Set Analyses:
Advanced Search

Advanced Search

 
Search By
Section (entire)
for


 
or upload a file of gene symbols


Category   Symbol Source: HGNC EntrezGene Ensembl GeneCards RNA genes CroW21
GIFtS

MIA3 Gene

protein-coding   GIFtS: 51
GCID: GC01P222791

melanoma inhibitory activity family, member 3

 Explore 12 diseases affiliated with
MIA3 via our new
 Human Malady Compendium 
Biological research products
for MIA3
    

(According to 1HGNC, 2Entrez Gene,
3UniProtKB/Swiss-Prot, 4UniProtKB/TrEMBL, 5OMIM, 6GeneLoc, 7Ensembl, 8DME, 9miRBase, and/or 10fRNAdb)
About This Section

Aliases
Melanoma Inhibitory Activity Family, Member 31 2     D3202 3
TANGO1 2 3 5     C219-Reactive Peptide2 3
KIAA02681 3 5     FLJ392071
TANGO12 3 5     ARNT2
UNQ60771 2     C219 Reactive Peptide2
Transport And Golgi Organization Protein 12 3     Melanoma Inhibitory Activity Protein 32

External Ids:    HGNC: 240081   Entrez Gene: 3750562   Ensembl: ENSG000001543057   OMIM: 6134555   UniProtKB: Q5JRA63   

Export aliases for MIA3 gene to outside databases

Previous GC identifers: GC01U901180 GC01P220858 GC01P193465


(According to Entrez Gene, Tocris Bioscience, Wikipedia's Gene Wiki, PharmGKB,
UniProtKB/Swiss-Prot, and/or UniProtKB/TrEMBL)
About This Section

UniProtKB/Swiss-Prot: MIA3_HUMAN, Q5JRA6
Function: Required for collagen VII (COL7A1) secretion by loading COL7A1 into transport carriers. May participate in
cargo loading of COL7A1 at endoplasmic reticulum exit sites by binding to COPII coat subunits Sec23/24 and guiding
SH3-bound COL7A1 into a growing carrier. Does not play a role in global protein secretion and is apparently specific
to COL7A1 cargo loading. However, it may participate in secretion of other proteins in cells that do not secrete
COL7A1




(According to GeneLoc and/or HGNC, and/or
Entrez Gene (NCBI build 37),
and/or miRBase,
Genomic Views according to UCSC (hg19) and Ensembl (release 69), Regulatory elements and Epigenetics data according to QIAGEN, SABiosciences, and/or SwitchGear Genomics)
About This Section
RefSeq DNA sequence:
NC_000001.10  NC_018912.1  NT_167186.1  
Regulatory elements:
   Search SABiosciences Regulatory transcription factor binding sites for MIA3
         Other transcription factors

SwitchGear Promoter luciferase reporter plasmidMIA3 promoter sequence
   Search SABiosciences Chromatin IP Primers for MIA3

Epigenetics:
QIAGEN PyroMark CpG Assay predesigned Pyrosequencing DNA Methylation assays in human, mouse, rat MIA3


Genomic Location:
Genomic View: UCSC Golden Path with GeneCards custom track

Entrez Gene cytogenetic band: 1q41   Ensembl cytogenetic band:  1q41   HGNC cytogenetic band: 1p36.33

MIA3 Gene in genomic location: bands according to Ensembl, locations according to (and/or Entrez Gene and/or Ensembl if different)
MIA3 gene location

GeneLoc information about chromosome 1         GeneLoc Exon Structure

GeneLoc location for GC01P222791:  view genomic region     (about GC identifiers)

Start:
222,791,428 bp from pter      End:
222,841,354 bp from pter
Size:
49,927 bases      Orientation:
plus strand

(According to 1UniProtKB, HORDE, neXtProt, Ensembl, and/or Reactome, Modification sites according to 2PhosphoSitePlus, Specific Peptides from DME, Protein expression images according to data from SPIRE MOPED and PaxDb, RefSeq according to NCBI, PDB rendering according to OCA and/or Proteopedia, Recombinant Proteins from EMD Millipore, R&D Systems, GenScript, Enzo Life Sciences, OriGene, Novus Biologicals, Sino Biological, ProSpec, and/or Uscn,
Biochemical Assays by EMD Millipore, R&D Systems, OriGene, GenScript, Cell Signaling Technology, Enzo Life Sciences, and/or Uscn, Ontologies according to Gene Ontology Consortium 01 Mar 2013 and Entrez Gene, Antibodies by EMD Millipore, R&D Systems, GenScript, Cell Signaling Technology, OriGene, Novus Biologicals, Thermo Fisher Scientific, Abcam, and/or Uscn)
About This Section

UniProtKB/Swiss-Prot: MIA3_HUMAN, Q5JRA6 (See protein sequence)
Recommended Name: Melanoma inhibitory activity protein 3 precursor  
Size: 1907 amino acids; 213702 Da
Subunit: Interacts (via SH3 domain) with COL7A1. Associates with the COPII coat subunits Sec23/Sec24
Subcellular location: Endoplasmic reticulum membrane; Single-pass type I membrane protein. Note=Localizes at
endoplasmic reticulum exit sites. After loading of COL7A1 into transport carriers, it is not incorporated into COPII
carriers and remains in the endoplasmic reticulum membrane
Sequence caution: Sequence=BAC04810.1; Type=Erroneous initiation; Sequence=BAF83024.1; Type=Erroneous initiation;
Sequence=CAI40474.1; Type=Erroneous gene model prediction;
Secondary accessions: A8K2S0 A8MT05 A8MT13 B7Z430 Q14083 Q3S4X3 Q5JRA5 Q5JRB0 Q5JRB1 Q5JRB2 Q6UVY8
Q86Y60 Q8N8M5 Q92580
Alternative splicing: 4 isoforms:  Q5JRA6-1   Q5JRA6-2   Q5JRA6-3   Q5JRA6-4   

Explore the universe of human proteins at neXtProt for MIA3: NX_Q5JRA6

Post-translational modifications:

  • View modification sites using PhosphoSitePlus2
  • View neXtProt modification sites for NX_Q5JRA6

  • MIA3 Protein expression data from MOPED and PaxDb:    About this image 
    Estimated protein expression log10 (pmol).

    REFSEQ proteins: NP_940953.2  
    ENSEMBL proteins: 
     ENSP00000340900   ENSP00000341348   ENSP00000355062   ENSP00000345866   ENSP00000396598  
     ENSP00000340587  

    Human Recombinant Protein Products: 
    Browse Purified and Recombinant Proteins at EMD Millipore
    Browse R&D Systems for human recombinant proteins
    Browse recombinant and purified proteins available from Enzo Life Sciences
    Browse OriGene full length recombinant human proteins expressed in human HEK293 cells
    Browse OriGene Protein Over-expression Lysates
    OriGene Custom Protein Services for MIA3 
    GenScript Custom Purified and Recombinant Proteins Services for MIA3
    Browse Sino Biological Recombinant Proteins
    Browse ProSpec Recombinant Proteins
    Uscn Proteins for MIA3

    Gene Ontology (GO): 2 cellular component terms (GO ID links to tree view):    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0005789endoplasmic reticulum membrane IDA19269366
    GO:0016021integral to membrane IDA19269366


    MIA3 for ontologies           About GeneDecksing



    MIA3 Antibody Products: 
    Browse EMD Millipore's Extensive Line of Mono- and Polyclonal Antibodies
    Browse R&D Systems for Antibodies
    OriGene Antibodies: MIA3
    OriGene Custom Antibody Services for MIA3 
    GenScript Custom Superior Antibodies Services for MIA3
    Search for Antibodies for MIA3 at Abcam  
    Uscn Antibodies for MIA3
    ThermoFisher Antibody for MIA3

    Assay Products for MIA3: 
    Browse Kits and Assays available from EMD Millipore
    OriGene Custom Immunoassay Development
    Browse OriGene Fluorogenic Cell Assay Kits
    Browse R&D Systems for biochemical assays
    GenScript Custom Assay Services for MIA3
    Browse Enzo Life Sciences for kits & assays
    Uscn ELISAs and CLIAs for MIA3


    (According to InterPro, ProtoNet, UniProtKB, and/or BLOCKS, Sets of similar genes according to GeneDecks)
    About This Section

    MIA3 for domains           About GeneDecksing

    2 InterPro domains/families:
     IPR001452 SH3_domain
     IPR011511 SH3_2

    Graphical View of Domain Structure for InterPro Entry Q5JRA6

    ProtoNet protein and cluster: Q5JRA6

    UniProtKB/Swiss-Prot: MIA3_HUMAN, Q5JRA6
    Domain: The proline-rich region (PRD) mediates the interaction with COPII coat subunits Sec23/24
    Domain: Although 2 transmembrane domains are predicted, PubMed:19269366 showed that it only contains one transmembrane
    domain. The other predicted transmembrane region is probably a hairpin-type region embedded into the membrane, which
    does not cross the membrane. It is unclear which of the 2 predicted transmembrane regions is the transmembrane or the
    hairpin-type region
    Similarity: Belongs to the MIA/OTOR family. Tango1 subfamily
    Similarity: Contains 1 SH3 domain


    (According to 1UniProtKB, Genatlas, LifeMap Discovery™, IUBMB, and/or 2DME, Human phenotypes from GenomeRNAi, Animal models from MGI Mar 06 2013,
    bound targets from SABiosciences, miRNA Gene Targets from miRTarBase shRNA from OriGene, RNAi from EMD Millipore, siRNAs from OriGene, QIAGEN, microRNA from QIAGEN, Gene Editing from DNA2.0, Clones from EMD Millipore, OriGene, SwitchGear Genomics, GenScript, Sino Biological, DNA2.0, and Vector BioLabs, Cell Lines from GenScript, LifeMap BioReagents, In Situ Hybridization Assays from Advanced Cell Diagnostics, Ontologies according to Gene Ontology Consortium 01 Mar 2013 via Entrez Gene.)
    About This Section

    Function Summary:

         UniProtKB/Swiss-Prot: MIA3_HUMAN, Q5JRA6
    Function: Required for collagen VII (COL7A1) secretion by loading COL7A1 into transport carriers. May participate in
    cargo loading of COL7A1 at endoplasmic reticulum exit sites by binding to COPII coat subunits Sec23/24 and guiding
    SH3-bound COL7A1 into a growing carrier. Does not play a role in global protein secretion and is apparently specific
    to COL7A1 cargo loading. However, it may participate in secretion of other proteins in cells that do not secrete
    COL7A1

    miRNA
    Products:
        
    miRTarBase miRNAs that target MIA3:
    hsa-mir-107 (MIRT004537)

    OriGene 3'-UTR Clone: MIA3
    Browse MicroRNA Expression Plasmids
    QIAGEN Custom miScript Target Protector blocks miRNA-binding site of human, mouse, rat MIA3
    8/54 QIAGEN miScript miRNA Assays for microRNAs that regulate MIA3 (see all 54):
    hsa-miR-21* hsa-miR-3164 hsa-miR-323-3p hsa-miR-607 hsa-miR-3146 hsa-miR-1245 hsa-miR-25 hsa-miR-30d
    SwitchGear 3'UTR luciferase reporter plasmidMIA3 3' UTR sequence
    Inhib. RNA
    Products:
        
    Browse for Gene Knock-down Tools from EMD Millipore
    OriGene 29mer shRNA kits in GFP-retroviral vector in human, mouse, rat for MIA3 (see all 4)
    OriGene shRNA RFP: MIA3
    OriGene siRNA: MIA3
    QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat MIA3

    Gene Editing
    Products:
    DNA2.0 Custom Protein Engineering Service for MIA3

    Clone
    Products:
         
    Browse Clones for the Expression of Recombinant Proteins Available from EMD Millipore
    OriGene Myc/DDK tagged cDNA clones in CMV expression vector in human, mouse, rat for MIA3 (see all 2)
    OriGene untagged cDNA clones in CMV expression vector in human, mouse, rat for MIA3
    OriGene custom cloning services – gene synthesis, subcloning, mutagenesis, variant library, vector shuttling 
    GenScript: all cDNA clones in your preferred vector: MIA3 (NM_198551)
    Browse Sino Biological Human cDNA Clones
    DNA2.0 Custom Codon Optimized Gene Synthesis Service for MIA3
    Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat MIA3 

    Cell Line
    Products:
         
    GenScript Custom overexpressing Cell Line Services for MIA3
    Search LifeMap BioReagents cell lines for MIA3

    In Situ Assay
    Products:
       

     
    Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for MIA3

    Gene Ontology (GO): 1 molecular function term (GO ID links to tree view):    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0005515protein binding IPI17726152


    MIA3 for ontologies           About GeneDecksing


    Animal Models:
         10 MGI mutant phenotypes (inferred from 1 allele(MGI details for Mia3):
     cardiovascular system  cellular  craniofacial  growth/size  homeostasis/metabolism 
     integument  limbs/digits/tail  mortality/aging  respiratory system  skeleton 

    MIA3 for phenotypes           About GeneDecksing


    (Pathways according to EMD Millipore, R&D Systems, Cell Signaling Technology, KEGG, PharmGKB, BioSystems, Reactome, Tocris Bioscience, GeneGo (Thomson Reuters), QIAGEN, and/or UniProtKB, Sets of similar genes according to GeneDecks, Interaction Networks according to SABiosciences, and/or STRING, Interactions according to 1UniProtKB, 2MINT, 3I2D, and/or 4STRING, with links to IntAct and Ensembl, Ontologies according to Gene Ontology Consortium 01 Mar 2013 via Entrez Gene).
    About This Section



    Interactions:

        Search SABiosciences Gene Network CentralTM Interacting Genes and Proteins Networks for MIA3

    STRING Interaction Network Preview (showing 5 interactants - click image to see 6)

    5/8 Interacting proteins for MIA3 (Q5JRA61, 2, 3 ENSP000003409004) via UniProtKB, MINT, STRING, and/or I2D (see all 8)
    InteractantInteraction Details
    GeneCardExternal ID(s)
    COL7A1Q023881, 2, 3, ENSP000003323714EBI-2803073,EBI-724237 MINT-7217948 MINT-7217938 MINT-7217905 MINT-7217969 MINT-7217990 MINT-7217980 MINT-7217958 I2D: score=2 STRING: ENSP00000332371
    SEC23AQ154362, 3, ENSP000003068814MINT-7217893 I2D: score=1 STRING: ENSP00000306881
    SEC24CP539922, 3, ENSP000003218454MINT-7217922 I2D: score=1 STRING: ENSP00000321845
    MINOS1Q5TGZ03, ENSP000003255624I2D: score=1 STRING: ENSP00000325562
    CACNA1AO005553I2D: score=1 
    About this table

    Gene Ontology (GO): 5/6 biological process terms (GO ID links to tree view) (see all 6):    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0002687positive regulation of leukocyte migration IDA17726152
    GO:0006887exocytosis IMP19269366
    GO:0007162negative regulation of cell adhesion IDA17726152
    GO:0015031protein transport IMP19269366
    GO:0030336negative regulation of cell migration IDA17044017


    MIA3 for ontologies           About GeneDecksing



    (Chemical Compounds according to UniProtKB, Enzo Life Sciences, EMD Millipore, Tocris Bioscience HMDB, BitterDB, and/or Novoseek, and Drugs according to DrugBank, Enzo Life Sciences, and/or PharmGKB, with drugs/clinical trials/news search links to CenterWatch)
    About This Section
    Browse Small Molecules at EMD Millipore
    Browse drugs & compounds from Enzo Life Sciences

    Browse Tocris compounds for MIA3
    Search CenterWatch for drugs/clinical trials and news about MIA3 

    (Secondary structures according to fRNAdb,
    GenBank/EMBL/DDBJ Accessions according to
    Unigene (Build 235 Homo sapiens; Mar 10 2013) or GenBank,
    RefSeq according to Entrez Gene,
    DOTS (version 10), and/or AceView, transcript ids from Ensembl with links to UCSC,
    exon structure from GeneLoc, alternative splicing isoforms according to ASD and/or ECgene,
    RNAi Products from EMD Millipore,
    siRNAs from OriGene, QIAGEN, shRNA from OriGene, microRNA from QIAGEN,
    Tagged/untagged cDNA clones from OriGene, SwitchGear Genomics, GenScript, DNA2.0, Vector BioLabs, Primers from OriGene, SABiosciences, and/or QIAGEN )
    About This Section

    REFSEQ mRNAs for MIA3 gene: 
    NM_198551.2  

    Unigene Cluster for MIA3:

    Melanoma inhibitory activity family, member 3
    Hs.118474  [show with all ESTs]
    Unigene Representative Sequence: NM_198551
    13 Ensembl transcripts including schematic representations, and UCSC links where relevant:
    ENST00000344922(uc009xea.1 uc001hnl.3 uc001hnm.3) ENST00000470521
    ENST00000344507 ENST00000354906 ENST00000340535 ENST00000495210 ENST00000467190
    ENST00000476400 ENST00000475451 ENST00000479370 ENST00000450260 ENST00000477519
    ENST00000344441

    miRNA
    Products:
         
    OriGene 3'-UTR Clone: MIA3
    Browse OriGene MicroRNA Expression Plasmids
    QIAGEN Custom miScript Target Protector blocks miRNA-binding site of human, mouse, rat MIA3
    8/54 QIAGEN miScript miRNA Assays for microRNAs that regulate MIA3 (see all 54):
    hsa-miR-21* hsa-miR-3164 hsa-miR-323-3p hsa-miR-607 hsa-miR-3146 hsa-miR-1245 hsa-miR-25 hsa-miR-30d
    SwitchGear 3'UTR luciferase reporter plasmidMIA3 3' UTR sequence
    Inhib. RNA
    Products:
         
    Browse for Gene Knock-down Tools from EMD Millipore
    OriGene 29mer shRNA kits in GFP-retroviral vector in human, mouse, rat for MIA3 (see all 4)
    OriGene shRNA RFP: MIA3
    OriGene siRNA: MIA3
    QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat MIA3
    Clone
    Products:
         
    OriGene Myc/DDK tagged cDNA clones in CMV expression vector in human, mouse, rat for MIA3 (see all 2)
    OriGene untagged cDNA clones in CMV expression vector in human, mouse, rat for MIA3
    OriGene custom cloning services – gene synthesis, subcloning, mutagenesis, variant library, vector shuttling 
    GenScript: all cDNA clones in your preferred vector: MIA3 (NM_198551)
    DNA2.0 Custom Codon Optimized Gene Synthesis Service for MIA3
    Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat MIA3 
    Primer
    Products:
        
    OriGene genome-wide validated SYBR primer pairs in human, mouse, rat for MIA3
    Browse OriGene validated miRNA SYBR primer pairs
    SABiosciences RT2 qPCR Primer Assay in human, mouse, rat MIA3
      QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat MIA3
      QIAGEN QuantiFast Probe-based Assays in human, mouse, rat MIA3

    Additional cDNA sequence: 

    AK025122.1 AK025506.1 AK026489.1 AK096526.1 AK290335.1 AK296712.1 AK307412.1 AY359091.1 
    BC031805.1 BC047116.1 D87742.1 DQ166034.1 L34688.1 

    22 DOTS entries:

    DT.100030191  DT.100797779  DT.95238479  DT.40132318  DT.99942138  DT.121395400  DT.95165351  DT.100797778 
    DT.121395386  DT.118949  DT.91777140  DT.121395342  DT.121395352  DT.100797777  DT.95325611  DT.91777143 
    DT.91886157  DT.95165331  DT.95239479  DT.99941461  DT.102834231  DT.97797499 

    GeneLoc Exon Structure

    5/12 Alternative Splicing Database (ASD) splice patterns (SP) for MIA3 (see all 12)    About this scheme

    ExUns: 1 ^ 2 ^ 3 ^ 4 ^ 5 ^ 6 ^ 7 ^ 8a · 8b · 8c ^ 9a · 9b · 9c · 9d ^ 10 ^ 11 ^ 12 ^ 13 ^ 14 ^ 15a · 15b ^ 16 ^ 17a · 17b ^ 18 ^ 19a ·
    SP1:                                                                                                                                                            
    SP2:                                                                                                                                                            
    SP3:                                                                                                                                                            
    SP4:                    -     -     -           -     -     -                                                                                                   
    SP5:                                                                                                                                                            

    ExUns: 19b ^ 20 ^ 21 ^ 22 ^ 23a · 23b ^ 24 ^ 25 ^ 26 ^ 27 ^ 28a · 28b ^ 29
    SP1:                                                        -                     
    SP2:                                                        -                     
    SP3:                                                                              
    SP4:                                                                              
    SP5:                                                                              


    ECgene alternative splicing isoforms for MIA3

    (RNA expression data according to H-InvDB, NONCODE, miRBase, and RNAdb, Expression images according to data from BioGPS, Illumina Human BodyMap, and CGAP SAGE, Sets of similar genes according to GeneDecks, in vivo and in vitro expression data from LifeMap Discovery™, plus additional links to Genevestigator, and/or SOURCE, and/or BioGPS, and/or UniProtKB,
    PCR Arrays from SABiosciences, Primers from OriGene, SABiosciences, and/or QIAGEN, In Situ Hybridization Assays from Advanced Cell Diagnostics)
    About This Section

    MIA3 expression in normal human tissues (normalized intensities)
    See probesets specificity/sensitivity at GeneAnnot
    About this imageBioGPS
    CGAP TAG: TATTTCCATT

    Microarray
    RNAseq (Illumina Body Map)
    (100×FPKM)½
    SAGE (Serial Analysis of Gene Expression)

    About this image

    MIA3 expression in embryonic tissues and stem cells
    Expression by the Database of Embryonic development, Stem cell research, and Regenerative medicine    About this table
    2 LifeMap In Vivo Development Anatomical Compartments/Cells 
    Tissue Anatomical Compartment CellCategory (developmental path)
    KidneyCap MesenchymeCap Mesenchyme CellsKidney
    KidneyS-shaped BodyKidney
    Expression: Positive    Negative     Selective marker
    Experimental details: Curated     Microarrays     In-situ hybridization

    See MIA3 Protein Expression from SPIRE MOPED and PaxDB
    Genevestigator expression for MIA3

    SOURCE GeneReport for Unigene cluster: Hs.118474

    UniProtKB/Swiss-Prot: MIA3_HUMAN, Q5JRA6
    Tissue specificity: Broadly expressed, except in bone marrow and peripheral blood mononuclear cells. Down-regulated in
    melanoma tissue

        SABiosciences Custom PCR Arrays for MIA3
    Primer
    Products:
    OriGene genome-wide validated SYBR primer pairs in human, mouse, rat for MIA3
    Browse OriGene validated miRNA SYBR primer pairs
    SABiosciences RT2 qPCR Primer Assay in human, mouse, rat MIA3
    QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat MIA3
    QIAGEN QuantiFast Probe-based Assays in human, mouse, rat MIA3
    In Situ
    Assay Products:
     

     
    Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for MIA3

    (Orthologs according to 1,2HomoloGene (2older version, for species not in 1newer version), 3euGenes, 4SGD , 5MGI Mar 06 2013, with possible further links to Flybase and/or WormBase, and/or 6Ensembl pan taxonomic compara , Gene Trees according to Ensembl and TreeFam)
    About This Section

    This gene was present in the common ancestor of animals.

    Orthologs for MIA3 gene from 4/13 species (see all 13)    About this table
    Organism Taxonomic
    classification
    Gene Description Human
    Similarity
    Orthology
    Type
    Details
    chicken
    (Gallus gallus)
    Aves MIA31 melanoma inhibitory activity family, member 3 56.47(n)
    44.6(a)
      421337  XM_419399.3  XP_419399.3 
    lizard
    (Anolis carolinensis)
    Reptilia MIA36
    --
    38(a)
    1 ↔ 1
    1(244435473-244469048)
    zebrafish
    (Danio rerio)
    Actinopterygii mia31 melanoma inhibitory activity family, member 3 50.19(n)
    41.45(a)
      567041  XM_003200775.1  XP_003200823.1 
    fruit fly
    (Drosophila melanogaster)
    Insecta Tango16
    Transport and Golgi organization 1
    12(a)
    1 → many
    2L(6649388-6654574)


    ENSEMBL Gene Tree for MIA3 (if available)
    TreeFam Gene Tree for MIA3 (if available) 

    (Paralogs according to 1HomoloGene,
    2Ensembl, and 3SIMAP, Pseudogenes according to 4Pseudogene.org Build 68)
    About This Section
    Paralogs for MIA3 gene
    CTAGE42  CTAGE92  ENSG000002589412  CTAGE12  CTAGE52  CTAGE82  
    3 SIMAP similar genes for MIA3 using alignment to 4 protein entries:     MIA3_HUMAN (see all proteins):
    OTOR    MIA    CTAGE5

    MIA3 for paralogs           About GeneDecksing


    1 Pseudogenes.org Pseudogene for MIA3
    PGOHUM00000251382


    (SNPs/Variants according to the 1NCBI SNP Database, 2Ensembl, 3PupaSUITE, UniProtKB, and DNA2.0, Linkage Disequilibrium by HapMap, Structural Variations(CNVs/InDels/Inversions) from the Database of Genomic Variants, Mutations from the Human Gene Mutation Database (HGMD) and the Locus Specific Mutation Databases (LSDB), Blood group antigen gene mutations by BGMUT, Resequencing Primers from QIAGEN, Cancer Mutation PCR Arrays and Assays and Copy Number PCR Arrays from SABiosciences)
    About This Section

    10/783 NCBI SNPs in MIA3 are shown (see all 783    About this table
    Genomic DataTranscription Related DataAllele Frequencies
    SNP IDValidClinical
    significance
    Chr 1 posSequence#AA
    Chg
    TypeMore#Allele
    freq
    PopTotal
    sample
    More
    ----------
    rs781713781,2
    C,F,--222789458(+) AATGGT/CCTCAT 1 -- us2k11Minor allele frequency- C:0.02EA 120
    rs1394771901,2
    --222789491(+) TTATCA/GTTGTA 1 -- us2k10--------
    rs1160451121,2
    C,--222789714(+) AGAAAA/GAGATA 1 -- us2k11Minor allele frequency- G:0.01NA 120
    rs1496643201,2
    --222789850(+) TTGTCC/TGTGAC 1 -- us2k10--------
    rs1454393631,2
    --222789868(+) AATGTA/GTATTT 1 -- us2k10--------
    rs1457248911,2
    C,--222790001(+) CCACA-/TTCT  
            
    TTCTT
    1 -- us2k10--------
    rs731229001,2
    C,--222790020(+) TTTTAA/GGTAAT 1 -- us2k12Minor allele frequency- G:0.05WA 120
    rs670832681,2
    C,--222790141(+) CAGGG-/CTGGAGAGCAT
    TGTAGCCACTCTT
    CTGGA
    1 -- us2k10--------
    rs670505411,2
    C--222790143(+) CTTCT-/GGAGAGCATTG
    TAGCCACTCTTCT
    CTGGG
    1 -- us2k11Minor allele frequency- GGAGAGCATTGTAGCCACTCTTCT:0.00NA 2
    rs2022259521,2
    --222790163(+) ACTCT-/TCTCTGG 1 -- us2k10--------

    HapMap Linkage Disequilibrium report for MIA3 (222791428 - 222841354 bp)
    Structural Variations (Copy Number Variations, Insertions/Deletions, Inversions)
    Database of Genomic Variants (DGV): 1 variation for MIA3
         1 CNV: 97642
    Human Gene Mutation Database (HGMD): MIA3

    SABiosciences Cancer Mutation PCR Assays
    QIAGEN SeqTarget long-range PCR primers in human, mouse, rat for resequencing MIA3
    DNA2.0 Custom Variant and Variant Library Synthesis for MIA3

    (in which this Gene is Involved, According to MalaCards, OMIM, UniProtKB, the University of Copenhagen DISEASES database, Genatlas, GeneTests, GAD, HuGE Navigator, and/or TGDB.)
    About This Section

    MIA3 for disorders           About GeneDecksing

    OMIM gene information: 613455    OMIM disorders: --

    12 diseases for MIA3:    About MalaCards
    melanoma    coronary heart disease    macular degeneration    myocardial infarction
    gigantism    nephropathy    pertussis    hepatocellular carcinoma
    meningioma    atherosclerosis    ataxia    carcinoma

    Human Genome Epidemiology (HuGE) Navigator: MIA3 (9 documents)

    Export disorders for MIA3 gene to outside databases

    (in PubMed. Associations of this gene to articles via 1Entrez Gene, 2UniProtKB/Swiss-Prot, 3HGNC, 4GAD, 5PharmGKB, 6HMDB, 7DrugBank, 8UniProtKB/TrEMBL, 9 Novoseek, and/or 10fRNAdb)
    About This Section

    PubMed articles for MIA3 gene, integrated from 9 sources (see all 37):
    (articles sorted by number of sources associating them with MIA3)
        Utopia: connect your pdf to the dynamic
    world of online information

    1. Characterization and expression pattern of the novel MIA homolog TANGO. (PubMed id 15183315)1, 2, 3 Bosserhoff A.K.... Buettner R. (2004)
    2. TANGO1 facilitates cargo loading at endoplasmic reticulum exit sites. (PubMed id 19269366)1, 2 Saito K.... Malhotra V. (2009)
    3. TANGO is a tumor suppressor of malignant melanoma. (PubMed id 17044017)1, 2 Arndt S. and Bosserhoff A.K. (2006)
    4. Complete sequencing and characterization of 21,243 full-length human cDNAs. (PubMed id 14702039)1, 2 Ota T.... Sugano S. (2004)
    5. The secreted protein discovery initiative (SPDI), a large-scale effort to identify novel human secreted and transmembrane proteins: a bioinformatics assessment. (PubMed id 12975309)1, 2 Clark H.F.... Gray A.M. (2003)
    6. Prediction of the coding sequences of unidentified human genes. VI. The coding sequences of 80 new genes (KIAA0201-KIAA0280) deduced by analysis of cDNA clones from cell line KG-1 and brain. (PubMed id 9039502)1, 2 Nagase T....Nomura N. (1996)
    7. Analysis of a novel cDNA encoding a C219-reactive peptide isolated from methotrexate-selected multidrug-resistant human leukemic cells. (PubMed id 7758977)2, 9 Norris M.D.... Haber M. (1995)
    8. Association study of MIA3 rs17465637 polymorphism with cardiovascular disease in rheumatoid arthritis patients. (PubMed id 22577832)1 Garcia-Bermudez M....Gonzalez-Gay M.A. (2012)
    9. MINOS1 is a conserved component of mitofilin complexe s and required for mitochondrial function and cristae organization. (PubMed id 22114354)1 Alkhaja A.K....Deckers M. (2012)
    10. Initial characterization of the human central proteome. (PubMed id 21269460)2 Burkard T.R.... Colinge J. (2011)

    (in PubMed, OMIM, and NCBI Bookshelf)
    About This Section
     ANDOR
    Aliases
    Free Text  

      Query String
    PubMed
    OMIM
    NCBI Bookshelf
      (Note: In FireFox, select the above section and copy using Ctrl-C)

    (According to Entrez Gene, HGNC, AceView, euGenes, Ensembl, miRBase, ECgene, Kegg, and/or H-InvDB)
    About This Section
    Entrez Gene: 375056 HGNC: 24008 Ensembl:ENSG00000154305 euGenes: HUgn375056 ECgene: MIA3
    H-InvDB: MIA3

    (According to HUGE)
    About This Section
    HUGE: KIAA0268

    (According to PharmGKB, ATLAS, HORDE, IMGT, LEIDEN, UniProtKB/Swiss-Prot, and/or UniProtKB/TrEMBL,
    Wikipedia and/or GeneReviews via UniProtKB/Swiss-Prot)
    About This Section
    NameDescription
    PharmGKB entry for MIA3 Pharmacogenomics, SNPs, Pathways

    (Patent information from GeneIP,
    Licensable technologies from WIS Yeda, Salk, Tufts,
    IP news from LifeMap Sciences, Inc.)
    About This Section
    Patent Information for MIA3 gene:
    Search GeneIP for patents involving MIA3

    GeneCards and IP:
    Japan Patent Office Licenses GeneCards     European Patent Office Licenses GeneCards     Improving the IP Search



    (Antibodies, recombinant proteins, and assays from EMD Millipore, R&D Systems, OriGene, QIAGEN, GenScript, Cell Signaling Technology, SABiosciences, Novus Biologicals, Sino Biological, Enzo Life Sciences, Abcam, ProSpec, Uscn, Thermo Fisher Scientific, Gene Editing from DNA2.0, Clones from EMD Millipore, OriGene, GenScript, Sino Biological, DNA2.0, SwitchGear Genomics, Vector BioLabs, Cell lines from GenScript and LifeMap BioReagents, PCR Arrays from SABiosciences, Drugs and/or compounds from EMD Millipore, Tocris Bioscience, and/or Enzo Life Sciences),
    In Situ Hybridization Assays from
    Advanced Cell Diagnostics
    About This Section

     
     EMD Millipore Custom Antibody & Bulk Services
     EMD Millipore Preclinical / Clinical Development Services
     EMD Millipore Immunoassay Services
     EMD Millipore Target Screening & Profiling Services

      
     Browse Antibodies   Browse Cell Culture Products  
     Browse ELISAs   Browse Flow Cytometry Kits  
     Browse Primer Pairs   Browse Kinase Activity Assays/Reagents  
     Browse ELISpot Kits/Development Modules   Browse TFB/Immunoprecipitation Assays  
     Browse Apoptosis Detection Kits/Reagents   Browse Ubiquitin Proteasome Pathway (UPP) Assay Kits/Reagents  
     Browse DNA Damage/Repair Kits/Reagents   Browse Multiplex/Array Assay Kits/Reagents  
     Browse Cell Selection/Detection Kits/Reagents   Browse Secondary Antibodies/Controls/Staining Reagents  
     Browse Phosphatase Activity Assays/Reagents   Browse Recombinant/Natural Proteins  
     OriGene Antibodies for MIA3   OriGene shRNA RFP for MIA3  
     OriGene 29mer shRNA kits in GFP-retroviral vector in human, mouse, rat for MIA3   OriGene genome-wide validated SYBR primer pairs in human, mouse, rat for MIA3  
     Browse OriGene Protein Over-expression Lysates   Browse OriGene Fluorogenic Cell Assay Kits  
     OriGene siRNA for MIA3   OriGene 3'-UTR Clone for MIA3  
     OriGene untagged cDNA clones in CMV expression vector in human, mouse, rat for MIA3   OriGene Myc/DDK tagged cDNA clones in CMV expression vector in human, mouse, rat for MIA3  
     Browse OriGene GFP tagged cDNA clones in CMV expression vector   Browse OriGene MicroRNA Expression Plasmids  
     Browse OriGene basic RS shRNAs   Browse OriGene validated miRNA SYBR primer pairs  
     Browse OriGene full length recombinant human proteins expressed in human HEK293 cells   OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling  
     OriGene Custom Antibody Services for MIA3   OriGene Custom Protein Services for MIA3  
     OriGene Custom Immunoassay Development  

     
     
     QIAGEN Custom miScript Target Protector blocks miRNA-binding site of in human, mouse, rat MIA3
     QIAGEN SeqTarget long-range PCR primers in human, mouse, rat for resequencing MIA3
     QIAGEN PyroMark CpG Assay predesigned Pyrosequencing DNA Methylation assays in human, mouse, rat MIA3
     QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat MIA3
     QIAGEN QuantiFast Probe-based Assays in human, mouse, rat MIA3
     QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat MIA3
     GenScript Custom Purified and Recombinant Proteins Services for MIA3 GenScript cDNA clones with any tag delivered in your preferred vector for MIA3
     GenScript Custom Assay Services for MIA3 GenScript Custom Superior Antibodies Services for MIA3
     GenScript Custom overexpressing Cell Line Services for MIA3 CloneReady with Over 120,000 Genes
     Gene Synthesis: Any Gene in Any Vector Vector-based siRNA and miRNA, Ready for Transfection
     Gene Mutant Library, Variants up to 10^11 Plasmid Preparation
     Custom Peptide Services
     Search for Antibodies & Assays

     Search Regulatory tfbs for MIA3
     Search Chromatin IP Primers for MIA3
     RT2 qPCR Primer Assay in human, mouse, rat MIA3
     Search GNC Networks for MIA3
     SABiosciences Custom PCR Arrays for MIA3
     Search Tocris compounds for MIA3
     Browse Sino Biological Proteins and Antibodies
     Browse Sino Biological cDNA Clones
     Antibodies/Proteins Production Services
     Rabbit Monoclonal Antibody Platform
     Bulk Purchasing
     Search www.enzolifesciences.com for proteins, assays, substrates, inhibitors & antibodies
     Novus Biologicals
     Novus Tissue Slides
     Search for Antibodies for MIA3 at Abcam
     See all of Abcam's Antibodies, Kits and Proteins for MIA3
     Custom Antibody / Protein Production Service
     Bulk Purchasing
     Advantages of Rabbit Monoclonal antibodies
     Abcam protocols and scientific support
     Browse ProSpec Recombinant Proteins




     MIA3 Proteins, Antibodies, CLIAs, and ELISAs
     Search LifeMap BioReagents cell lines for MIA3
     Gene Synthesis
     Protein Engineering
     Variant Library Synthesis
     Codon Optimization
     Protein Production and Purification
     Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for MIA3
     SwitchGear 3'UTR luciferase reporter plasmids for MIA3
     SwitchGear Promoter luciferase reporter plasmids for MIA3
     ThermoFisher Antibody for MIA3
     Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat MIA3
           
    GeneCards Homepage - Last full update: 19 Mar 2013 - Incrementals: 21 Mar 2013 , 15 Apr 2013 , 26 Apr 2013

    View Random Gene

    Category
    VWF
    (GIFTS: 73)
    von Willebrand factor
    GIFtS Group
    The GeneCards human gene database gene index: 1 3 5 6 A B C D E F G H I J K L M N O P Q R S T U V W X Y Z 


    Developed at the Crown Human Genome Center, Department of Molecular Genetics, the Weizmann Institute of Science

    Hot genes      Disease genes      MIA3 gene at Home site.
    hostname: 356980-web2.xennexinc.com index build: 100 solr: 1.4