mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , Protein differential expression in normal tissues , Protein expression , mRNA Expression by UniProt/SwissProt and Expression partners for MIMT1 Gene

Orthologs for MIMT1 Gene

Evolution for MIMT1 Gene

Gene Tree for MIMT1 (if available)
Gene Tree for MIMT1 (if available)

No data available for Orthologs for MIMT1 Gene

Paralogs for MIMT1 Gene

No data available for Paralogs for MIMT1 Gene

Variants for MIMT1 Gene

Sequence variations from dbSNP and Humsavar for MIMT1 Gene

SNP ID Clin Chr 19 pos Sequence Context AA Info Type MAF
rs4458116 -- 56,844,884(+) TACAC(C/T)GCACC intron-variant
rs6146573 -- 56,845,327(+) ATATT(-/TGAAAGGGGATACTCTTATCTTTACTA)TGAAA intron-variant
rs10410188 -- 56,846,653(+) TATTT(C/T)TTTAA intron-variant
rs11387052 -- 56,843,283(+) ACGAC(-/A)CAAAA intron-variant
rs12461283 -- 56,846,170(+) TGTTC(A/C)ATATA intron-variant

Structural Variations from Database of Genomic Variants (DGV) for MIMT1 Gene

Variant ID Type Subtype PubMed ID
nsv833884 CNV Loss 17160897

Relevant External Links for MIMT1 Gene

HapMap Linkage Disequilibrium report

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for MIMT1 Gene

Disorders for MIMT1 Gene

Relevant External Links for MIMT1

Genetic Association Database (GAD)

No disorders were found for MIMT1 Gene.

No data available for MalaCards , OMIM , UniProtKB/Swiss-Prot , University of Copenhagen DISEASES , Novoseek inferred disease relationships and Genatlas for MIMT1 Gene

Publications for MIMT1 Gene

  1. Genomic organization and imprinting of the Peg3 domain in bovine. (PMID: 17509818) Kim J. … Stubbs L. (Genomics 2007) 2 3
  2. A genome-wide association study for blood lipid phenotypes in the Framingham Heart Study. (PMID: 17903299) Kathiresan S. … Cupples L.A. (BMC Med. Genet. 2007) 48
  3. ncRNAimprint: a comprehensive database of mammalian imprinted noncoding RNAs. (PMID: 20801769) Zhang Y. … Qu L.H. (RNA 2010) 3

Products for MIMT1 Gene

Sources for MIMT1 Gene

Back to Top