Home
GeneCards Guide
Suite
- MalaCards
- GeneALaCart
- GeneDecks
- GeneIP
- GeneLoc
Terms and Conditions
- Terms of Use
- 3rd Party Notice
About Us
- GeneCards Team
- Our Publications
- Citing GeneCards
- Licensing Agreement
- Weizmann Institute
- LifeMap Sciences Inc
User Feedback
Mirror sites

Set Analyses:

Generates a file of GeneCards annotations for your list of genes

Advanced Search

Search By

Section (entire)

for

All GeneCards Within gene subset (to enable gene prioritization):
or upload a file of gene symbols

Category Symbol Source: HGNC EntrezGene Ensembl GeneCards RNA genes CroW21

GIFtS
-

MEGF11 Gene

protein-coding GIFtS: 51
GCID: GC15M066187

Multiple EGF-Like-Domains 11

See related diseases
at

MalaCards

(According to ¹HGNC, ²Entrez Gene,
³UniProtKB/Swiss-Prot, ⁴UniProtKB/TrEMBL, ⁵OMIM, ⁶GeneLoc, ⁷Ensembl, ⁸DME, ⁹miRBase, ¹⁰fRNAdb, ¹²H-InvDB, ¹³NCBI, ¹⁴NONCODE, and/or ¹⁵RNAdb)
About This Section

Aliases
Multiple EGF-Like-Domains 11¹ ²
Multiple EGF-Like Domains Protein 11² ³
KIAA1781³ ⁵
Multiple Epidermal Growth Factor-Like Domains Protein 11²

External Ids:	HGNC: 29635¹	Entrez Gene: 84465²	Ensembl: ENSG00000157890⁷	OMIM: 612454⁵	UniProtKB: A6BM72³

Export aliases for MEGF11 gene to outside databases

Previous GC identifers: GC15M061979 GC15M059286 GC15M063766 GC15M063903 GC15M063974 GC15M043012

(According to Entrez Gene, Tocris Bioscience, Wikipedia's Gene Wiki, PharmGKB,
UniProtKB/Swiss-Prot, and/or UniProtKB/TrEMBL)
About This Section

GeneCards Summary for MEGF11 Gene:

MEGF11 (multiple EGF-like-domains 11) is a protein-coding gene. Diseases associated with MEGF11 include retinitis, and neuronitis. An important paralog of this gene is SCARF1.

UniProtKB/Swiss-Prot: MEG11_HUMAN, A6BM72

Function: May regulate the mosaic spacing of specific neuron subtypes in the retina through homotypic retinal

neuron repulsion. Mosaics provide a mechanism to distribute each cell type evenly across the retina, ensuring

that all parts of the visual field have access to a full set of processing elements (By similarity)

(According to GeneLoc and/or HGNC, and/or
Entrez Gene (NCBI build 37),
and/or miRBase,
Genomic Views according to UCSC (hg19) and Ensembl (release 73), Regulatory elements and Epigenetics data according to QIAGEN, SABiosciences, and/or SwitchGear Genomics)
About This Section

RefSeq DNA sequence:

NC_000015.9 NT_010194.17 NC_018926.2

Regulatory elements:

SABiosciences Regulatory transcription factor binding sites in the MEGF11 gene promoter:
GR FAC1 POU2F1 Pax-5 POU2F1a GR-alpha POU6F1 (c2) CUTL1 Pax-4a
Other transcription factors

SwitchGear Promoter luciferase reporter plasmid: MEGF11 promoter sequence

Search SABiosciences Chromatin IP Primers for MEGF11

Epigenetics:

QIAGEN PyroMark CpG Assay predesigned Pyrosequencing DNA Methylation assays in human, mouse, rat MEGF11

Genomic Location:
Genomic View: UCSC Golden Path with GeneCards custom track

Entrez Gene cytogenetic band: 15q22.31 Ensembl cytogenetic band: 15q22.31 HGNC cytogenetic band: 15q22.31

MEGF11 Gene in genomic location: bands according to Ensembl, locations according to (and/or Entrez Gene and/or Ensembl if different)
MEGF11 gene location

GeneLoc information about chromosome 15 GeneLoc Exon Structure

GeneLoc location for GC15M066187: view genomic region (about GC identifiers)

Start:	66,187,417 bp from pter	End:	66,546,085 bp from pter
Size:	358,669 bases	Orientation:	minus strand

1 alternative location:

Chr15-,NW_003315944 5,553-357,692

(According to UniProtKB, HORDE, neXtProt, Ensembl, and/or Reactome, Modification sites according to PhosphoSitePlus, Specific Peptides from DME, Protein expression images according to data from SPIRE ¹MOPED, ²PaxDb, and ³MAXQB RefSeq according to NCBI, PDB rendering according to OCA and/or Proteopedia, Recombinant Proteins from EMD Millipore, R&D Systems, GenScript, Enzo Life Sciences, OriGene, Novus Biologicals, Sino Biological, ProSpec, and/or Cloud-Clone Corp.,
Biochemical Assays by EMD Millipore, R&D Systems, OriGene, GenScript, Cell Signaling Technology, Enzo Life Sciences, and/or Cloud-Clone Corp., Ontologies according to Gene Ontology Consortium 01 Oct 2013 and Entrez Gene, Antibodies by EMD Millipore, R&D Systems, GenScript, Cell Signaling Technology, OriGene, Novus Biologicals, Thermo Fisher Scientific, LSBio, Abcam, and/or Cloud-Clone Corp.)
About This Section

UniProtKB/Swiss-Prot: MEG11_HUMAN, A6BM72 (See protein sequence)

Recommended Name: Multiple epidermal growth factor-like domains protein 11 precursor

Size: 1044 amino acids; 110844 Da

Subunit: Homopolymer (Probable). Does not interact with MEGF10

Subcellular location: Cell membrane; Single-pass type I membrane protein. Basolateral cell membrane; Single-pass

type I membrane protein. Note=Forms an irregular, mosaic-like adhesion pattern in region of the cell that becomes

firmely fixed to the substrate. Localized to protruding lamellipodia. Does not localize with MEGF10

Sequence caution: Sequence=BAB47410.2; Type=Erroneous initiation; Note=Translation N-terminally extended;

Sequence=CAD38994.1; Type=Erroneous initiation; Note=Translation N-terminally extended;

Secondary accessions: Q17R86 Q6UXS5 Q8ND91 Q96KG6

Alternative splicing: 4 isoforms: A6BM72-1 A6BM72-2 A6BM72-3 A6BM72-4

Explore the universe of human proteins at neXtProt for MEGF11: NX_A6BM72

Explore proteomics data for MEGF11 at MOPED

Post-translational modifications:

View modification sites using PhosphoSitePlus

View neXtProt modification sites for NX_A6BM72

MEGF11 Protein expression data from MOPED¹, PaxDb² and MAXQB³ : About this image

REFSEQ proteins: NP_115821.2

ENSEMBL proteins:

ENSP00000386908 ENSP00000288745 ENSP00000456118 ENSP00000401400 ENSP00000414475

ENSP00000378987 ENSP00000378976 ENSP00000353919

Human Recombinant Protein Products for MEGF11:

	Browse Purified and Recombinant Proteins at EMD Millipore
	Browse R&D Systems for human recombinant proteins
	Browse recombinant and purified proteins available from Enzo Life Sciences
	Browse OriGene full length recombinant human proteins expressed in human HEK293 cells Browse OriGene Protein Over-expression Lysates OriGene Custom MassSpec OriGene Custom Protein Services for MEGF11
	GenScript Custom Purified and Recombinant Proteins Services for MEGF11
	Browse Sino Biological Recombinant Proteins Browse Sino Biological Cell Lysates
	Browse ProSpec Recombinant Proteins
	Cloud-Clone Corp. Proteins for MEGF11

Gene Ontology (GO): 2 cellular component terms (GO ID links to tree view): About this table

GO ID	Qualified GO term	Evidence	PubMed IDs
GO:0016021	integral to membrane	IEA	--
GO:0016323	basolateral plasma membrane	IEA	--

MEGF11 for ontologies About GeneDecksing

MEGF11 Antibody Products:

	Browse EMD Millipore's Extensive Line of Mono- and Polyclonal Antibodies
	Browse R&D Systems for Antibodies
	Browse OriGene Antibodies OriGene Custom Antibody Services for MEGF11
	GenScript Custom Superior Antibodies Services for MEGF11
	Novus Biologicals MEGF11 Antibodies
	Abcam antibodies for MEGF11
	Cloud-Clone Corp. Antibodies for MEGF11
	Search ThermoFisher Antibodies for MEGF11
	LSBio Antibodies in human, mouse, rat for MEGF11

Assay Products for MEGF11:

	Browse Kits and Assays available from EMD Millipore
	OriGene Custom Assay Services for MEGF11
	Browse R&D Systems for biochemical assays
	GenScript Custom Assay Services for MEGF11
	Browse Enzo Life Sciences for kits & assays
	Cloud-Clone Corp. ELISAs for MEGF11 Cloud-Clone Corp. CLIAs for MEGF11

(According to HGNC, IUPHAR, InterPro, ProtoNet, UniProtKB, and/or BLOCKS, Sets of similar genes according to GeneDecks)
About This Section

4 InterPro protein domains:

IPR000742 EG-like_dom

IPR011489 EMI_domain

IPR002049 EGF_laminin

IPR013032 EGF-like_CS

Graphical View of Domain Structure for InterPro Entry A6BM72

ProtoNet protein and cluster: A6BM72

UniProtKB/Swiss-Prot: MEG11_HUMAN, A6BM72

Similarity: Belongs to the MEGF family

Similarity: Contains 14 EGF-like domains

Similarity: Contains 1 EMI domain

MEGF11 for domains About GeneDecksing

(According to ¹UniProtKB, Genatlas, LifeMap Discovery™, IUBMB, and/or ²DME, Human phenotypes from GenomeRNAi, Animal models from MGI Mar 06 2013, inGenious Targeting Laboratory, genOway,
bound targets from SABiosciences, miRNA Gene Targets from miRTarBase, shRNA from OriGene, RNAi from EMD Millipore, siRNAs from OriGene, QIAGEN, microRNA from QIAGEN, Gene Editing from DNA2.0, Sirion Biotech, Clones from EMD Millipore, OriGene, SwitchGear Genomics, GenScript, Sino Biological, DNA2.0, Vector BioLabs, and Sirion Biotech, Cell Lines from GenScript, LifeMap BioReagents, In Situ Hybridization Assays from Advanced Cell Diagnostics, Ontologies according to Gene Ontology Consortium 01 Oct 2013 via Entrez Gene.)
About This Section

Molecular Function:

UniProtKB/Swiss-Prot Summary: MEG11_HUMAN, A6BM72

Function: May regulate the mosaic spacing of specific neuron subtypes in the retina through homotypic retinal

neuron repulsion. Mosaics provide a mechanism to distribute each cell type evenly across the retina, ensuring

that all parts of the visual field have access to a full set of processing elements (By similarity)

Gene Ontology (GO): 1 molecular function term (GO ID links to tree view): About this table

GO ID	Qualified GO term	Evidence	PubMed IDs
GO:0005515	protein binding	--	--

MEGF11 for ontologies About GeneDecksing

Phenotypes:
2 MGI mutant phenotypes (inferred from 1 allele) (MGI details for Megf11):

nervous system

vision/eye

MEGF11 for phenotypes About GeneDecksing

Animal Models:

inGenious Targeting Laboratory - Custom generated mouse model solutions for MEGF11

inGenious Targeting Laboratory - Custom generated inducible mouse model solutions for MEGF11

genOway customized KO model: permanent, tissue-specific or time-controlled inactivation for MEGF11

genOway customized Knockin model: humanization, point mutation, expression monitoring, etc. for MEGF11

miRNA Products:		QIAGEN Custom miScript Target Protector blocks miRNA-binding site of human, mouse, rat MEGF11
		8/53 QIAGEN miScript miRNA Assays for microRNAs that regulate MEGF11 (see all 53):
		hsa-miR-376b hsa-let-7d hsa-miR-188-5p hsa-miR-128 hsa-let-7a-2* hsa-miR-624 hsa-miR-578 hsa-miR-488

		SwitchGear 3'UTR luciferase reporter plasmid: MEGF11 3' UTR sequence

Inhib. RNA Products:		Browse for Gene Knock-down Tools from EMD Millipore
		OriGene RNAi products in human, mouse, rat for MEGF11
		QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat MEGF11

Gene Editing Products:			DNA2.0 Custom Protein Engineering Service for MEGF11
			Sirion Biotech Customized adenovirus for overexpression of MEGF11

Clone Products:		Browse Clones for the Expression of Recombinant Proteins Available from EMD Millipore
		OriGene clones in human, mouse for MEGF11 (see all 9) OriGene ORF clones in mouse, rat for MEGF11 OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
		GenScript: all cDNA clones in your preferred vector: MEGF11 (NM_032445)
		Browse Sino Biological Human cDNA Clones
		DNA2.0 Custom Codon Optimized Gene Synthesis Service for MEGF11
		Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat MEGF11
		Sirion Biotech Customized lentivirus for stable overexpression of MEGF11 Customized lentivirus expression plasmids for stable overexpression of MEGF11

Cell Line Products:		GenScript Custom overexpressing Cell Line Services for MEGF11
		Search LifeMap BioReagents cell lines for MEGF11

In Situ Assay
Products:

Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for MEGF11

(Pathways according to EMD Millipore, R&D Systems, Cell Signaling Technology, KEGG, PharmGKB, BioSystems, Sino Biological, Reactome, Tocris Bioscience, GeneGo (Thomson Reuters), QIAGEN, and/or UniProtKB, Sets of similar genes according to GeneDecks, Interaction Networks according to SABiosciences, and/or STRING, Interactions according to ¹UniProtKB, ²MINT, ³I2D, and/or ⁴STRING, with links to IntAct and Ensembl, Ontologies according to Gene Ontology Consortium 01 Oct 2013 via Entrez Gene).
About This Section

Interactions:

Search SABiosciences Gene Network Central^TM Interacting Genes and Proteins Networks for MEGF11

STRING Interaction Network Preview (showing 1 interactants - click image to see more details)

3 Interacting proteins for MEGF11 (A6BM72^{2, 3} ENSP00000386908⁴) via UniProtKB, MINT, STRING, and/or I2D

Interactant		Interaction Details
GeneCard	External ID(s)	Interaction Details
ATN1	P54259²^,³, ENSP00000349076⁴	MINT-2877232 MINT-2877251 I2D: score=3 STRING: ENSP00000349076
GULP1	Q9UBP9³	I2D: score=1
SNX2	O60749³	I2D: score=1

About this table

Gene Ontology (GO): 2 biological process terms (GO ID links to tree view): About this table

GO ID	Qualified GO term	Evidence	PubMed IDs
GO:0010842	retina layer formation	ISS	--
GO:0034109	homotypic cell-cell adhesion	ISS	--

MEGF11 for ontologies About GeneDecksing

(Chemical Compounds according to UniProtKB, Enzo Life Sciences, EMD Millipore, Tocris Bioscience HMDB, BitterDB, and/or Novoseek, Ligands according to IUPHAR, and Drugs according to DrugBank, Enzo Life Sciences, and/or PharmGKB, with drugs/clinical trials/news search links to CenterWatch)
About This Section

Browse Small Molecules at EMD Millipore

Browse drugs & compounds from Enzo Life Sciences

Browse Tocris compounds for MEGF11 (MEG11)

Search CenterWatch for drugs/clinical trials and news about MEGF11 / MEG11

(Secondary structures according to fRNAdb,
GenBank/EMBL/DDBJ Accessions according to
Unigene (Build 236 Homo sapiens; Apr 25 2013) or GenBank,
RefSeq according to Entrez Gene,
DOTS (version 10), and/or AceView, transcript ids from Ensembl with links to UCSC,
Conferences by KenesGroup, exon structure from GeneLoc, alternative splicing isoforms according to ASD and/or ECgene,
RNAi Products from EMD Millipore,
siRNAs from OriGene, QIAGEN, shRNA from OriGene, microRNA from QIAGEN,
Tagged/untagged cDNA clones from OriGene, SwitchGear Genomics, GenScript, DNA2.0, Vector BioLabs, Sirion Biotech, Primers from OriGene, SABiosciences, and/or QIAGEN )
About This Section

REFSEQ mRNAs for MEGF11 gene:

NM_032445.2

Unigene Cluster for MEGF11:

Multiple EGF-like-domains 11

Hs.712886 [show with all ESTs]

Unigene Representative Sequence: NM_032445

17 Ensembl transcripts including schematic representations, and UCSC links where relevant:

ENST00000409699(uc002apn.1) ENST00000288745(uc002apl.2) ENST00000478721

ENST00000490495 ENST00000489275 ENST00000562154 ENST00000493192 ENST00000478590

ENST00000564573 ENST00000455812 ENST00000484618 ENST00000474398 ENST00000469917

ENST00000422354(uc002apm.2) ENST00000395625 ENST00000395614 ENST00000360698

miRNA Products:		QIAGEN Custom miScript Target Protector blocks miRNA-binding site of human, mouse, rat MEGF11
		8/53 QIAGEN miScript miRNA Assays for microRNAs that regulate MEGF11 (see all 53):
		hsa-miR-376b hsa-let-7d hsa-miR-188-5p hsa-miR-128 hsa-let-7a-2* hsa-miR-624 hsa-miR-578 hsa-miR-488

		SwitchGear 3'UTR luciferase reporter plasmid: MEGF11 3' UTR sequence

Inhib. RNA Products:		Browse for Gene Knock-down Tools from EMD Millipore
		OriGene RNAi products in human, mouse, rat for MEGF11
		QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat MEGF11

Clone Products:		OriGene clones in human, mouse for MEGF11 (see all 9) OriGene ORF clones in mouse, rat for MEGF11 OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
		GenScript: all cDNA clones in your preferred vector: MEGF11 (NM_032445)
		DNA2.0 Custom Codon Optimized Gene Synthesis Service for MEGF11
		Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat MEGF11
		Sirion Biotech Customized lentivirus for stable overexpression of MEGF11 Customized lentivirus expression plasmids for stable overexpression of MEGF11

Primer Products:		OriGene qSTAR qPCR primer pairs in human, mouse for MEGF11
		SABiosciences RT² qPCR Primer Assay in human, mouse, rat MEGF11
		QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat MEGF11
		QIAGEN QuantiFast Probe-based Assays in human, mouse, rat MEGF11

Additional mRNA sequence:

AB058677.1 AB300051.1 AK090663.1 BC029999.1 BC117419.1 BC126313.1

9 DOTS entries:

DT.75193995 DT.121080094 DT.91944360 DT.40129195 DT.101978329 DT.403184 DT.406166 DT.91717542

DT.121080092

24/38 AceView cDNA sequences (see all 38):

BM723031 BM677486 BC029999 AY358226 AB058677 AW131768 NM_032445 AA496110

AK090663 AL834326 AA293781 AA861104 AI027310 BM563529 BF529240 AA398355

AA496109 AW293834 AW103176 BX090443 AL044960 AI919451 BF529771 AI936445

GeneLoc Exon Structure

5/8 Alternative Splicing Database (ASD) splice patterns (SP) for MEGF11 (see all 8) About this scheme

ExUns:	1	^	2	^	3	^	4	^	5	^	6	^	7	^	8	^	9	^	10	^	11	^	12	^	13	^	14	^	15	^	16	^	17	^	18a	·	18b	^	19	^	20	^	21a	·	21b	·	21c	^	22	^	23	^
SP1:							-		-						-																						-						-				-		-		-
SP2:																																											-				-		-		-
SP3:																																															-		-		-
SP4:																																																			-
SP5:

ExUns:	24	^	25	^	26a	·	26b	^	27	^	28	^	29a	·	29b	·	29c	^	30	^	31
SP1:	-		-		-		-		-				-		-		-
SP2:	-
SP3:					-				-						-		-
SP4:	-
SP5:

ECgene alternative splicing isoforms for MEGF11

(RNA expression data according to H-InvDB, NONCODE, miRBase, and RNAdb, Expression images according to data from BioGPS, Illumina Human BodyMap, and CGAP SAGE, Sets of similar genes according to GeneDecks, in vivo and in vitro expression data from LifeMap Discovery™, plus additional links to Genevestigator, and/or SOURCE, and/or BioGPS, and/or UniProtKB,
PCR Arrays from SABiosciences, Primers from OriGene, SABiosciences, and/or QIAGEN, In Situ Hybridization Assays from Advanced Cell Diagnostics)
About This Section

MEGF11 expression in normal human tissues (normalized intensities) MEGF11 embryonic expression: see
See probesets specificity/sensitivity at GeneAnnot
About this imageBioGPS <intensity>^2/3
CGAP TAG: --

About this image

MEGF11 expression in embryonic tissues and stem cells About this table

Data from LifeMap, the Embryonic Development and Stem Cells Database

5/4 selected tissues (see all 4) fully expand


Eye (Sensory Organs) fully expand to see all 3 entries
Mature Horizontal Cells Inner Nuclear Layer

Brain (Nervous System) fully expand to see all 2 entries
cerebellum

Heart (Cardiovascular System)
Atrioventricular Node Cells Atrioventricular Node

Testis (Reproductive System)

See MEGF11 Protein Expression from SPIRE MOPED and PaxDB
Genevestigator expression for MEGF11

SOURCE GeneReport for Unigene cluster: Hs.712886

SABiosciences Custom PCR Arrays for MEGF11

Primer Products:		OriGene qSTAR qPCR primer pairs in human, mouse for MEGF11
		SABiosciences RT² qPCR Primer Assay in human, mouse, rat MEGF11
		QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat MEGF11
		QIAGEN QuantiFast Probe-based Assays in human, mouse, rat MEGF11

In Situ
Assay Products:

Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for MEGF11

(Orthologs according to ^1,2HomoloGene (²older version, for species not in ¹newer version), ³euGenes, ⁴SGD , ⁵MGI Mar 06 2013, with possible further links to Flybase and/or WormBase, and/or ⁶Ensembl pan taxonomic compara , Gene Trees according to Ensembl and TreeFam)
About This Section

This gene was present in the common ancestor of animals.

Orthologs for MEGF11 gene from 6/14 species (see all 14) About this table

Organism	Taxonomic classification	Gene	Description	Human Similarity	Orthology Type	Details
mouse (Mus musculus)	Mammalia	Megf11^{1 , 5}	multiple EGF-like-domains 11^{1, 5}	87.12(n)¹ 90.59(a)¹		9 (34.67 cM)⁵ 214058¹ NM_001134399.1¹ NP_001127871.1¹ 64385626⁵
chicken (Gallus gallus)	Aves	MEGF11¹	multiple EGF-like-domains 11	75.3(n) 77.96(a)		415545 XM_413915.3 XP_413915.3
lizard (Anolis carolinensis)	Reptilia	-- -- (see all 3)	Uncharacterized protein (see all 3)	84(a) 72(a) (see all 3)	possible ortholog 1 ↔ many (see all 3)	GL343921.1(27207-93585) GL343930.1(34104-87478)
zebrafish (Danio rerio)	Actinopterygii	megf11¹	multiple EGF-like-domains 11	70.44(n) 69.24(a)		563468 XM_001921905.3 XP_001921940.2
fruit fly (Drosophila melanogaster)	Insecta	CG18172³ drpr¹	draper¹	44(a) (best of 3)³ 51.97(n)¹ 41.18(a)¹		38218¹ NM_167911.2¹ NP_728660.2¹
worm (Caenorhabditis elegans)	Secernentea	ced-1¹	Protein CED-1	47.7(n) 40.74(a)		173064 NM_001026601.2 NP_001021772.1

ENSEMBL Gene Tree for MEGF11 (if available)
TreeFam Gene Tree for MEGF11 (if available)

(Paralogs according to ¹HomoloGene,
²Ensembl, and ³SIMAP, Pseudogenes according to ⁴Pseudogene.org Build 68)
About This Section

Paralogs for MEGF11 gene

SCARF1² PEAR1² MEGF10² SCARF2²

4 SIMAP similar genes for MEGF11 using alignment to 3 protein entries: MEG11_HUMAN (see all proteins):

MEGF10 PEAR1 MEGF6 EGFEM1P

MEGF11 for paralogs About GeneDecksing

1 Pseudogenes.org Pseudogene for MEGF11
PGOHUM00000246825

(SNPs/Variants according to the ¹NCBI SNP Database, ²Ensembl, ³PupaSUITE, ⁴UniProtKB, and DNA2.0, Linkage Disequilibrium by HapMap, Structural Variations(CNVs/InDels/Inversions) from the Database of Genomic Variants, Mutations from the Human Gene Mutation Database (HGMD) and the Locus Specific Mutation Databases (LSDB), Blood group antigen gene mutations by BGMUT, Resequencing Primers from QIAGEN, Cancer Mutation PCR Arrays and Assays and Copy Number PCR Arrays from SABiosciences)
About This Section

SNP ID	Valid	Clinical significance	Chr 15 pos	Sequence	#	AA Chg	Type	More	#	Allele freq	Pop	Total sample	More
Genomic Data					Transcription Related Data				Allele Frequencies
				--	--	--		--	--
rs57789929^1,2	C	--	43321544(+)	`AAAAT-/AAAATAAAATAAAAT/AAA ATAAAATAAAATAAAATAAAATCATCA`	2	--	int¹ cds¹		1		NA	2
rs35024692^1,2	C,F	--	43349296(+)	`TTGGGT/ATTTTT`	1	--	int¹		2		NA	4
rs71447889^1,2	C	--	43349296(+)	`TTGGG-/TT/TTT TTTTT`	1	--	int¹		1		NA	2
rs71860153^1,2	C	--	46332468(+)	`TACCCCT/-CTCTT`	1	--	int¹		1		CSA	2
rs78392362^1,2	C	--	46383312(+)	`TTTTG-/GATTT ATTTA`	1	--	int¹		0	--	--	--	--
rs192900900^1,2		--	66187140(+)	`TGGTGC/TGATCT`	1	--	ds500¹		0	--	--	--	--
rs148817332^1,2	C	--	66187234(+)	`CACCAC/GGCCCG`	1	--	ds500¹		0	--	--	--	--
rs143463549^1,2	C	--	66187238(+)	`AGGCCC/TGGCTA`	1	--	ds500¹		0	--	--	--	--
rs185054566^1,2		--	66187245(+)	`GCTAAG/TTTTTT`	1	--	ds500¹		0	--	--	--	--
rs16949083^1,2	C,F,H	--	66188031(+)	`CTCCTC/GTGTAT`	1	--	ut3¹ ese³ trp³		8		NA NS EA WA	678

HapMap Linkage Disequilibrium report for MEGF11 (66187417 - 66437417 bp, first 250kb of MEGF11)

Structural Variations
Database of Genomic Variants (DGV) 10/21 variations for MEGF11 (see all 21): About this table

Variant ID	Type	Subtype	PubMed ID
esv5067	CNV	Deletion	18987735
esv987792	CNV	Deletion	20482838
esv2749789	CNV	Deletion	23290073
esv2749788	CNV	Deletion	23290073
nsv1574	CNV	Insertion	18451855
esv273604	CNV	Insertion	20981092
esv1121128	CNV	Insertion	17803354
esv994579	CNV	Insertion	20482838
esv1421197	CNV	Insertion	17803354
nsv509572	CNV	Insertion	20534489

Human Gene Mutation Database (HGMD): MEGF11

SABiosciences Cancer Mutation PCR Assays

SeqTarget long-range PCR primers for resequencing MEGF11

DNA2.0 Custom Variant and Variant Library Synthesis for MEGF11

(in which this Gene is Involved, According to MalaCards, OMIM, UniProtKB, the University of Copenhagen DISEASES database, Conferences by KenesGroup, Genatlas, GeneTests, GAD, HuGE Navigator, and/or TGDB.)
About This Section

OMIM gene information: 612454 OMIM disorders: --

2 diseases for MEGF11: About MalaCards

retinitis neuronitis

MEGF11 for disorders About GeneDecksing

Genetic Association Database (GAD): MEGF11
Human Genome Epidemiology (HuGE) Navigator: MEGF11 (2 documents)

Export disorders for MEGF11 gene to outside databases

(in PubMed. Associations of this gene to articles via ¹Entrez Gene, ²UniProtKB/Swiss-Prot, ³HGNC, ⁴GAD, ⁵PharmGKB, ⁶HMDB, ⁷DrugBank, ⁸UniProtKB/TrEMBL, ⁹ Novoseek, and/or ¹⁰fRNAdb)
About This Section

PubMed articles for MEGF11 gene, integrated from 9 sources (see all 12):
(articles sorted by number of sources associating them with MEGF11)

Utopia: connect your pdf to the dynamic
world of online information

Prediction of the coding sequences of unidentified human genes. XX. The complete sequences of 100 new cDNA clones from brain which code for large proteins in vitro. (PubMed id 11347906)^{1, 2, 3} Nagase T.... Ohara O. (2001)
Assessment of a polymorphism of SDK1 with hypertensio n in Japanese Individuals. (PubMed id 19851296)^{1, 4} Oguri M....Yamada Y. (2010)
Association of genetic variants with hemorrhagic stro ke in Japanese individuals. (PubMed id 20198315)^{1, 4} Yoshida T....Yamada Y. (2010)
The mammalian Ced-1 ortholog MEGF10/KIAA1780 displays a novel adhesion pattern. (PubMed id 17498693)^{1, 2} Suzuki E. and Nakayama M. (2007)
The secreted protein discovery initiative (SPDI), a large-scale effort to identify novel human secreted and transmembrane proteins: a bioinformatics assessment. (PubMed id 12975309)^{1, 2} Clark H.F.... Gray A.M. (2003)
A genome-wide association study of breast and prostate cancer in the NHLBI's Framingham Heart Study. (PubMed id 17903305)⁴ Murabito J.M....Hwang S.J. (2007)
The full-ORF clone resource of the German cDNA consortium. (PubMed id 17974005)² Bechtel S.... Schupp I. (2007)
Analysis of the DNA sequence and duplication history of human chromosome 15. (PubMed id 16572171)² Zody M.C....Nusbaum C. (2006)
A protein-protein interaction network for human inherited ataxias and disorders of Purkinje cell degeneration. (PubMed id 16713569)¹ Lim J.... Zoghbi H.Y. (2006)
The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). (PubMed id 15489334)² Gerhard D.S....Malek J. (2004)

(in PubMed, OMIM, and NCBI Bookshelf)
About This Section

		AND	OR
Aliases
Free Text

Query String		PubMed OMIM NCBI Bookshelf
	(Note: In FireFox, select the above section and copy using Ctrl-C)

(According to Entrez Gene, HGNC, AceView, euGenes, Ensembl, miRBase, ECgene, Kegg, and/or H-InvDB)
About This Section

Entrez Gene: 84465	HGNC: 29635	AceView: MEGF11	Ensembl:ENSG00000157890	euGenes: HUgn84465
ECgene: MEGF11	H-InvDB: MEGF11

(According to HUGE)
About This Section

HUGE: KIAA1781

(According to PharmGKB, ATLAS, HORDE, IMGT, LEIDEN, UniProtKB/Swiss-Prot, and/or UniProtKB/TrEMBL,
Wikipedia and/or GeneReviews via UniProtKB/Swiss-Prot)
About This Section

Name	Description
PharmGKB entry for MEGF11	Pharmacogenomics, SNPs, Pathways

Intellectual Property for MEGF11 gene
(Patent information from GeneIP, Licensable technologies from WIS Yeda, Salk, Tufts, IP news from LifeMap Sciences, Inc.)

About This Section

Patent Information for MEGF11 gene:
Search GeneIP for patents involving MEGF11

GeneCards and IP:
Japan Patent Office Licenses GeneCards European Patent Office Licenses GeneCards Improving the IP Search

(Antibodies, recombinant proteins, and assays from EMD Millipore, R&D Systems, OriGene, QIAGEN, GenScript, Cell Signaling Technology, SABiosciences, Novus Biologicals, Sino Biological, Enzo Life Sciences, Abcam, ProSpec, Cloud-Clone Corp., Thermo Fisher Scientific, LSBio, Gene Editing from DNA2.0 and Sirion Biotech, Clones from EMD Millipore, OriGene, GenScript, Sino Biological, DNA2.0, SwitchGear Genomics, Vector BioLabs, Sirion Biotech, Cell lines from GenScript, and LifeMap BioReagents, PCR Arrays from SABiosciences, Drugs and/or compounds from EMD Millipore, Tocris Bioscience, and/or Enzo Life Sciences, In Situ Hybridization Assays from
Advanced Cell Diagnostics, Animal models from inGenious Targeting Laboratory, genOway)
About This Section


	EMD Millipore Custom Antibody & Bulk Services
	EMD Millipore Preclinical / Clinical Development Services
	EMD Millipore Immunoassay Services
	EMD Millipore Target Screening & Profiling Services

	Browse Antibodies		Browse Cell Culture Products
	Browse ELISAs		Browse Flow Cytometry Kits
	Browse Primer Pairs		Browse Kinase Activity Assays/Reagents
	Browse ELISpot Kits/Development Modules		Browse TFB/Immunoprecipitation Assays
	Browse Apoptosis Detection Kits/Reagents		Browse Ubiquitin Proteasome Pathway (UPP) Assay Kits/Reagents
	Browse DNA Damage/Repair Kits/Reagents		Browse Multiplex/Array Assay Kits/Reagents
	Browse Cell Selection/Detection Kits/Reagents		Browse Secondary Antibodies/Controls/Staining Reagents
	Browse Protease Activity Assays and Reagents		Browse Recombinant/Natural Proteins
	Browse Stem Cell Products		Browse Tocris Biochemicals & Compounds
	Browse cDNA Clones		Browse Proteome Profiler Antibody Arrays

	Browse OriGene Antibodies		OriGene RNAi products in human, mouse, rat for MEGF11
	Browse OriGene qPCR primer pairs and template standards		Browse OriGene Protein Over-expression Lysates
	OriGene Custom Mass Spec		OriGene clones in human, mouse for MEGF11
	OriGene qSTAR qPCR primer pairs in human, mouse for MEGF11		Browse OriGene full length recombinant human proteins expressed in human HEK293 cells
	OriGene ORF clones in mouse, rat for MEGF11		OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
	OriGene Custom Antibody Services for MEGF11		OriGene Custom Protein Services for MEGF11

	QIAGEN Custom miScript Target Protector blocks miRNA-binding site of in human, mouse, rat MEGF11
	QIAGEN SeqTarget long-range PCR primers for resequencing MEGF11
	QIAGEN PyroMark CpG Assay predesigned Pyrosequencing DNA Methylation assays in human, mouse, rat MEGF11
	QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat MEGF11
	QIAGEN QuantiFast Probe-based Assays in human, mouse, rat MEGF11
	QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat MEGF11

	GenScript Custom Purified and Recombinant Proteins Services for MEGF11		GenScript cDNA clones with any tag delivered in your preferred vector for MEGF11
	GenScript Custom Assay Services for MEGF11		GenScript Custom Superior Antibodies Services for MEGF11
	GenScript Custom overexpressing Cell Line Services for MEGF11		CloneReady with Over 120,000 Genes
	Gene Synthesis: Any Gene in Any Vector		Vector-based siRNA and miRNA, Ready for Transfection
	Gene Mutant Library, Variants up to 10^11		Plasmid Preparation
	Custom Peptide Services

Search for Antibodies & Assays

	Regulatory tfbs in MEGF11 promoter
	Search Chromatin IP Primers for MEGF11
	RT² qPCR Primer Assay in human, mouse, rat MEGF11
	Search GNC Networks for MEGF11
	SABiosciences Custom PCR Arrays for MEGF11

Search Tocris compounds for MEGF11 (MEG11)

	Browse Sino Biological Proteins and Antibodies
	Browse Sino Biological Cell Lysates
	Browse Sino Biological cDNA Clones
	4000+ Proteins
	Search Sino Biological for antibodies, proteins & pathways
	Protein Production Services
	Transfection Reagents
	Protein A/G/L resins
	Isotyping reagents

Search www.enzolifesciences.com for proteins, assays, substrates, inhibitors & antibodies

	Novus Tissue Slides
	MEGF11 antibodies

	Antibodies for MEGF11
	See all of Abcam's Antibodies, Kits and Proteins for MEGF11
	Custom Antibody / Protein Production Service
	Bulk Purchasing
	Advantages of Rabbit Monoclonal antibodies
	Abcam protocols and scientific support

Browse ProSpec Recombinant Proteins

	Proteins for MEGF11
	Antibodies for MEGF11
	ELISAs for MEGF11
	CLIAs for MEGF11

Search LifeMap BioReagents cell lines for MEGF11

	Gene Synthesis
	Protein Engineering
	Variant Library Synthesis
	Codon Optimization
	Protein Production and Purification

Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for MEGF11

	SwitchGear 3'UTR luciferase reporter plasmids for MEGF11
	SwitchGear Promoter luciferase reporter plasmids for MEGF11

Search ThermoFisher Antibodies for MEGF11

Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat MEGF11

	inGenious Targeting Laboratory - Custom generated mouse model solutions for MEGF11
	inGenious Targeting Laboratory - Custom generated inducible mouse model solutions for MEGF11

Customized:

	lentivirus for stable overexpression of MEGF11
	lentivirus expression plasmids for stable overexpression of MEGF11
	adenovirus for overexpression of MEGF11

LSBio Antibodies in human, mouse, rat for MEGF11

Customized transgenic rodents for:

	Humanization
	Biomarker expression
	Off-target effect monitoring
	Translational medicine
	Tissue-specific gene expresssion
	Time-controlled gene expresssion

GeneCards Homepage - Last full update: 23 Oct 2013 - Incrementals: 4 Nov 2013 , 7 Nov 2013 , 23 Jan 2014

View Random Gene

Category			TGFB1 (GIFtS: 73) transforming growth factor, beta 1
GIFtS Group

The GeneCards human gene database gene index: 1 3 5 6 A B C D E F G H I J K L M N O P Q R S T U V W X Y Z

The GeneCards Human Gene Database

Developed at the Crown Human Genome Center, Department of Molecular Genetics, the Weizmann Institute of Science

Hot genes Disease genes MEGF11 gene at Home site.

hostname: 356977-web1.xennexinc.com index build: 106 solr: 1.4

Advanced Search

Export list of displayed genes

MEGF11 Gene

Multiple EGF-Like-Domains 11

Aliases
for MEGF11 gene

Summaries
for MEGF11 gene

Genomic Views
for MEGF11 gene

Proteins
for MEGF11 gene

Protein Domains /
Families
for MEGF11 gene

Function
for MEGF11 gene

Pathways & Interactions
for MEGF11 gene

Drugs & Compounds
for MEGF11 gene

Transcripts
for MEGF11 gene

Expression
for MEGF11 gene

Orthologs
for MEGF11 gene

Paralogs
for MEGF11 gene

Genomic Variants
for MEGF11 gene

Disorders / Diseases
for MEGF11 gene

Publications
for MEGF11 gene

External Searches for MEGF11 gene

Genome Databases showing MEGF11 gene

Other Databases showing MEGF11 gene

Specialized Databases showing MEGF11 gene

Intellectual Property
for MEGF11 gene

Products
for MEGF11 gene

View Random Gene

Advanced Search

Export list of displayed genes

MEGF11 Gene

Multiple EGF-Like-Domains 11

Aliasesfor MEGF11 gene

Summariesfor MEGF11 gene

Genomic Viewsfor MEGF11 gene

Proteinsfor MEGF11 gene

Protein Domains /Familiesfor MEGF11 gene

Functionfor MEGF11 gene

Pathways & Interactionsfor MEGF11 gene

Drugs & Compoundsfor MEGF11 gene

Transcriptsfor MEGF11 gene

Expression for MEGF11 gene

Orthologsfor MEGF11 gene

Paralogsfor MEGF11 gene

Genomic Variantsfor MEGF11 gene

Disorders / Diseasesfor MEGF11 gene

Publicationsfor MEGF11 gene

External Searches for MEGF11 gene

Genome Databases showing MEGF11 gene

Other Databases showing MEGF11 gene

Specialized Databases showing MEGF11 gene

Intellectual Propertyfor MEGF11 gene

Productsfor MEGF11 gene

View Random Gene

Aliases
for MEGF11 gene

Summaries
for MEGF11 gene

Genomic Views
for MEGF11 gene

Proteins
for MEGF11 gene

Protein Domains /
Families
for MEGF11 gene

Function
for MEGF11 gene

Pathways & Interactions
for MEGF11 gene

Drugs & Compounds
for MEGF11 gene

Transcripts
for MEGF11 gene

Expression
for MEGF11 gene

Orthologs
for MEGF11 gene

Paralogs
for MEGF11 gene

Genomic Variants
for MEGF11 gene

Disorders / Diseases
for MEGF11 gene

Publications
for MEGF11 gene

Intellectual Property
for MEGF11 gene

Products
for MEGF11 gene