Set Analyses:
Advanced Search

Advanced Search

 
Search By
Section (entire)
for


 



METTL21C Gene

protein-coding   GIFtS: 40
GCID: GC13M103339

Methyltransferase Like 21C

(Previous name: chromosome 13 open reading frame 39)
(Previous symbol: C13orf39)
  Search for METTL21C
at  

(According to 1HGNC, 2Entrez Gene,
3UniProtKB/Swiss-Prot, 4UniProtKB/TrEMBL, 5OMIM, 6GeneLoc, 7Ensembl, 8DME, 9miRBase, 10fRNAdb, 12H-InvDB, 13NCBI, 14NONCODE, and/or 15RNAdb)
About This Section

TryGeneCards Plus

Aliases
Methyltransferase Like 21C1 2
C13orf391 2 3 5
Methyltransferase-Like Protein 21C2 3
Chromosome 13 Open Reading Frame 391
Protein-Lysine Methyltransferase METTL21C2
EC 2.1.1.-3

External Ids:    HGNC: 337171   Entrez Gene: 1965412   Ensembl: ENSG000001397807   OMIM: 6152595   UniProtKB: Q5VZV13   

Export aliases for METTL21C gene to outside databases


(According to Entrez Gene, GeneCards, Tocris Bioscience, Wikipedia's Gene Wiki, PharmGKB,
UniProtKB/Swiss-Prot, and/or UniProtKB/TrEMBL)
About This Section

TryGeneCards Plus

GeneCards Summary for METTL21C Gene:
METTL21C (methyltransferase like 21C) is a protein-coding gene. GO annotations related to this gene include protein-lysine N-methyltransferase activity. An important paralog of this gene is METTL21B.

UniProtKB/Swiss-Prot: MT21C_HUMAN, Q5VZV1
Function: Protein-lysine methyltransferase




(According to GeneLoc and/or HGNC, and/or
Entrez Gene (NCBI build 37),
and/or miRBase,
Genomic Views according to UCSC (hg19) and Ensembl (release 75), Regulatory elements and Epigenetics data according to QIAGEN, and/or SwitchGear Genomics)
About This Section

TryGeneCards Plus
RefSeq DNA sequence:
NC_000013.11  NC_018924.2  NT_009952.15  
Regulatory elements:
   Search for regulatory transcription factor binding sites for METTL21C
         Other transcription factors

Browse SwitchGear Promoter luciferase reporter plasmids
   Search Chromatin IP Primers for METTL21C

Epigenetics:
DNA Methylation CpG Assay Predesigned for Pyrosequencing in human, mouse, rat METTL21C


Genomic Location:
Genomic View: UCSC Golden Path with GeneCards custom track

Entrez Gene cytogenetic band: 13q33.1   Ensembl cytogenetic band:  13q33.1   HGNC cytogenetic band: 13q33.1

METTL21C Gene in genomic location: bands according to Ensembl, locations according to (and/or Entrez Gene and/or Ensembl if different)
METTL21C gene location

GeneLoc information about chromosome 13         GeneLoc Exon Structure

GeneLoc location for GC13M103339:  view genomic region     (about GC identifiers)

Start:
103,338,094 bp from pter      End:
103,346,854 bp from pter
Size:
8,761 bases      Orientation:
minus strand

(According to 1UniProtKB, HORDE, 2neXtProt, Ensembl, and/or Reactome, Modification sites according to PhosphoSitePlus, Specific Peptides from DME, RefSeq according to NCBI, PDB rendering according to OCA and/or Proteopedia, Recombinant Proteins from EMD Millipore, R&D Systems, GenScript, Enzo Life Sciences, OriGene, Novus Biologicals, Sino Biological, ProSpec, and/or Cloud-Clone Corp.,
Biochemical Assays by EMD Millipore, R&D Systems, OriGene, GenScript, Cell Signaling Technology, Enzo Life Sciences, and/or Cloud-Clone Corp., Antibodies by EMD Millipore, R&D Systems, Cell Signaling Technology, OriGene, Novus Biologicals, Thermo Fisher Scientific, LSBio, Abcam, Cloud-Clone Corp, and/or others.)
About This Section

TryGeneCards Plus

UniProtKB/Swiss-Prot: MT21C_HUMAN, Q5VZV1 (See protein sequence)
Recommended Name: Protein-lysine methyltransferase METTL21C  
Size: 264 amino acids; 29565 Da
Subunit: Interacts with members of the heat shock protein 70 families; these proteins may possibly be methylation
substrates for the enzyme (PubMed:23349634)
1 PDB 3D structure from and Proteopedia for METTL21C:
4MTL (3D)    

Explore the universe of human proteins at neXtProt for METTL21C: NX_Q5VZV1

Explore proteomics data for METTL21C at MOPED


See METTL21C Protein Expression from SPIRE MOPED, PaxDB, and MaxQB

REFSEQ proteins: NP_001010977.1  
ENSEMBL proteins: 
 ENSP00000267273  

METTL21C Human Recombinant Protein Products:

Browse Purified and Recombinant Proteins at EMD Millipore
Browse R&D Systems for human recombinant proteins
Browse recombinant and purified proteins available from Enzo Life Sciences
OriGene Purified Protein for METTL21C
OriGene Protein Over-expression Lysate for METTL21C
OriGene MassSpec for METTL21C
OriGene Custom Protein Services for METTL21C
GenScript Custom Purified and Recombinant Proteins Services for METTL21C
Novus Biologicals METTL21C Protein
Novus Biologicals METTL21C Lysates
Browse Sino Biological Recombinant Proteins
Browse Sino Biological Cell Lysates
Browse ProSpec Recombinant Proteins
Cloud-Clone Corp. Proteins for METTL21C

METTL21C Antibody Products:

Browse EMD Millipore's Extensive Line of Mono- and Polyclonal Antibodies
Browse R&D Systems for Antibodies
Browse OriGene Antibodies
OriGene Custom Antibody Services for METTL21C
Novus Biologicals METTL21C Antibodies
Abcam antibodies for METTL21C
Cloud-Clone Corp. Antibodies for METTL21C
Search ThermoFisher Antibodies for METTL21C
LSBio Antibodies in human, mouse, rat for METTL21C

METTL21C Assay Products:

Browse Kits and Assays available from EMD Millipore
OriGene Custom Assay Services for METTL21C
Browse R&D Systems for biochemical assays
GenScript Custom Assay Services for METTL21C
Browse Enzo Life Sciences for kits & assays
Cloud-Clone Corp. ELISAs for METTL21C
Cloud-Clone Corp. CLIAs for METTL21C


(According to HGNC, IUPHAR, InterPro, ProtoNet, UniProtKB, and/or BLOCKS, Sets of similar genes according to GeneDecks)
About This Section

TryGeneCards Plus
1 InterPro protein domain:
 IPR019410 Nicotinamide_N-MeTfrase-like

Graphical View of Domain Structure for InterPro Entry Q5VZV1

ProtoNet protein and cluster: Q5VZV1

UniProtKB/Swiss-Prot: MT21C_HUMAN, Q5VZV1
Similarity: Belongs to the methyltransferase superfamily. METTL21 family


METTL21C for domains           About GeneDecksing


(According to 1UniProtKB, Genatlas, LifeMap Discovery™, IUBMB, and/or 2DME, Human phenotypes from GenomeRNAi, Animal models from MGI Mar 06 2013, inGenious Targeting Laboratory, genOway,
transcription factor targeting from QIAGEN and/or HOMER, miRNA Gene Targets from miRTarBase, shRNA from OriGene, siRNAs from OriGene, QIAGEN, microRNA from QIAGEN, SwitchGear Genomics, Gene Editing from DNA2.0, Clones from OriGene, GenScript, Sino Biological, DNA2.0, and Vector BioLabs, Cell Lines from GenScript, ESI BIO, In Situ Hybridization Assays from Advanced Cell Diagnostics, Ontologies according to Gene Ontology Consortium 01 Apr 2014 via Entrez Gene.)
About This Section

TryGeneCards Plus

Molecular Function:

     UniProtKB/Swiss-Prot Summary: MT21C_HUMAN, Q5VZV1
Function: Protein-lysine methyltransferase

     Enzyme Number (IUBMB): EC 2.1.1.-1

     Gene Ontology (GO): 1 molecular function term:    About this table

GO IDQualified GO termEvidencePubMed IDs
GO:0016279protein-lysine N-methyltransferase activity IDA--
     
METTL21C for ontologies           About GeneDecksing


Animal Models:
   inGenious Targeting Laboratory: Let us create your new Knockout/Knockin mouse model for METTL21C
   inGenious Targeting Laboratory: Contact us about creating complex and humanized mouse models for METTL21C

   genOway customized KO model: permanent, tissue-specific or time-controlled inactivation for METTL21C
   genOway customized Knockin model: humanization, point mutation, expression monitoring, etc. for METTL21C

miRNA
Products:
    
Block miRNA regulation of human, mouse, rat METTL21C using miScript Target Protectors
Search for qRT-PCR Assays for microRNAs that regulate METTL21C
SwitchGear 3'UTR luciferase reporter plasmidMETTL21C 3' UTR sequence
Inhib. RNA
Products:
    
OriGene RNAi products in human, mouse, rat for METTL21C
Predesigned siRNA for gene silencing in human, mouse, rat METTL21C

Gene Editing
Products:
DNA2.0 Custom Protein Engineering Service for METTL21C

Clone
Products:
     
OriGene clones in human, mouse for METTL21C (see all 5)
OriGene ORF clones in mouse, rat for METTL21C
OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
GenScript: all cDNA clones in your preferred vector: METTL21C (NM_001010977)
Browse Sino Biological Human cDNA Clones
DNA2.0 Custom Codon Optimized Gene Synthesis Service for METTL21C
Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat METTL21C

Cell Line
Products:
     
GenScript Custom overexpressing Cell Line Services for METTL21C
Browse ESI BIO Cell Lines and PureStem Progenitors for METTL21C 
In Situ Assay
Products:
   

 
Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for METTL21C


(According to UniProtKB, COMPARTMENTS Subcellular localization database, Ontologies according to Gene Ontology Consortium 01 Apr 2014 via Entrez Gene.)
About This Section

TryGeneCards Plus

Subcellular locations from UniProtKB/Swiss-Prot
MT21C_HUMAN, Q5VZV1: Nucleus

Gene Ontology (GO): 1 cellular component term:    About this table

GO IDQualified GO termEvidencePubMed IDs
GO:0005634nucleus IEA--

METTL21C for ontologies           About GeneDecksing


(SuperPaths according to PathCards, Pathways according to R&D Systems, Cell Signaling Technology, KEGG, PharmGKB, BioSystems, Sino Biological, Reactome, Tocris Bioscience, GeneGo (Thomson Reuters), QIAGEN, and/or UniProtKB, Sets of similar genes according to GeneDecks, Interaction Networks according to QIAGEN, and/or STRING, Interactions according to 1UniProtKB, 2MINT, 3I2D, and/or 4STRING, with links to IntAct and Ensembl, Ontologies according to Gene Ontology Consortium 01 Apr 2014 via Entrez Gene).
About This Section

TryGeneCards Plus



    Custom Pathway & Disease-focused RT2 Profiler PCR Arrays for METTL21C
Interactions:

    Search GeneGlobe Interaction Network for METTL21C

STRING Interaction Network Preview (showing 4 interactants - click image to see more details)

4 Interacting proteins for METTL21C (ENSP000002672734) via UniProtKB, MINT, STRING, and/or I2D
InteractantInteraction Details
GeneCardExternal ID(s)
MUS81ENSP000003078534STRING: ENSP00000307853
TMA16ENSP000003513804STRING: ENSP00000351380
FARS2ENSP000002746804STRING: ENSP00000274680
FDXACB1ENSP000002602574STRING: ENSP00000260257
About this table

Gene Ontology (GO): 2 biological process terms:    About this table

GO IDQualified GO termEvidencePubMed IDs
GO:0006479protein methylation IDA--
GO:0018022peptidyl-lysine methylation IDA--

METTL21C for ontologies           About GeneDecksing



(Chemical Compounds according to UniProtKB, Enzo Life Sciences, EMD Millipore, Tocris Bioscience, ApexBio, HMDB, BitterDB, and/or Novoseek, Ligands according to IUPHAR, and Drugs according to DrugBank, Enzo Life Sciences, and/or PharmGKB)
About This Section

TryGeneCards Plus
Browse Small Molecules at EMD Millipore
   Browse drugs & compounds from Enzo Life Sciences
  Browse compounds at ApexBio 

Browse Tocris compounds for METTL21C (MT21C)



(Secondary structures according to fRNAdb,
GenBank/EMBL/DDBJ Accessions according to
Unigene (Build 236 Homo sapiens; Apr 25 2013) or GenBank,
RefSeq according to Entrez Gene,
DOTS (version 10), and/or AceView, transcript ids from Ensembl with links to UCSC,
exon structure from GeneLoc, alternative splicing isoforms according to ASD and/or ECgene,
siRNAs from OriGene, QIAGEN, shRNA from OriGene, microRNA from QIAGEN, SwitchGear Genomics,
Tagged/untagged cDNA clones from OriGene, GenScript, DNA2.0, Vector BioLabs, Primers from OriGene, and/or QIAGEN )
About This Section

TryGeneCards Plus

REFSEQ mRNAs for METTL21C gene: 
NM_001010977.2  

Unigene Cluster for METTL21C:

Methyltransferase like 21C
Hs.508623  [show with all ESTs]
Unigene Representative Sequence: NM_001010977
1 Ensembl transcript including schematic representation, and UCSC links where relevant:
ENST00000267273(uc001vpj.3)
miRNA
Products:
     
Block miRNA regulation of human, mouse, rat METTL21C using miScript Target Protectors
Search for qRT-PCR Assays for microRNAs that regulate METTL21C
SwitchGear 3'UTR luciferase reporter plasmidMETTL21C 3' UTR sequence
Inhib. RNA
Products:
     
OriGene RNAi products in human, mouse, rat for METTL21C
Predesigned siRNA for gene silencing in human, mouse, rat METTL21C
Clone
Products:
     
OriGene clones in human, mouse for METTL21C (see all 5)
OriGene ORF clones in mouse, rat for METTL21C
OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
GenScript: all cDNA clones in your preferred vector: METTL21C (NM_001010977)
DNA2.0 Custom Codon Optimized Gene Synthesis Service for METTL21C
Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat METTL21C
Primer
Products:
    
OriGene qSTAR qPCR primer pairs in human, mouse for METTL21C
Pre-validated RT2 qPCR Primer Assay in human, mouse, rat METTL21C
  QuantiTect SYBR Green Assays in human, mouse, rat METTL21C
  QuantiFast Probe-based Assays in human, mouse, rat METTL21C

Additional mRNA sequence: 

BC132748.1 BC132750.1 

2 DOTS entries:

DT.210824  DT.91741785 

24 AceView cDNA sequences:

BX089441 BF431062 AI800561 AI333373 W95480 AA704485 AA716703 CR595660 
AX747578 W95369 AI351418 BG210224 AK092513 N64492 BX112716 AA001603 
BF590213 AA706761 BG206841 AA001305 AA909732 N50031 AL576607 BG202368 

GeneLoc Exon Structure


(RNA expression data according to H-InvDB, NONCODE, miRBase, and RNAdb, Expression images according to data from BioGPS, Illumina Human BodyMap, and CGAP SAGE, Sets of similar genes according to GeneDecks, in vivo and in vitro expression data from LifeMap Discovery™, Protein expression images according to data from SPIRE 1MOPED, 2PaxDb, and 3MaxQB, plus additional links to SOURCE, and/or BioGPS, and/or UniProtKB,
PCR Arrays from QIAGEN, Primers from OriGene, and/or QIAGEN, In Situ Hybridization Assays from Advanced Cell Diagnostics)
About This Section

TryGeneCards Plus

METTL21C expression in normal human tissues (normalized intensities)
See probesets specificity/sensitivity at GeneAnnot
About this imageBioGPS <intensity>2/3
CGAP TAG: --
METTL21C Expression
About this image

METTL21C Protein expression data from MOPED1, PaxDb2 and MaxQB3    About this image

METTL21C Protein Expression

SOURCE GeneReport for Unigene cluster: Hs.508623
    Custom PCR Arrays for METTL21C
Primer
Products:
OriGene qSTAR qPCR primer pairs in human, mouse for METTL21C
Pre-validated RT2 qPCR Primer Assay in human, mouse, rat METTL21C
QuantiTect SYBR Green Assays in human, mouse, rat METTL21C
QuantiFast Probe-based Assays in human, mouse, rat METTL21C
In Situ
Assay Products:
 

 
Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for METTL21C

(Orthologs according to 1,2HomoloGene (2older version, for species not in 1newer version), 3euGenes, 4SGD , 5MGI Mar 06 2013, with possible further links to Flybase and/or WormBase, and/or 6Ensembl pan taxonomic compara , Gene Trees according to Ensembl and TreeFam)
About This Section

TryGeneCards Plus

This gene was present in the common ancestor of animals and fungi.

Orthologs for METTL21C gene from Selected species (see all 14)    About this table
Organism Taxonomic
classification
Gene Description Human
Similarity
Orthology
Type
Details
mouse
(Mus musculus)
Mammalia Mettl21c1 , 5 RIKEN cDNA A530098C11 gene5
methyltransferase like 21C1
83.48(n)1
82.05(a)1
  1 (23.52 cM)5
4332941  NM_001013799.11  NP_001013821.11 
 440094085 
chicken
(Gallus gallus)
Aves METTL21C1 methyltransferase like 21C 66.21(n)
64.22(a)
  418768  XM_416965.4  XP_416965.4 
lizard
(Anolis carolinensis)
Reptilia METTL21C6
methyltransferase like 21C
61(a)
1 ↔ 1
3(100939898-100942012)
tropical clawed frog
(Xenopus tropicalis)
Amphibia mettl21c1 methyltransferase like 21C 64.45(n)
60.19(a)
  100487446  XM_002933025.2  XP_002933071.2 
zebrafish
(Danio rerio)
Actinopterygii LOC1001494251 protein-lysine methyltransferase METTL21E-like 57.71(n)
54.23(a)
  100149425  XM_005168013.1  XP_005168070.1 
worm
(Caenorhabditis elegans)
Secernentea C42C1.136
Protein C42C1.13, isoform b
24(a)
1 → many
IV(12278767-12279546) WBGene00016591
baker's yeast
(Saccharomyces cerevisiae)
Saccharomycetes NNT1(YLR285W)4 Putative nicotinamide N-methyltransferase, has a role more   --   12(707360-708145) 850991  NP_013387.1 


ENSEMBL Gene Tree for METTL21C (if available)
TreeFam Gene Tree for METTL21C (if available)

(Paralogs according to 1HomoloGene,
2Ensembl, and 3SIMAP, Pseudogenes according to 4Pseudogene.org Build 68)
About This Section

TryGeneCards Plus
Paralogs for METTL21C gene
METTL21B2  VCPKMT2  METTL21A2  
1 SIMAP similar gene for METTL21C using alignment to 1 protein entry:     MT21C_HUMAN:
METTL21EP

METTL21C for paralogs           About GeneDecksing


1 Pseudogenes.org Pseudogene for METTL21C
PGOHUM00000248678


(SNPs/Variants according to the 1NCBI SNP Database, 2Ensembl, 3PupaSUITE, 4UniProtKB, and DNA2.0, Linkage Disequilibrium by HapMap, Structural Variations(CNVs/InDels/Inversions) from the Database of Genomic Variants, Mutations from the Human Gene Mutation Database (HGMD), the Human Cytochrome P450 Allele Nomenclature Database, and the Locus Specific Mutation Databases (LSDB), Blood group antigen gene mutations by BGMUT, Resequencing Primers, Cancer Mutation PCR Arrays and Assays, and Copy Number PCR Arrays from QIAGEN)
About This Section

TryGeneCards Plus

Selected SNPs for METTL21C (see all 358)    About this table    
Genomic DataTranscription Related DataAllele Frequencies
SNP IDValidClinical
significance
Chr 13 posSequence#AA
Chg
TypeMore#Allele
freq
PopTotal
sample
More
----------
rs1898026961,2
--103337626(+) GCTGTA/GAACCA 1 -- int10--------
rs1415596751,2
--103337674(+) TTCTTA/GCCTTT 1 -- int10--------
rs73388061,2
C,A--103337707(+) acaaaC/Aaaata 1 -- int11Minor allele frequency- A:0.00NA 2
rs562461651,2
C--103337710(+) ACAAA-/ACAAAAAAAAAATATATATATAT/ACAAACAAAAAAAAAAAATATATATAT/ACAAACAAAAAAAAAAATATATATAT/ACAAACAAA
AAAAAAATATATAT
/ACAAACAAACAAAAAATATATATATAT/CAAAAAAAAAATATATATATA/CAAACAAAAAAAAAAAATATATATA
TATAT
4 -- int1 cds11NA 2
rs2000964311,2
C--103337711(+) ACAAAC/TATATA 1 -- int10--------
rs6688921,2
C,F,A,H--103337726(-) tatgcC/Tatata 1 -- int14Minor allele frequency- T:0.25NS EA NA 250
rs6426931,2
C,F,O--103337760(+) TACTTG/ACTGTG 1 -- int18Minor allele frequency- A:0.30NA WA EA 504
rs1470448441,2
--103337817(+) TGACAC/TAGAGG 1 -- int10--------
rs1389086691,2
C--103338190(+) TATTTA/GGATTA 1 -- ut310--------
rs15871,2
C,F,A,H--103338230(+) TAGAAA/CGTTTC 1 -- ut3121Minor allele frequency- C:0.20MN NS EA NA WA 2492

HapMap Linkage Disequilibrium report for METTL21C (103338094 - 103346854 bp)

Structural Variations
     Database of Genomic Variants (DGV) 3 variations for METTL21C:    About this table    
Variant IDTypeSubtypePubMed ID
esv1001430CNV Insertion20482838
nsv1157CNV Insertion18451855
nsv519661CNV Loss19592680

Site Specific Mutation Identification with PCR Assays
SeqTarget long-range PCR primers for resequencing METTL21C
DNA2.0 Custom Variant and Variant Library Synthesis for METTL21C

(in which this Gene is Involved, According to MalaCards, OMIM, UniProtKB, the University of Copenhagen DISEASES database, Genatlas, GeneTests, GAD, HuGE Navigator, and/or TGDB.)
About This Section

TryGeneCards Plus
OMIM gene information: 615259    OMIM disorders: --


METTL21C for disorders           About GeneDecksing


Export disorders for METTL21C gene to outside databases

(in PubMed. Associations of this gene to articles via 1Entrez Gene, 2UniProtKB/Swiss-Prot, 3HGNC, 4GAD, 5PharmGKB, 6HMDB, 7DrugBank, 8UniProtKB/TrEMBL, 9 Novoseek, and/or 10fRNAdb)
About This Section

TryGeneCards Plus

PubMed articles for METTL21C gene integrated from 10 sources:
(articles sorted by number of sources associating them with METTL21C)
    Utopia: connect your pdf to the dynamic
world of online information

  1. A newly uncovered group of distantly related lysine methyltransferases preferentially interact with molecular chaperones to regulate their activity. (PubMed id 23349634)1, 2 Cloutier P.... Coulombe B. (PLoS Genet. 2013)
  2. Lysine methylation of VCP by a member of a novel human protein methyltransferase family. (PubMed id 22948820)2 Kernstock S.... Falnes P.O. (Nat. Commun. 2012)
  3. The DNA sequence and analysis of human chromosome 13. (PubMed id 15057823)2 Dunham A.... Ross M.T. (Nature 2004)
  4. The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). (PubMed id 15489334)2 Gerhard D.S.... Malek J. (Genome Res. 2004)
  5. Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences. (PubMed id 12477932)1 Strausberg R.L....Marra M.A. (Proc. Natl. Acad. Sci. U.S.A. 2002)

(in PubMed, OMIM, and NCBI Bookshelf)
About This Section

TryGeneCards Plus
 ANDOR
Aliases
Free Text  

  Query String
PubMed
OMIM
NCBI Bookshelf
  (Note: In FireFox, select the above section and copy using Ctrl-C)

(According to Entrez Gene, HGNC, AceView, euGenes, Ensembl, miRBase, ECgene, Kegg, and/or H-InvDB)
About This Section

TryGeneCards Plus
Entrez Gene: 196541 HGNC: 33717 AceView: LOC196541 Ensembl:ENSG00000139780 euGenes: HUgn196541
ECgene: METTL21C H-InvDB: METTL21C

(According to HUGE)
About This Section

TryGeneCards Plus
  --

(According to PharmGKB, ATLAS, HORDE, IMGT, LEIDEN, UniProtKB/Swiss-Prot, UniProtKB/TrEMBL, and/or others, e.g. Wikipedia and GeneReviews, via UniProtKB/Swiss-Prot)
About This Section

TryGeneCards Plus
NameDescription
PharmGKB entry for METTL21C Pharmacogenomics, SNPs, Pathways

(Patent information from GeneIP,
Licensable technologies from WIS Yeda, Salk, Tufts,
IP news from LifeMap Sciences, Inc.)
About This Section

TryGeneCards Plus
Patent Information for METTL21C gene:
Search GeneIP for patents involving METTL21C

GeneCards and IP:
Japan Patent Office Licenses GeneCards     European Patent Office Licenses GeneCards     Improving the IP Search



(Antibodies, recombinant proteins, and assays from EMD Millipore, R&D Systems, OriGene, QIAGEN, GenScript, Cell Signaling Technology, Novus Biologicals, Sino Biological, Enzo Life Sciences, Abcam, ProSpec, Cloud-Clone Corp., Thermo Fisher Scientific, LSBio, Gene Editing from DNA2.0. Clones from OriGene, GenScript, Sino Biological, DNA2.0, SwitchGear Genomics, Vector BioLabs, Cell lines from GenScript, and ESI BIO, PCR Arrays from QIAGEN, Drugs and/or compounds from EMD Millipore, Tocris Bioscience, Enzo Life Sciences, and/or ApexBio, In Situ Hybridization Assays from
Advanced Cell Diagnostics, Animal models from inGenious Targeting Laboratory, genOway)
About This Section

TryGeneCards Plus

 
 EMD Millipore genomic analysis products

  
 Browse Antibodies   Browse Cell Culture Products  
 Browse ELISAs   Browse Flow Cytometry Kits  
 Browse Primer Pairs   Browse Enzyme Activity Assays/Reagents  
 Browse ELISpot/FluoroSpot Kits/Development Modules   Browse TFB/Immunoprecipitation Assays  
 Browse Apoptosis Detection Kits/Reagents   Browse Ubiquitin Proteasome Pathway (UPP) Assay Kits/Reagents  
 Browse DNA Damage/Repair Kits/Reagents   Browse Luminex Assays  
 Browse Cell Selection/Detection Kits/Reagents   Browse Secondary Antibodies/Controls/Staining Reagents  
 Browse Recombinant/Natural Proteins   Browse Stem Cell Products  
 Browse cDNA Clones   Browse Proteome Profiler Antibody Arrays  
 Browse OriGene Antibodies   OriGene RNAi products in human, mouse, rat for METTL21C  
 Browse OriGene qPCR primer pairs and template standards   OriGene Protein Over-expression Lysate for METTL21C  
 OriGene MassSpec something-or-other for METTL21C   OriGene clones in human, mouse for METTL21C  
 OriGene qSTAR qPCR primer pairs in human, mouse for METTL21C   OriGene Purified Protein for METTL21C  
 OriGene ORF clones in mouse, rat for METTL21C   OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling  
 OriGene Custom Antibody Services for METTL21C   OriGene Custom Protein Services for METTL21C  

 
 
 Block miRNA regulation of human, mouse, rat METTL21C using miScript Target Protectors SeqTarget long-range PCR primers for resequencing METTL21C
 DNA Methylation CpG Assay Predesigned for Pyrosequencing in human, mouse, rat METTL21C Predesigned siRNA for gene silencing in human, mouse, rat METTL21C
 QuantiFast Probe-based Assays in human, mouse, rat METTL21C QuantiTect SYBR Green Assays in human, mouse, rat METTL21C
 Custom PCR Arrays for METTL21C Search Chromatin IP Primers for METTL21C
 Pre-validated RT2 qPCR Primer Assay in human, mouse, rat METTL21C  Search GeneGlobe Interaction Network for METTL21C
 Search Regulatory tfbs for METTL21C
 GenScript Custom Purified and Recombinant Proteins Services for METTL21C GenScript cDNA clones with any tag delivered in your preferred vector for METTL21C
 GenScript Custom Assay Services for METTL21C GenScript Custom overexpressing Cell Line Services for METTL21C
 CloneReady with Over 120,000 Genes  Gene Synthesis: Any Gene in Any Vector
 Vector-based siRNA and miRNA, Ready for Transfection Gene Mutant Library, Variants up to 10^11
 Plasmid Preparation Custom Peptide Services
 Search for Antibodies & Assays

 Search Tocris compounds for METTL21C (MT21C)
 Browse Sino Biological Proteins
 Browse Sino Biological Cell Lysates
 Browse Sino Biological cDNA Clones
 4000+ Proteins
 Search Sino Biological for antibodies, proteins & pathways
 Protein Production Services
 Transfection Reagents
 Protein A/G/L resins
 Isotyping reagents
 Search www.enzolifesciences.com for proteins, assays, substrates, inhibitors & antibodies

 Novus Tissue Slides
 METTL21C antibodies
 METTL21C proteins
 METTL21C lysates
 Antibodies for METTL21C
 See all of Abcam's Antibodies, Kits and Proteins for METTL21C
 Custom Antibody / Protein Production Service
 Bulk Purchasing
 Advantages of Rabbit Monoclonal antibodies
 Abcam protocols and scientific support
 Browse ProSpec Recombinant Proteins
 Proteins for METTL21C
 Antibodies for METTL21C
 ELISAs for METTL21C
 CLIAs for METTL21C



 Browse ESI BIO Cell Lines and PureStem Progenitors for METTL21C
 Gene Synthesis
 Protein Engineering
 Variant Library Synthesis
 Codon Optimization
 Protein Production and Purification
 Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for METTL21C
 SwitchGear 3'UTR luciferase reporter plasmids for METTL21C
 Browse SwitchGear Promoter luciferase reporter plasmids for METTL21C
 Search ThermoFisher Antibodies for METTL21C
 Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat METTL21C
 inGenious Targeting Laboratory: Let us create your new Knockout/Knockin mouse model for METTL21C
 inGenious Targeting Laboratory: Contact us about creating complex and humanized mouse models for METTL21C
 LSBio Antibodies in human, mouse, rat for METTL21C
Customized transgenic rodents for:
 Humanization
 Biomarker expression
 Off-target effect monitoring
 Translational medicine
 Tissue-specific gene expresssion
 Time-controlled gene expresssion
 Browse compounds at ApexBio
       
GeneCards Homepage - Last full update: 7 May 2014 - Incrementals: 9 May 2014 , 2 Jun 2014 , 26 Jun 2014 , 30 Jun 2014

View Random Gene

Category
(GIFtS: )
GIFtS Group
The GeneCards human gene database gene index: 1 3 5 A B C D E F G H I J K L M N O P Q R S T U V W X Y Z 


Developed at the Crown Human Genome Center, Department of Molecular Genetics, the Weizmann Institute of Science

Hot genes      Disease genes      METTL21C gene at Home site.
Version: 3.12.166 28 Aug 2014
hostname: 356980-web2.xennexinc.com index build: 126 solr: 1.4