Free for academic non-profit institutions. Other users need a Commercial license

Aliases for METTL23 Gene

Aliases for METTL23 Gene

  • Methyltransferase Like 23 2 3 5
  • C17orf95 3 4
  • Chromosome 17 Open Reading Frame 95 2
  • Methyltransferase-Like Protein 23 3
  • EC 2.1.1.- 4
  • MRT44 3

External Ids for METTL23 Gene

Previous HGNC Symbols for METTL23 Gene

  • C17orf95

Previous GeneCards Identifiers for METTL23 Gene

  • GC17P074723

Summaries for METTL23 Gene

Entrez Gene Summary for METTL23 Gene

  • The protein encoded by this gene functions as a transcription factor regulator in the transcriptional pathway for human cognition. It is a partner of the alpha subunit of the GA-binding protein transcription factor. Mutations in this gene cause mild autosomal recessive intellectual disability. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2014]

GeneCards Summary for METTL23 Gene

METTL23 (Methyltransferase Like 23) is a Protein Coding gene. Diseases associated with METTL23 include Mental Retardation, Autosomal Recessive 44 and Autosomal Recessive Non-Syndromic Intellectual Disability. Gene Ontology (GO) annotations related to this gene include methyltransferase activity. An important paralog of this gene is ENSG00000267168.

UniProtKB/Swiss-Prot for METTL23 Gene

  • Probable methyltransferase.

Additional gene information for METTL23 Gene

No data available for CIViC summary , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for METTL23 Gene

Genomics for METTL23 Gene

GeneHancer (GH) Regulatory Elements for METTL23 Gene

Promoters and enhancers for METTL23 Gene
GeneHancer (GH) Identifier GH Type GH
GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites
Gene Targets
GH17I076733 Promoter/Enhancer 3 UCNEbase EPDnew Ensembl ENCODE dbSUPER 56 +11.4 11386 7.8 CLOCK ZFP64 FEZF1 DMAP1 IRF4 YY1 SLC30A9 E2F8 ZNF143 ZNF548 SRSF2 MFSD11 MIR636 UNK ENSG00000267342 TRIM65 ENSG00000266980 SEPT9 ENSG00000267546 METTL23
GH17I076258 Promoter/Enhancer 2.8 EPDnew FANTOM5 Ensembl ENCODE dbSUPER 38.8 -457.9 -457898 19.6 CLOCK DMAP1 IRF4 YY1 ZNF213 E2F8 ZNF143 SP3 NFYC ZC3H11A UBALD2 UNK ENSG00000267342 SRSF2 TRIM65 ENSG00000266980 ENSG00000267546 METTL23 MFSD11 EXOC7
GH17I075776 Promoter/Enhancer 2.7 UCNEbase EPDnew Ensembl ENCODE dbSUPER 36.6 -947.3 -947347 4.9 CLOCK MLX ZFP64 DMAP1 IRF4 YY1 SLC30A9 ZNF213 E2F8 ZNF143 H3F3B GC17M075778 GC17P075777 UNK NT5C SRSF2 NUP85 ENSG00000266980 GGA3 METTL23
GH17I076669 Promoter/Enhancer 1.8 Ensembl ENCODE dbSUPER 49.6 -53.6 -53624 4.6 CLOCK MLX ZFP64 FEZF1 DMAP1 IRF4 YY1 SLC30A9 ZNF213 ZNF143 GC17M076671 LOC105274304 UNK SRSF2 METTL23 ENSG00000267342 ENSG00000266980 MXRA7 MFSD11 SRP68
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data dump

GeneHancers around METTL23 on UCSC Golden Path with GeneCards custom track

Genomic Locations for METTL23 Gene

Genomic Locations for METTL23 Gene
8,064 bases
Plus strand

Genomic View for METTL23 Gene

Genes around METTL23 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
METTL23 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for METTL23 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for METTL23 Gene

Proteins for METTL23 Gene

  • Protein details for METTL23 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Recommended name:
    Methyltransferase-like protein 23
    Protein Accession:
    Secondary Accessions:
    • H9ZYJ0
    • K7EK32

    Protein attributes for METTL23 Gene

    190 amino acids
    Molecular mass:
    21469 Da
    Quaternary structure:
    • Interacts with HSPA5, HSP90B1, TUBULIN, UGGT1 and UGGT2.
    • Sequence=AAH45819.1; Type=Erroneous initiation; Note=Translation N-terminally shortened.; Evidence={ECO:0000305};

    Alternative splice isoforms for METTL23 Gene


neXtProt entry for METTL23 Gene

Post-translational modifications for METTL23 Gene

No Post-translational modifications

No data available for DME Specific Peptides for METTL23 Gene

Domains & Families for METTL23 Gene

Gene Families for METTL23 Gene

Human Protein Atlas (HPA):
  • Disease related genes
  • Predicted intracellular proteins

Protein Domains for METTL23 Gene

Suggested Antigen Peptide Sequences for METTL23 Gene

Graphical View of Domain Structure for InterPro Entry



  • Belongs to the methyltransferase superfamily. METTL23 family.
  • Belongs to the methyltransferase superfamily. METTL23 family.
genes like me logo Genes that share domains with METTL23: view

Function for METTL23 Gene

Molecular function for METTL23 Gene

UniProtKB/Swiss-Prot Function:
Probable methyltransferase.

Enzyme Numbers (IUBMB) for METTL23 Gene

Phenotypes From GWAS Catalog for METTL23 Gene

Gene Ontology (GO) - Molecular Function for METTL23 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005515 protein binding IPI 23349634
GO:0008134 transcription factor binding IPI 24501276
GO:0008168 methyltransferase activity IEA --
GO:0016740 transferase activity IEA --
GO:0031072 heat shock protein binding IPI 23349634
genes like me logo Genes that share ontologies with METTL23: view

Phenotypes for METTL23 Gene

GenomeRNAi human phenotypes for METTL23:
genes like me logo Genes that share phenotypes with METTL23: view

Human Phenotype Ontology for METTL23 Gene

HPO Id HPO Name Alternative Ids Definition Synonyms

Animal Model Products

CRISPR Products

miRNA for METTL23 Gene

miRTarBase miRNAs that target METTL23

Inhibitory RNA Products

Clone Products

No data available for Animal Models , Transcription Factor Targets and HOMER Transcription for METTL23 Gene

Localization for METTL23 Gene

Subcellular locations from UniProtKB/Swiss-Prot for METTL23 Gene

Cytoplasm. Membrane; Single-pass membrane protein. Note=When overexpressed, detected in cytoplasmic membrane-like structures.

Subcellular locations from

Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for METTL23 gene
Compartment Confidence
nucleus 5
extracellular 2
mitochondrion 1
peroxisome 1
cytosol 1

Gene Ontology (GO) - Cellular Components for METTL23 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005634 nucleus IDA 24501276
GO:0005737 cytoplasm IDA,IEA 23349634
GO:0016020 membrane IEA --
GO:0016021 integral component of membrane IEA --
GO:0043234 protein complex IDA 23349634
genes like me logo Genes that share ontologies with METTL23: view

No data available for Subcellular locations from the Human Protein Atlas (HPA) for METTL23 Gene

Pathways & Interactions for METTL23 Gene

SuperPathways for METTL23 Gene

No Data Available

Interacting Proteins for METTL23 Gene

Gene Ontology (GO) - Biological Process for METTL23 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0032259 methylation IEA --
GO:0045944 positive regulation of transcription by RNA polymerase II IMP 24501276
GO:0050890 cognition IMP 24501276
genes like me logo Genes that share ontologies with METTL23: view

No data available for Pathways by source and SIGNOR curated interactions for METTL23 Gene

Drugs & Compounds for METTL23 Gene

No Compound Related Data Available

Transcripts for METTL23 Gene

Unigene Clusters for METTL23 Gene

Methyltransferase like 23:
Representative Sequences:

CRISPR Products

Inhibitory RNA Products

Clone Products

Alternative Splicing Database (ASD) splice patterns (SP) for METTL23 Gene

ExUns: 1a · 1b · 1c · 1d · 1e ^ 2a · 2b · 2c · 2d · 2e · 2f · 2g ^ 3a · 3b ^ 4a · 4b · 4c · 4d ^ 5a · 5b · 5c ^ 6a · 6b · 6c · 6d · 6e ·
SP1: - - - - - - - - - -
SP2: - - - - -
SP3: - - - -
SP4: - - - - - - - -
SP5: - - - - - - -
SP6: - - - - - -
SP7: - - - -
SP8: - - - - - - - - - -
SP9: - -
SP10: - - - - - - - - - -
SP11: - - - -
SP12: - -

ExUns: 6f · 6g · 6h

Relevant External Links for METTL23 Gene

GeneLoc Exon Structure for
ECgene alternative splicing isoforms for

Expression for METTL23 Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for METTL23 Gene

Protein differential expression in normal tissues from HIPED for METTL23 Gene

This gene is overexpressed in Liver, secretome (69.0).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, PaxDb, and MOPED for METTL23 Gene

Protein tissue co-expression partners for METTL23 Gene

- Elite partner

NURSA nuclear receptor signaling pathways regulating expression of METTL23 Gene:


SOURCE GeneReport for Unigene cluster for METTL23 Gene:


Phenotype-based relationships between genes and organs from Gene ORGANizer for METTL23 Gene

Germ Layers:
  • ectoderm
  • endoderm
  • mesoderm
  • cardiovascular
  • integumentary
  • nervous
  • respiratory
  • skeletal muscle
  • skeleton
Head and neck:
  • brain
  • cerebellum
  • cheek
  • chin
  • cranial nerve
  • ear
  • eye
  • eyelid
  • face
  • forehead
  • head
  • jaw
  • lip
  • mandible
  • maxilla
  • mouth
  • neck
  • nose
  • outer ear
  • pharynx
  • skull
  • tooth
  • chest wall
  • heart
  • abdominal wall
  • foot
  • lower limb
  • blood vessel
  • hair
  • peripheral nerve
  • peripheral nervous system
  • skin
  • spinal column
  • spinal cord
genes like me logo Genes that share expression patterns with METTL23: view

Primer Products

No data available for mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , mRNA differential expression in normal tissues , mRNA Expression by UniProt/SwissProt and Evidence on tissue expression from TISSUES for METTL23 Gene

Orthologs for METTL23 Gene

This gene was present in the common ancestor of eukaryotes.

Orthologs for METTL23 Gene

Organism Taxonomy Gene Similarity Type Details
(Pan troglodytes)
Mammalia METTL23 33
  • 99.47 (n)
C17ORF95 34
  • 64 (a)
(Canis familiaris)
Mammalia METTL23 33 34
  • 90.18 (n)
(Bos Taurus)
Mammalia METTL23 33 34
  • 89.47 (n)
(Mus musculus)
Mammalia Mettl23 16 34 33
  • 85.96 (n)
(Rattus norvegicus)
Mammalia Mettl23 33
  • 85.71 (n)
(Monodelphis domestica)
Mammalia -- 34
  • 61 (a)
(Ornithorhynchus anatinus)
Mammalia -- 34
  • 57 (a)
(Gallus gallus)
Aves METTL23 33
  • 71.84 (n)
-- 34
  • 58 (a)
(Anolis carolinensis)
Reptilia -- 34
  • 51 (a)
tropical clawed frog
(Silurana tropicalis)
Amphibia mettl23 33
  • 66.84 (n)
(Danio rerio)
Actinopterygii si:ch73-366l1.2 33
  • 63.64 (n)
METTL23 34
  • 52 (a)
fruit fly
(Drosophila melanogaster)
Insecta CG5013 33 34
  • 55.37 (n)
African malaria mosquito
(Anopheles gambiae)
Insecta AgaP_AGAP001222 33
  • 51.28 (n)
thale cress
(Arabidopsis thaliana)
eudicotyledons AT1G63855 33
  • 53.39 (n)
(Oryza sativa)
Liliopsida Os02g0120300 33
  • 54.03 (n)
Species where no ortholog for METTL23 was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea squirt (Ciona intestinalis)
  • sea squirt (Ciona savignyi)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)
  • worm (Caenorhabditis elegans)

Evolution for METTL23 Gene

Gene Tree for METTL23 (if available)
Gene Tree for METTL23 (if available)

Paralogs for METTL23 Gene

Paralogs for METTL23 Gene

(1) SIMAP similar genes for METTL23 Gene using alignment to 10 proteins:

genes like me logo Genes that share paralogs with METTL23: view

Variants for METTL23 Gene

Sequence variations from dbSNP and Humsavar for METTL23 Gene

SNP ID Clin Chr 17 pos Variation AA Info Type
rs587777644 pathogenic, Mental retardation, autosomal recessive 44 76,733,060(+) CTCACT/CT 5_prime_UTR_variant, coding_sequence_variant, frameshift, intron_variant
rs587777645 pathogenic, Mental retardation, autosomal recessive 44 76,733,174(+) AAGATA/A coding_sequence_variant, frameshift, intron_variant
rs587777646 pathogenic, Mental retardation, autosomal recessive 44 76,733,367(+) C/T coding_sequence_variant, non_coding_transcript_variant, stop_gained
rs1057521913 likely-pathogenic, not provided 76,733,378(+) G/C coding_sequence_variant, missense_variant, splice_donor_variant
rs757197161 likely-pathogenic, not provided 76,733,649(+) AAATGCTGGT/AAATGCTGGTAAATGCTGGT 3_prime_UTR_variant, coding_sequence_variant, frameshift, non_coding_transcript_variant

Structural Variations from Database of Genomic Variants (DGV) for METTL23 Gene

Variant ID Type Subtype PubMed ID
nsv1110921 OTHER inversion 24896259
nsv1130707 CNV deletion 24896259
nsv833550 CNV loss 17160897

Variation tolerance for METTL23 Gene

Residual Variation Intolerance Score: 52.3% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 1.79; 33.74% of all genes are more intolerant (likely to be disease-causing)

Additional Variant Information for METTL23 Gene

Human Gene Mutation Database (HGMD)
SNPedia medical, phenotypic, and genealogical associations of SNPs for

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for METTL23 Gene

Disorders for METTL23 Gene

MalaCards: The human disease database

(2) MalaCards diseases for METTL23 Gene - From: HGMD, OMIM, ClinVar, GTR, Orphanet, and GeneCards

Disorder Aliases PubMed IDs
mental retardation, autosomal recessive 44
  • mrt44
autosomal recessive non-syndromic intellectual disability
  • autosomal recessive mental retardation
- elite association - COSMIC cancer census association via MalaCards


  • Mental retardation, autosomal recessive 44 (MRT44) [MIM:615942]: A disorder characterized by significantly below average general intellectual functioning associated with impairments in adaptive behavior and manifested during the developmental period. MRT44 manifestations include mild to severe cognitive impairment, delayed psychomotor development, seizures in some patients, and dysmorphic features. {ECO:0000269 PubMed:24501276, ECO:0000269 PubMed:24626631}. Note=The disease is caused by mutations affecting the gene represented in this entry.

Additional Disease Information for METTL23

genes like me logo Genes that share disorders with METTL23: view

No data available for Genatlas for METTL23 Gene

Publications for METTL23 Gene

  1. METTL23, a transcriptional partner of GABPA, is essential for human cognition. (PMID: 24501276) Reiff RE … Mochida GH (Human molecular genetics 2014) 2 3 4 58
  2. Disruption of the methyltransferase-like 23 gene METTL23 causes mild autosomal recessive intellectual disability. (PMID: 24626631) Bernkopf M … Duba HC (Human molecular genetics 2014) 3 4 58
  3. A newly uncovered group of distantly related lysine methyltransferases preferentially interact with molecular chaperones to regulate their activity. (PMID: 23349634) Cloutier P … Coulombe B (PLoS genetics 2013) 3 4 58
  4. A directed protein interaction network for investigating intracellular signal transduction. (PMID: 21900206) Vinayagam A … Wanker EE (Science signaling 2011) 3 58
  5. Diversification of transcriptional modulation: large-scale identification and characterization of putative alternative promoters of human genes. (PMID: 16344560) Kimura K … Sugano S (Genome research 2006) 3 58

Products for METTL23 Gene

Sources for METTL23 Gene

Loading form....