Set Analyses:
Advanced Search

Advanced Search

 
Search By
Section (entire)
for


 
or upload a file of gene symbols


Category   Symbol Source: HGNC EntrezGene Ensembl GeneCards RNA genes CroW21
GIFtS

MECP2 Gene

protein-coding   GIFtS: 69
GCID: GC0XM153287

Methyl CpG Binding Protein 2 (Rett Syndrome)

(Previous names: mental retardation, X-linked 16, mental retardation, X-linked...)
(Previous symbols: RTT, MRX16, MRX79)
  See related diseases
at  

(According to 1HGNC, 2Entrez Gene,
3UniProtKB/Swiss-Prot, 4UniProtKB/TrEMBL, 5OMIM, 6GeneLoc, 7Ensembl, 8DME, 9miRBase, 10fRNAdb, 12H-InvDB, 13NCBI, 14NONCODE, and/or 15RNAdb)
About This Section

This gene clusters with an RNA gene
Subcategory (RNA class): lncRNA

Quality score for the ORGUL clustered with this gene is 3

Aliases
Methyl CpG Binding Protein 2 (Rett Syndrome)1 2     PPMX2 5
MRX161 2 5     Mental Retardation, X-Linked 161
MRX791 2 5     Mental Retardation, X-Linked 791
RTT1 2 5     RS2
MeCp-2 Protein2 3     RTS2
AUTSX32 5     Methyl-CpG-Binding Protein 22
MRXS132 5     MeCp23
MRXSL2 5     

External Ids:    HGNC: 69901   Entrez Gene: 42042   Ensembl: ENSG000001690577   OMIM: 3000055   UniProtKB: P516083   
ORGUL members:         
NONCODE14:n337397      

Export aliases for MECP2 gene to outside databases

Previous GC identifers: GC0XM147424 GC0XM149742 GC0XM150872 GC0XM151755 GC0XM152808 GC0XM152940 GC0XM141928


(According to Entrez Gene, Tocris Bioscience, Wikipedia's Gene Wiki, PharmGKB,
UniProtKB/Swiss-Prot, and/or UniProtKB/TrEMBL)
About This Section

Entrez Gene summary for MECP2 Gene:
DNA methylation is the major modification of eukaryotic genomes and plays an essential role in mammalian
development. Human proteins MECP2, MBD1, MBD2, MBD3, and MBD4 comprise a family of nuclear proteins related by
the presence in each of a methyl-CpG binding domain (MBD). Each of these proteins, with the exception of MBD3, is
capable of binding specifically to methylated DNA. MECP2, MBD1 and MBD2 can also repress transcription from
methylated gene promoters. In contrast to other MBD family members, MECP2 is X-linked and subject to X
inactivation. MECP2 is dispensible in stem cells, but is essential for embryonic development. MECP2 gene
mutations are the cause of most cases of Rett syndrome, a progressive neurologic developmental disorder and one
of the most common causes of mental retardation in females. (provided by RefSeq, Jul 2009)

GeneCards Summary for MECP2 Gene: 
MECP2 (methyl CpG binding protein 2 (Rett syndrome)) is a protein-coding gene, and is affiliated with the lncRNA class. Diseases associated with MECP2 include rett syndrome, and classic rett syndrome, and among its related super-pathways are Synaptic Neurotransmission: GABAergic Inhibition and Macrophage Differentiation and Growth Inhibition by METS. GO annotations related to this gene include transcription factor binding and sequence-specific DNA binding transcription factor activity. An important paralog of this gene is MBD4.

UniProtKB/Swiss-Prot: MECP2_HUMAN, P51608
Function: Chromosomal protein that binds to methylated DNA. It can bind specifically to a single methyl-CpG pair.
It is not influenced by sequences flanking the methyl-CpGs. Mediates transcriptional repression through
interaction with histone deacetylase and the corepressor SIN3A

Gene Wiki entry for MECP2 Gene


(According to GeneLoc and/or HGNC, and/or
Entrez Gene (NCBI build 37),
and/or miRBase,
Genomic Views according to UCSC (hg19) and Ensembl (release 73), Regulatory elements and Epigenetics data according to QIAGEN, SABiosciences, and/or SwitchGear Genomics)
About This Section
RefSeq DNA sequence:
NC_000023.10  NT_167198.1  NC_018934.2  
Regulatory elements:
   SABiosciences Regulatory transcription factor binding sites in the MECP2 gene promoter:
         TBP   ISGF-3   Nkx2-5   IRF-1   STAT5A   NF-Y   CBF(2)   C/EBPalpha   
         Other transcription factors

SwitchGear Promoter luciferase reporter plasmids (see all 2): MECP2 promoter sequence
   Search SABiosciences Chromatin IP Primers for MECP2

Epigenetics:
QIAGEN PyroMark CpG Assay predesigned Pyrosequencing DNA Methylation assays in human, mouse, rat MECP2


Genomic Location:
Genomic View: UCSC Golden Path with GeneCards custom track

Entrez Gene cytogenetic band: Xq28   Ensembl cytogenetic band:  Xq28   HGNC cytogenetic band: Xq28

MECP2 Gene in genomic location: bands according to Ensembl, locations according to (and/or Entrez Gene and/or Ensembl if different)
MECP2 gene location

GeneLoc information about chromosome X         GeneLoc Exon Structure

GeneLoc location for GC0XM153287:  view genomic region     (about GC identifiers)

Start:
153,287,024 bp from pter      End:
153,402,578 bp from pter
Size:
115,555 bases      Orientation:
minus strand

(According to UniProtKB, HORDE, neXtProt, Ensembl, and/or Reactome, Modification sites according to PhosphoSitePlus, Specific Peptides from DME, Protein expression images according to data from SPIRE 1MOPED, 2PaxDb, and 3MAXQB RefSeq according to NCBI, PDB rendering according to OCA and/or Proteopedia, Recombinant Proteins from EMD Millipore, R&D Systems, GenScript, Enzo Life Sciences, OriGene, Novus Biologicals, Sino Biological, ProSpec, and/or Cloud-Clone Corp.,
Biochemical Assays by EMD Millipore, R&D Systems, OriGene, GenScript, Cell Signaling Technology, Enzo Life Sciences, and/or Cloud-Clone Corp., Ontologies according to Gene Ontology Consortium 01 Oct 2013 and Entrez Gene, Antibodies by EMD Millipore, R&D Systems, GenScript, Cell Signaling Technology, OriGene, Novus Biologicals, Thermo Fisher Scientific, LSBio, Abcam, and/or Cloud-Clone Corp.)
About This Section

UniProtKB/Swiss-Prot: MECP2_HUMAN, P51608 (See protein sequence)
Recommended Name: Methyl-CpG-binding protein 2  
Size: 486 amino acids; 52441 Da
Subunit: Interacts with FNBP3 (By similarity). Interacts with CDKL5
Subcellular location: Nucleus. Note=Colocalized with methyl-CpG in the genome
Sequence caution: Sequence=CAD97991.1; Type=Erroneous initiation;
2 PDB 3D structures from and Proteopedia for MECP2:
1QK9 (3D)        3C2I (3D)    
Secondary accessions: O15233 Q6QHH9 Q7Z384
Alternative splicing: 2 isoforms:  P51608-1   P51608-2   (Ten times higher expression levels than isoform A in brain)

Explore the universe of human proteins at neXtProt for MECP2: NX_P51608

Explore proteomics data for MECP2 at MOPED 

Post-translational modifications:

  • UniProtKB: Phosphorylated on Ser-423 in brain upon synaptic activity, which attenuates its repressor activity and seems to
    regulate dendritic growth and spine maturation (By similarity)
  • View modification sites using PhosphoSitePlus
  • View neXtProt modification sites for NX_P51608

  • MECP2 Protein expression data from MOPED1, PaxDb2 and MAXQB3 :    About this image 

    MECP2 Protein Expression
    REFSEQ proteins (2 alternative transcripts): 
    NP_001104262.1  NP_004983.1  

    ENSEMBL proteins: 
     ENSP00000301948   ENSP00000395535   ENSP00000384865   ENSP00000358973   ENSP00000416267  

    Human Recombinant Protein Products for MECP2: 
    Browse Purified and Recombinant Proteins at EMD Millipore
    Browse R&D Systems for human recombinant proteins
    Browse recombinant and purified proteins available from Enzo Life Sciences
    Browse OriGene full length recombinant human proteins expressed in human HEK293 cells
    OriGene Protein Over-expression Lysate for MECP2
    OriGene Custom MassSpec 
    OriGene Custom Protein Services for MECP2
    GenScript Custom Purified and Recombinant Proteins Services for MECP2
    Novus Biologicals MECP2 Proteins
    Novus Biologicals MECP2 Lysates
    Browse Sino Biological Recombinant Proteins
    Browse Sino Biological Cell Lysates 
    ProSpec Recombinant Protein for MECP2
    Cloud-Clone Corp. Proteins for MECP2 

    Gene Ontology (GO): 4 cellular component terms (GO ID links to tree view):    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0000792heterochromatin IDA11441023
    GO:0005634nucleus IDA--
    GO:0005737cytoplasm ----
    GO:0005829cytosol IEA--

    MECP2 for ontologies           About GeneDecksing



    MECP2 Antibody Products: 
    EMD Millipore Mono- and Polyclonal Antibodies for the study of MECP2
    Browse R&D Systems for Antibodies
    Cell Signaling Technology (CST) Antibodies for MECP2 
    OriGene Antibodies for MECP2
    OriGene Custom Antibody Services for MECP2
    GenScript Superior Antibodies for MECP2
    Novus Biologicals MECP2 Antibodies
    Abcam antibodies for MECP2
    Cloud-Clone Corp. Antibodies for MECP2 
    ThermoFisher Antibody for MECP2
    LSBio Antibodies in human, mouse, rat for MECP2 

    Assay Products for MECP2: 
    Browse Kits and Assays available from EMD Millipore
    OriGene Custom Assay Services for MECP2
    Browse R&D Systems for biochemical assays
    GenScript Custom Assay Services for MECP2
    Browse Enzo Life Sciences for kits & assays
    Cloud-Clone Corp. ELISAs for MECP2 
    Cloud-Clone Corp. CLIAs for MECP2


    (According to HGNC, IUPHAR, InterPro, ProtoNet, UniProtKB, and/or BLOCKS, Sets of similar genes according to GeneDecks)
    About This Section
    4 InterPro protein domains:
     IPR017956 AT_hook_DNA-bd_motif
     IPR001739 Methyl_CpG_DNA-bd
     IPR017353 Me_CpG-bd_MeCP2
     IPR016177 DNA-bd_integrase-typ

    Graphical View of Domain Structure for InterPro Entry P51608

    ProtoNet protein and cluster: P51608

    1 Blocks protein domain: IPB001739 Methyl-CpG binding

    UniProtKB/Swiss-Prot: MECP2_HUMAN, P51608
    Similarity: Contains 2 A.T hook DNA-binding domains
    Similarity: Contains 1 MBD (methyl-CpG-binding) domain


    MECP2 for domains           About GeneDecksing


    (According to 1UniProtKB, Genatlas, LifeMap Discovery™, IUBMB, and/or 2DME, Human phenotypes from GenomeRNAi, Animal models from MGI Mar 06 2013, inGenious Targeting Laboratory, genOway,
    bound targets from SABiosciences, miRNA Gene Targets from miRTarBase, shRNA from OriGene, RNAi from EMD Millipore, siRNAs from OriGene, QIAGEN, microRNA from QIAGEN, Gene Editing from DNA2.0, Sirion Biotech, Clones from EMD Millipore, OriGene, SwitchGear Genomics, GenScript, Sino Biological, DNA2.0, Vector BioLabs, and Sirion Biotech, Cell Lines from GenScript, LifeMap BioReagents, In Situ Hybridization Assays from Advanced Cell Diagnostics, Ontologies according to Gene Ontology Consortium 01 Oct 2013 via Entrez Gene.)
    About This Section

    Molecular Function:

         UniProtKB/Swiss-Prot Summary: MECP2_HUMAN, P51608
    Function: Chromosomal protein that binds to methylated DNA. It can bind specifically to a single methyl-CpG pair.
    It is not influenced by sequences flanking the methyl-CpGs. Mediates transcriptional repression through
    interaction with histone deacetylase and the corepressor SIN3A

         Genatlas biochemistry entry for MECP2:
    methyl CpG-binding protein 2,abundant chromosomal protein,murine Mecp2 homolog,that selectivity binds 5'methyl
    cytosine residues in symmetrically positioned GpG dinucleotides,preferentially in the promoter regions of genes
    subject to transcriptional silencing after DNA methylation,interacting with histone deacetylase and the
    transcriptional corepressor SIN3A,involved in the regulation of gene expression

         Gene Ontology (GO): 5/12 molecular function terms (GO ID links to tree view) (see all 12):    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0003677DNA binding TAS9620804
    GO:0003682chromatin binding IEA--
    GO:0003700sequence-specific DNA binding transcription factor activity IEA--
    GO:0003714transcription corepressor activity TAS10773092
    GO:0003729mRNA binding IEA--
         
    MECP2 for ontologies           About GeneDecksing


    Phenotypes:
         15/20 MGI mutant phenotypes (inferred from 20 alleles(MGI details for Mecp2) (see all 20):
     adipose tissue  behavior/neurological  cellular  craniofacial  embryogenesis 
     endocrine/exocrine gland  growth/size  hearing/vestibular/ear  homeostasis/metabolism  immune system 
     integument  liver/biliary system  mortality/aging  nervous system  no phenotypic analysis 

    MECP2 for phenotypes           About GeneDecksing

    Animal Models:
         MGI mouse knock-outs for MECP2: Mecp2tm1Pplt Mecp2tm1.1Jae Mecp2tm1Jchr Mecp2tm1Hzo Mecp2tm1.1Bird

       inGenious Targeting Laboratory - Custom generated mouse model solutions for MECP2 
       inGenious Targeting Laboratory - Custom generated inducible mouse model solutions for MECP2

       genOway customized KO model: permanent, tissue-specific or time-controlled inactivation for MECP2 
       genOway customized Knockin model: humanization, point mutation, expression monitoring, etc. for MECP2 

    miRNA
    Products:
        
    miRTarBase miRNAs that target MECP2:
    hsa-mir-199b-3p (MIRT004396), hsa-mir-155 (MIRT000442), hsa-mir-212 (MIRT003897), hsa-mir-122 (MIRT003089), hsa-mir-19a (MIRT001795), hsa-mir-195 (MIRT000795), hsa-mir-802 (MIRT000441), hsa-mir-199a-5p (MIRT004395)

    QIAGEN Custom miScript Target Protector blocks miRNA-binding site of human, mouse, rat MECP2
    8/100 QIAGEN miScript miRNA Assays for microRNAs that regulate MECP2 (see all 100):
    hsa-miR-194* hsa-miR-548j hsa-miR-520f hsa-miR-361-5p hsa-miR-3607-3p hsa-miR-199a-3p hsa-miR-106a hsa-miR-218-1*
    Browse SwitchGear 3'UTR luciferase reporter plasmids
    Inhib. RNA
    Products:
        
    Browse for Gene Knock-down Tools from EMD Millipore
    OriGene RNAi products in human, mouse, rat for MECP2
    QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat MECP2

    Gene Editing
    Products:
    DNA2.0 Custom Protein Engineering Service for MECP2
    Sirion Biotech Customized adenovirus for overexpression of MECP2

    Clone
    Products:
         
    Browse Clones for the Expression of Recombinant Proteins Available from EMD Millipore
    OriGene clones in human, mouse for MECP2 (see all 12)
    OriGene ORF clones in mouse, rat for MECP2
    OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
    GenScript: all cDNA clones in your preferred vector (see all 2): MECP2 (NM_004992)
    Sino Biological Human cDNA Clone for MECP2
    DNA2.0 Custom Codon Optimized Gene Synthesis Service for MECP2
    Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat MECP2
    Sirion Biotech Customized lentivirus for stable overexpression of MECP2 
                         Customized lentivirus expression plasmids for stable overexpression of MECP2 

    Cell Line
    Products:
         
    GenScript Custom overexpressing Cell Line Services for MECP2
    Search LifeMap BioReagents cell lines for MECP2
    In Situ Assay
    Products:
       

     
    Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for MECP2


    (Pathways according to EMD Millipore, R&D Systems, Cell Signaling Technology, KEGG, PharmGKB, BioSystems, Sino Biological, Reactome, Tocris Bioscience, GeneGo (Thomson Reuters), QIAGEN, and/or UniProtKB, Sets of similar genes according to GeneDecks, Interaction Networks according to SABiosciences, and/or STRING, Interactions according to 1UniProtKB, 2MINT, 3I2D, and/or 4STRING, with links to IntAct and Ensembl, Ontologies according to Gene Ontology Consortium 01 Oct 2013 via Entrez Gene).
    About This Section

    SuperPaths for MECP2 About                                                                                                See pathways by source

    SuperPathContained pathways About
    1GABA A receptor activation
    GABA signaling in brain0.32
    2DNA Methylation and Transcriptional Repression
    DNA Methylation and Transcriptional Repression0.30
    3SIDS Susceptibility Pathways
    SIDS Susceptibility Pathways
    4Neuroscience
    Neuroscience
    5Chromatin Regulation / Acetylation
    Chromatin Regulation / Acetylation

    Pathways by source                                                                                                                                                                 See SuperPaths
    Show all pathways

    1 EMD Millipore Pathway for MECP2
        GABA signaling in brain

    1 Downloadable PowerPoint Slide of QIAGEN Pathway Central Maps for MECP2
        DNA Methylation and Transcriptional Repression

    2 Cell Signaling Technology (CST) Pathways for MECP2
        Chromatin Regulation / Acetylation
    Neuroscience

    1 BioSystems Pathway for MECP2
        SIDS Susceptibility Pathways




    MECP2 for pathways           About GeneDecksing

    Interactions:

        SABiosciences Gene Network CentralTM Interacting Genes and Proteins Network for MECP2

    STRING Interaction Network Preview (showing 5 interactants - click image to see 25)

    5/53 Interacting proteins for MECP2 (P516081, 2, 3 ENSP000003955354) via UniProtKB, MINT, STRING, and/or I2D (see all 53)
    InteractantInteraction Details
    GeneCardExternal ID(s)
    SMARCA2P515311, 3, ENSP000002657734EBI-1189067,EBI-679562 I2D: score=5 STRING: ENSP00000265773
    HIPK2Q9H2X62, 3MINT-7308929 MINT-7308914 I2D: score=1 
    HIST2H3AQ71DI33, ENSP000003854794I2D: score=1 STRING: ENSP00000385479
    HIST2H3CQ71DI33I2D: score=1 
    HIST2H3DQ71DI33I2D: score=1 
    About this table

    Gene Ontology (GO): 5/57 biological process terms (GO ID links to tree view) (see all 57):    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0000122negative regulation of transcription from RNA polymerase II promoter TAS9620804
    GO:0001662behavioral fear response IEA--
    GO:0001666response to hypoxia IEA--
    GO:0001964startle response IEA--
    GO:0001976neurological system process involved in regulation of systemic arterial blood pressure IEA--

    MECP2 for ontologies           About GeneDecksing



    (Chemical Compounds according to UniProtKB, Enzo Life Sciences, EMD Millipore, Tocris Bioscience HMDB, BitterDB, and/or Novoseek, Ligands according to IUPHAR, and Drugs according to DrugBank, Enzo Life Sciences, and/or PharmGKB, with drugs/clinical trials/news search links to CenterWatch)
    About This Section

    MECP2 for compounds           About GeneDecksing

    Browse Small Molecules at EMD Millipore
    Browse drugs & compounds from Enzo Life Sciences

    Browse Tocris compounds for MECP2

    10/18 Novoseek inferred chemical compound relationships for MECP2 gene (see all 18)    About this table
    Compound   -log (P-Val)   Hits   PubMed IDs for Articles with Shared Sentences (# sentences)
    5-aza-2'deoxycytidine 64.5 2 15247904 (1), 16848908 (1)
    cytosine 53.2 3 10390525 (1), 10319871 (1), 18313390 (1)
    5-methylcytosine 41.6 6 11331619 (1), 15917437 (1), 17309881 (1)
    hpaii 17.5 2 11691937 (2)
    azathioprine 13.9 1 17036333 (1)
    valproate 6.55 1 15870696 (1)
    gaba 6.37 5 17363207 (1), 18302128 (1)
    folate 3.82 5 18058624 (1), 12939425 (1)
    oligonucleotide 0 2 19324899 (1), 15689352 (1)
    guanosine 0 3 11453972 (1)

    Search CenterWatch for drugs/clinical trials and news about MECP2

    (Secondary structures according to fRNAdb,
    GenBank/EMBL/DDBJ Accessions according to
    Unigene (Build 236 Homo sapiens; Apr 25 2013) or GenBank,
    RefSeq according to Entrez Gene,
    DOTS (version 10), and/or AceView, transcript ids from Ensembl with links to UCSC,
    Conferences by KenesGroup, exon structure from GeneLoc, alternative splicing isoforms according to ASD and/or ECgene,
    RNAi Products from EMD Millipore,
    siRNAs from OriGene, QIAGEN, shRNA from OriGene, microRNA from QIAGEN,
    Tagged/untagged cDNA clones from OriGene, SwitchGear Genomics, GenScript, DNA2.0, Vector BioLabs, Sirion Biotech, Primers from OriGene, SABiosciences, and/or QIAGEN )
    About This Section

    REFSEQ mRNAs for MECP2 gene (2 alternative transcripts): 
    NM_001110792.1  NM_004992.3  

    Unigene Clusters for MECP2:

    Methyl CpG binding protein 2 (Rett syndrome)
    Hs.200716  [show with all ESTs], Hs.702514  [show with all ESTs]
    Unigene Representative Sequences: GQ203295, HQ154629
    14 Ensembl transcripts including schematic representations, and UCSC links where relevant:
    ENST00000303391(uc004fjv.2 uc004fjw.2) ENST00000453960 ENST00000407218
    ENST00000486506 ENST00000369957 ENST00000496908 ENST00000464075 ENST00000495474
    ENST00000480620 ENST00000481807 ENST00000488293 ENST00000463644 ENST00000460227
    ENST00000415944
    miRNA
    Products:
         
    QIAGEN Custom miScript Target Protector blocks miRNA-binding site of human, mouse, rat MECP2
    8/100 QIAGEN miScript miRNA Assays for microRNAs that regulate MECP2 (see all 100):
    hsa-miR-194* hsa-miR-548j hsa-miR-520f hsa-miR-361-5p hsa-miR-3607-3p hsa-miR-199a-3p hsa-miR-106a hsa-miR-218-1*
    Browse SwitchGear 3'UTR luciferase reporter plasmids
    Inhib. RNA
    Products:
         
    Browse for Gene Knock-down Tools from EMD Millipore
    OriGene RNAi products in human, mouse, rat for MECP2
    QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat MECP2
    Clone
    Products:
         
    OriGene clones in human, mouse for MECP2 (see all 12)
    OriGene ORF clones in mouse, rat for MECP2
    OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
    GenScript: all cDNA clones in your preferred vector (see all 2): MECP2 (NM_004992)
    DNA2.0 Custom Codon Optimized Gene Synthesis Service for MECP2
    Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat MECP2
    Sirion Biotech Customized lentivirus for stable overexpression of MECP2 
                         Customized lentivirus expression plasmids for stable overexpression of MECP2 
    Primer
    Products:
        
    OriGene qSTAR qPCR primer pairs in human, mouse for MECP2
    SABiosciences RT2 qPCR Primer Assay in human, mouse, rat MECP2
      QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat MECP2
      QIAGEN QuantiFast Probe-based Assays in human, mouse, rat MECP2

    Additional mRNA sequence: 

    DQ656051.2 HQ154629.1 

    15 DOTS entries:

    DT.92046808  DT.92434186  DT.453173  DT.100798087  DT.92434188  DT.100730813  DT.121294059  DT.100798090 
    DT.121294481  DT.100831459  DT.121294031  DT.121294333  DT.75101285  DT.86846848  DT.91868594 

    24/269 AceView cDNA sequences (see all 269):

    AA832448 AA888593 BX281740 BI821242 BM671070 BC031833 AL157555 BM893890 
    AI003203 R09924 Z41666 BU679576 AI611806 AI381864 AA543089 BU902034 
    BM263171 AW025137 AW407215 AI224490 BM967227 AI866995 BM986904 AY541280 

    GeneLoc Exon Structure

    4 Alternative Splicing Database (ASD) splice patterns (SP) for MECP2    About this scheme

    ExUns: 1 ^ 2 ^ 3 ^ 4 ^ 5 ^ 6
    SP1:        -           -               
    SP2:        -     -     -               
    SP3:                                    
    SP4:                                    


    ECgene alternative splicing isoforms for MECP2

    (RNA expression data according to H-InvDB, NONCODE, miRBase, and RNAdb, Expression images according to data from BioGPS, Illumina Human BodyMap, and CGAP SAGE, Sets of similar genes according to GeneDecks, in vivo and in vitro expression data from LifeMap Discovery™, plus additional links to Genevestigator, and/or SOURCE, and/or BioGPS, and/or UniProtKB,
    PCR Arrays from SABiosciences, Primers from OriGene, SABiosciences, and/or QIAGEN, In Situ Hybridization Assays from Advanced Cell Diagnostics)
    About This Section

    MECP2 expression in normal human tissues (normalized intensities)      MECP2 embryonic expression: see
    See probesets specificity/sensitivity at GeneAnnot
    About this imageBioGPS <intensity>2/3
    CGAP TAG: CCAAGGCCAA
    MECP2 Expression
    About this image


    MECP2 expression in embryonic tissues and stem cells    About this table
    Data from LifeMap, the Embryonic Development and Stem Cells Database 
     5/37 selected tissues (see all 37) fully expand
     
     Brain (Nervous System)    fully expand to see all 14 entries
             Thalamus
             Olfactory Bulb   
     
     Uterus (Reproductive System)    fully expand to see all 5 entries
             uterus, post-menopause ; glandular cells   
     
     Lung (Respiratory System)    fully expand to see all 4 entries
             Stem Bronchi
             lung ; pneumocytes   
     
     Testis (Reproductive System)    fully expand to see all 4 entries
             Leydig Cells Testis Interstitium
             seminal vesicle ; glandular cells   
     
     Epithelium
             vagina ; squamous epithelial cells   

    See MECP2 Protein Expression from SPIRE MOPED and PaxDB
    Genevestigator expression for MECP2

    SOURCE GeneReport for Unigene clusters: Hs.200716 Hs.702514

    UniProtKB/Swiss-Prot: MECP2_HUMAN, P51608
    Tissue specificity: Present in all adult somatic tissues tested

        SABiosciences Expression via Pathway-Focused PCR Array including MECP2: 
              Epigenetic Chromatin Remodeling Factors in human mouse rat

    Primer
    Products:
    OriGene qSTAR qPCR primer pairs in human, mouse for MECP2
    SABiosciences RT2 qPCR Primer Assay in human, mouse, rat MECP2
    QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat MECP2
    QIAGEN QuantiFast Probe-based Assays in human, mouse, rat MECP2
    In Situ
    Assay Products:
     

     
    Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for MECP2

    (Orthologs according to 1,2HomoloGene (2older version, for species not in 1newer version), 3euGenes, 4SGD , 5MGI Mar 06 2013, with possible further links to Flybase and/or WormBase, and/or 6Ensembl pan taxonomic compara , Gene Trees according to Ensembl and TreeFam)
    About This Section

    This gene was present in the common ancestor of chordates.

    Orthologs for MECP2 gene from 4/11 species (see all 11)    About this table
    Organism Taxonomic
    classification
    Gene Description Human
    Similarity
    Orthology
    Type
    Details
    mouse
    (Mus musculus)
    Mammalia Mecp21 , 5 methyl CpG binding protein 21, 5 90.89(n)1
    95.75(a)1
      X (37.63 cM)5
    172571  NM_001081979.11  NP_001075448.11 
     740265925 
    lizard
    (Anolis carolinensis)
    Reptilia MECP26
    methyl CpG binding protein 2 (Rett syndrome)
    65(a)
    1 ↔ 1
    2(88474297-88595647)
    African clawed frog
    (Xenopus laevis)
    Amphibia MECP22 methyl-CpG-binding protein MeCP2 76.69(n)    AF106951.1 
    zebrafish
    (Danio rerio)
    Actinopterygii wufk96a042 Danio rerio methyl-cytosine binding protein 2 (mecp2) more 74.06(n)    AY298900.2 


    ENSEMBL Gene Tree for MECP2 (if available)
    TreeFam Gene Tree for MECP2 (if available)

    (Paralogs according to 1HomoloGene,
    2Ensembl, and 3SIMAP, Pseudogenes according to 4Pseudogene.org Build 68)
    About This Section
    Paralogs for MECP2 gene
    MBD42  
    1 SIMAP similar gene for MECP2 using alignment to 17 protein entries:     MECP2_HUMAN (see all proteins):
    MBD4

    MECP2 for paralogs           About GeneDecksing



    (SNPs/Variants according to the 1NCBI SNP Database, 2Ensembl, 3PupaSUITE, 4UniProtKB, and DNA2.0, Linkage Disequilibrium by HapMap, Structural Variations(CNVs/InDels/Inversions) from the Database of Genomic Variants, Mutations from the Human Gene Mutation Database (HGMD) and the Locus Specific Mutation Databases (LSDB), Blood group antigen gene mutations by BGMUT, Resequencing Primers from QIAGEN, Cancer Mutation PCR Arrays and Assays and Copy Number PCR Arrays from SABiosciences)
    About This Section

    1147/1574 SNPs in MECP2 are shown (see all 1574)    About this table     
    Genomic DataTranscription Related DataAllele Frequencies
    SNP IDValidClinical
    significance
    Chr X posSequence#AA
    Chg
    TypeMore#Allele
    freq
    PopTotal
    sample
    More
    ----------
    VAR_0182064
    Rett syndrome (RTT)4--see VAR_0182062 P A mis40--------
    VAR_0235574
    Rett syndrome (RTT)4--see VAR_0235572 T A mis40--------
    VAR_0376654
    Mental retardation, X-linked, syndromic, 13 (MRXS13)4--see VAR_0376652 P S mis40--------
    VAR_0181984
    Rett syndrome (RTT)4--see VAR_0181982 P R mis40--------
    VAR_0181904
    Rett syndrome (RTT)4--see VAR_0181902 K E mis40--------
    VAR_0235524
    Rett syndrome (RTT)4--see VAR_0235522 D E mis40--------
    VAR_0102764
    Rett syndrome (RTT)4--see VAR_0102762 P R mis40--------
    VAR_0235584
    Rett syndrome (RTT)4--see VAR_0235582 G V mis40--------
    VAR_0181804
    Rett syndrome (RTT)4--see VAR_0181802 E Q mis40--------
    VAR_0102784
    Rett syndrome (RTT)4--see VAR_0102782 S C mis40--------
    VAR_0181874
    Rett syndrome (RTT)4--see VAR_0181872 R G mis40--------
    VAR_0181894
    Rett syndrome (RTT)4--see VAR_0181892 R H mis40--------
    VAR_0181924
    Mental retardation, X-linked, syndromic, 13 (MRXS13)4--see VAR_0181922 R W mis40--------
    VAR_0235554
    Rett syndrome (RTT)4--see VAR_0235552 Y D mis40--------
    VAR_0235564
    Rett syndrome (RTT)4--see VAR_0235562 F I mis40--------
    VAR_0182094
    Rett syndrome (RTT)4--see VAR_0182092 P R mis40--------
    VAR_0235544
    Rett syndrome (RTT)4--see VAR_0235542 P S mis40--------
    VAR_0102774
    Rett syndrome (RTT)4--see VAR_0102772 L F mis40--------
    VAR_0181884
    Rett syndrome (RTT)4--see VAR_0181882 Q P mis40--------
    VAR_0181974
    Rett syndrome (RTT)4--see VAR_0181972 K I mis40--------
    VAR_0182134
    Rett syndrome (RTT)4--see VAR_0182132 P L mis40--------
    VAR_0182084
    Rett syndrome (RTT)4--see VAR_0182082 P L mis40--------
    VAR_0181854
    Rett syndrome (RTT)4--see VAR_0181852 P T mis40--------
    VAR_0181914
    Rett syndrome (RTT)4--see VAR_0181912 D G mis40--------
    VAR_0181834
    Rett syndrome (RTT)4--see VAR_0181832 P H mis40--------
    VAR_0182074
    Rett syndrome (RTT)4--see VAR_0182072 P H mis40--------
    VAR_0182114
    Rett syndrome (RTT)4--see VAR_0182112 R H mis40--------
    VAR_0181844
    Rett syndrome (RTT)4--see VAR_0181842 P L mis40--------
    VAR_0181864
    Rett syndrome (RTT)4--see VAR_0181862 R Q mis40--------
    VAR_0235534
    Rett syndrome (RTT)4--see VAR_0235532 L R mis40--------
    VAR_0376644
    Mental retardation, X-linked, syndromic, 13 (MRXS13)4--see VAR_0376642 P L mis40--------
    VAR_0182104
    Rett syndrome (RTT)4--see VAR_0182102 K R mis40--------
    VAR_0182144
    Rett syndrome (RTT)4--see VAR_0182142 R W mis40--------
    VAR_0182034
    Mental retardation, X-linked, syndromic, 13 (MRXS13)4--see VAR_0182032 K E mis40--------
    VAR_0175814
    Mental retardation, X-linked, syndromic, 13 (MRXS13)4--see VAR_0175812 E G mis40--------
    VAR_0182254
    Mental retardation, X-linked, syndromic, 13 (MRXS13)4--see VAR_0182252 R Q mis40--------
    VAR_0181824
    Rett syndrome (RTT)4--see VAR_0181822 D Y mis40--------
    VAR_0102804
    Rett syndrome (RTT)4--see VAR_0102802 P R mis40--------
    VAR_0182124
    Rett syndrome (RTT)4--see VAR_0182122 P A mis40--------
    rs289354681,2,4
    CRett syndrome (RTT)4 pathogenic1153164502(-) AGAAGC/TGCAAG 6 R C mis1 ese32Minor allele frequency- T:0.00NA 4
    rs289349061,2,4
    CRett syndrome (RTT)4 pathogenic1153164945(-) CTTCAC/TGGTAA 6 T M mis1 ese32Minor allele frequency- T:0.00NA 4
    rs289349051,2,4
    CRett syndrome (RTT)4 pathogenic1153164954(-) TGATTC/G/TTGACT 9 S C F mis10--------
    rs289349081,2,4
    CMental retardation, X-linked, syndromic, 13 (MRXS13)4 pathogenic1153164999(-) GATTGC/TGTACT 6 A V mis1 ese30--------
    rs289349041,2,4
    CRett syndrome (RTT)4 pathogenic1153165021(-) CCTTTC/G/TGCTCT 9 R G C mis12NA 4
    rs289349071,2,4
    CRett syndrome (RTT)4 pathogenic1153165858(-) GGACAC/G/TGGAAG 9 R G W mis1 ese32NA 4
    rs289351681,2,4
    CRett syndrome (RTT)4 pathogenic1153165876(-) CCACCC/GTGCCT 6 L V mis1 ese30--------
    rs1048948641,2
    Cpathogenic1153164055(-) GAGGGG/TAGGGA 6 E * stg10--------
    rs617539711,2
    Cpathogenic1153164136(-) GCGACA/GGCTGC 6 S G mis10--------
    rs617539651,2
    Cpathogenic1153164202(-) AGCCCC/TAGGAC 6 Q * stg10--------
    rs617514491,2
    Cpathogenic1153164454(-) TGAAGC/G/TCCCTG 9 P A S mis10--------
    rs617513621,2
    Cpathogenic1153164538(-) CTATCC/TGATCT 6 R * stg10--------
    rs617502401,2
    Cpathogenic1153164610(-) GGGGCC/G/TGAAAG 9 R G * mis1 stg10--------
    rs617497211,2
    Cpathogenic1153164655(-) GGAAGC/TGAAAA 6 R * stg10--------
    rs617497151,2
    Cpathogenic1153164744(-) GATGCC/G/TTTTTC 9 P R L mis10--------
    rs617484211,2
    Cpathogenic1153164916(-) CCCGGC/TGAGAG 6 R * stg10--------
    rs1793639001,2
    Cpathogenic1153164964(-) TGGACC/GCTAAT 6 P A mis10--------
    rs617483961,2
    Cpathogenic1153164995(-) GCGTAA/C/GTTCGA 9 * Y stg10--------
    rs617483921,2
    Cpathogenic1153165008(-) AGTGGA/GGTTGA 6 E G mis10--------
    rs1939226781,2
    Cprobable-pathogenic1153163977(-) CGCCCA/GTGACC 6 M V mis10--------
    rs617514451,2
    Cprobable-pathogenic1153164486(-) GGAGAC/TGGTCA 6 T M mis10--------
    rs617514391,2
    Cprobable-pathogenic1153164509(-) CCCATC/GAAGAA 6 I M mis10--------
    rs617513701,2
    Cprobable-pathogenic1153164520(-) AGACCA/GTACTC 6 I V mis10--------
    rs30279151,2
    C,Funtested1153156101(+) TTTGCT/GGGCGA 2 -- ut31 ese31Minor allele frequency- G:0.03NA 92
    rs30279171,2
    C,F,Huntested1153156209(+) TGGAGG/AATGGG 2 -- ut319Minor allele frequency- A:0.04NS EA NA 1088
    rs2021391041,2
    Cuntested1153158469(+) TACAG-/ATATATA 2 -- ut310--------
    rs2676083461,2
    Cuntested1153158609(-) ACACAC/TAGACT 2 -- ut310--------
    rs30279201,2
    Cuntested1153159381(+) GGTTTG/TCCTTC 2 -- ut31 trp30--------
    rs1482308891,2
    Cuntested1153160079(+) CATCAC/GTGTCA 2 -- ut310--------
    rs560361771,2
    Cuntested1153160480(+) GAGCTC/TGACGA 2 -- ut310--------
    rs30279211,2
    C,F,Huntested1153161300(+) GAGTTC/TGAGGC 2 -- ut31 ese34Minor allele frequency- T:0.01NS NA 324
    rs30279221,2
    C,F,Huntested1153162220(+) GGTACC/TGCTAC 2 -- ut318Minor allele frequency- T:0.08NS NA 1294
    rs30279241,2
    C,Funtested1153163079(+) TCACAC/GACTGC 2 -- ut31 ese33Minor allele frequency- G:0.33NA WA 6
    rs1876144381,2
    Cuntested1153163096(+) TGATTA/CGGAAT 2 -- ut310--------
    rs1909205751,2
    Cuntested1153163126(+) TCTGCC/GCGGCC 2 -- ut310--------
    rs1833490221,2
    Cuntested1153163413(+) GGGATC/TGCACA 3 -- ut31 ds50010--------
    rs1115655191,2
    Cuntested1153163468(+) TGTCTC/GTCCTG 3 -- ut31 ds50010--------
    rs1878510591,2
    Cuntested1153163586(+) CTGCTC/GTGTCG 3 -- ut31 ds50010--------
    rs626216751,2
    Cuntested1153163594(-) AGACAC/GAGCGA 3 -- ut31 ds50010--------
    rs626216741,2
    C,Funtested1153163598(-) TTAGAC/GACAGA 3 -- ut31 ds50010--------
    rs626216731,2
    Cuntested1153163629(-) CTCCCA/GCCCAA 3 -- ut31 ds50010--------
    rs626216721,2
    Cuntested1153163865(-) CTTCCC/G/TGATTA 6 -- ut310--------
    rs1999639921,2
    Cuntested1153163943(+) CAATCC/TGCTCC 3 -- ut310--------
    rs1440089951,2
    Cuntested1153163948(+) CGCTCC/TGTGTA 3 -- ut310--------
    rs2676086421,2
    Cuntested1153163957(-) AGCTGA/C/GCTTTA 9 * C W --0--------
    rs768950941,2
    Cuntested1153163972(-) GTGACC/TGAGAG 6 T syn10--------
    rs2676086351,2
    Cuntested1153163982(-) CCGGAC/TGCCCG 6 T M mis10--------
    rs1859575131,2
    Cuntested1153164045(+) CTTTGC/TGCTCT 6 H R mis10--------
    rs30279271,2
    C,Funtested1153164083(+) GCGGCC/TGTGGC 6 T syn1 ese31Minor allele frequency- T:0.01NA 4552
    rs617539751,2,4
    Cuntested1153164088(-) CCGCCA/GCCACG 6 T A mis10--------
    rs617513631,2
    Cuntested1153164092(-) GCCACC/TGCCGC 6 T syn11Minor allele frequency- T:0.00NA 4548
    rs617539731,2
    Cuntested1153164103(-) AGCCCA/GCGGTT 6 T A mis10--------
    rs617539701,2
    Cuntested1153164152(-) GGAGGC/TTCACT 6 G syn10--------
    rs617539661,2,4
    Cuntested1153164184(-) GCAGCG/ATCTGC 6 /I /V mis11Minor allele frequency- A:0.00NA 4284
    rs30279281,2
    C,Funtested1153164185(+) CAGACG/ACTGCT 6 /S syn1 ese31Minor allele frequency- A:0.00NA 4216
    rs635868601,2
    C,Funtested1153164212(-) AGCCCC/TCCTGA 6 P syn11Minor allele frequency- T:0.00NA 3160
    rs617530141,2
    Cuntested1153164213(-) CAGCCC/TCCCTG 6 P L mis10--------
    rs617530121,2
    C,Funtested1153164221(-) GACCCC/TACCAG 6 P syn11Minor allele frequency- T:0.00NA 2810
    rs2676083271,2
    Cuntested1153164221(-) ACCCC-/TGCCCCCACCTCCACCTGA
    GCCCGAGAGCTCCGAGGACCCC
    ACCAG
    6 H LPPPPPEPESSEDP fra10--------
    rs562684391,2,4
    C,Funtested1153164229(+) GTCCTA/C/TGGAGC 9 K E * mis1 stg12CSA NA 2477
    rs630946621,2
    Cuntested1153164238(-) AGCCCA/G/TAGAGC 9 K E * mis1 stg10--------
    rs617530001,2
    Cuntested1153164256(-) TGCCCC/G/TCACCT 6 P S mis10--------
    rs617502461,2
    Cuntested1153164257(-) CTGCCC/TCCACC 6 P syn10--------
    rs2676085721,2
    Cuntested1153164280(-) CCCCCA/GTGCCA 6 M V mis10--------
    rs617529801,2
    Cuntested1153164281(-) GCCCCC/TGTGCC 6 P syn10--------
    rs2013149101,2
    Cuntested1153164285(+) CGGGGA/C/GCCTTT 9 A G V mis10--------
    rs617523871,2
    Cuntested1153164292(-) AGTCCC/TCAAAG 6 P S mis10--------
    rs617523711,2
    Cuntested1153164343(-) GCGCCC/TCCTCA 6 P S mis10--------
    rs617502361,2
    Cuntested1153164347(-) AGCAGC/TGCCTC 6 S syn10--------
    rs617483871,2
    C,Funtested1153164357(-) GGGGCA/G/TCAGCA 9 H R L mis11NA 3598
    rs617523621,2
    C,Funtested1153164383(-) CGGAAA/GAGCAA 6 K syn11Minor allele frequency- G:0.00NA 4222
    rs617523611,2
    Cuntested1153164388(-) CTGGGC/TGGAAA 6 R W mis10--------
    rs1487448941,2
    Cuntested1153164422(+) TTCCCG/ACTCTT 6 /S syn11Minor allele frequency- A:0.00NA 4526
    rs2018711831,2
    Cuntested1153164433(+) CTCACC/TGAGGG 6 S G mis10--------
    rs617514421,2
    Cuntested1153164434(-) ACCCTA/C/TGGTGA 9 L syn10--------
    rs617514461,2
    Cuntested1153164476(-) AGCATC/TGAGGT 6 I syn10--------
    rs617514431,2
    Cuntested1153164501(-) GAAGCA/G/TCAAGA 9 H R L mis10--------
    rs617514381,2
    Cuntested1153164512(-) CTCCCC/GATCAA 6 P syn10--------
    rs617497231,2
    Cuntested1153164513(-) ACTCCA/C/G/
            
    CATCA
    12 H P R L mis10--------
    rs617513731,2
    Cuntested1153164514(-) TACTCA/C/G/
            
    CCATC
    12 T P A S mis10--------
    rs617484231,2
    C,Funtested1153164521(-) GAGACC/TGTACT 6 T syn11Minor allele frequency- T:0.00NA 4548
    rs617502571,2
    Cuntested1153164559(-) AGAAAC/GCCGTG 6 P A mis10--------
    rs617502531,2
    C,Funtested1153164569(-) GAGGCC/GAAAAA 6 A syn11Minor allele frequency- G:0.00NA 4526
    rs617502521,2
    Cuntested1153164575(-) GCCGCC/TGAGGC 6 A syn11Minor allele frequency- T:0.00NA 4470
    rs617502511,2
    Cuntested1153164578(-) GCTGCC/TGCCGA 6 A syn10--------
    rs617502481,2
    Cuntested1153164584(-) GCAGCC/TGCTGC 6 A syn11Minor allele frequency- T:0.00NA 4322
    rs617502451,2
    Cuntested1153164599(-) CCGGGG/TAGTGT 6 G syn11Minor allele frequency- T:0.00NA 4338
    rs617502391,2
    Cuntested1153164616(-) AGAAAC/TGGGGC 6 R W mis11Minor allele frequency- T:0.00NA 4276
    rs10428701,2
    C,Funtested1153164641(-) GAGGCC/TGACCC 6 A syn1 ese32Minor allele frequency- T:0.00NS NA 4326
    rs635820631,2
    Cuntested1153164665(-) CGCCCC/TGGCAG 6 P syn11Minor allele frequency- T:0.00NA 4226
    rs617484241,2
    Cuntested1153164668(-) AAACGA/C/TCCCGG 9 R syn10--------
    rs617497521,2
    Cuntested1153164669(-) CAAAC-/C/TGCCCC 9 R PP LP fra10--------
    rs617497461,2
    Cuntested1153164698(-) GCCACC/G/TACATC 9 T syn10--------
    rs617484221,2,4
    Cuntested1153164723(-) AGGGGC/GCAAGG 6 A G mis10--------
    rs617497401,2
    C,Funtested1153164728(-) TCGCCA/CGGGGG 6 P syn11Minor allele frequency- C:0.00NA 4498
    rs617497391,2
    Cuntested1153164732(-) AACTTA/C/TGCCAG 9 * S L stg1 mis11NA 4520
    rs617497381,2,4
    C,Funtested1153164735(-) TCAAAC/GTTCGC 6 T S mis11Minor allele frequency- G:0.00NA 4528
    rs617497311,2
    Cuntested1153164785(-) AAAAGC/GGTCCT 6 S R mis10--------
    rs634858601,2
    Cuntested1153164801(-) AGAGGA/C/GTGTGC 9 D A G mis10--------
    rs617497201,2
    C,Funtested1153164810(-) GGCCAC/TGTCAG 6 T M mis11Minor allele frequency- T:0.00NA 4528
    rs617483811,2,4
    Cuntested1153164816(-) CAAGGC/TGGCCA 6 A V mis10--------
    rs617497141,2
    C,Funtested1153164828(-) CACCAC/TGAGAC 6 T M mis11Minor allele frequency- T:0.00NA 4488
    rs617497131,2
    C,Funtested1153164831(-) CGGCAC/GCACGA 6 T S mis11Minor allele frequency- G:0.00NA 4494
    rs617497111,2
    C,Funtested1153164836(-) GGGAGC/TGGCAC 6 S syn11Minor allele frequency- T:0.00NA 4472
    rs617497011,2
    Cuntested1153164891(-) GAAGCC/GCAAAT 6 P R mis10--------
    rs617484171,2
    Cuntested1153164936(-) AACTGA/G/TGAGAG 9 E G V mis10--------
    rs617484081,2
    Cuntested1153164950(-) TTTGAC/G/TTTCAC 9 D E mis1 syn10--------
    rs617484071,2
    Cuntested1153164951(-) TTTTGA/C/GCTTCA 9 D A G mis10--------
    rs617483971,2
    Cuntested1153164992(-) TACTTC/TGAAAA 6 F syn10--------
    rs2676084751,2
    Cuntested1153165005(-) GGAGTA/C/TGATTG 9 * S L stg1 mis10--------
    rs617483901,2
    Cuntested1153165017(-) TCGCTC/G/TTAAAG 9 S C F mis10--------
    rs617483891,2
    Cuntested1153165020(-) CTTTCA/G/TCTCTA 9 H R L mis10--------
    rs617483851,2
    Cuntested1153165025(-) AAAGCC/GTTTCG 6 A syn10--------
    rs2676084641,2
    Cuntested1153165042(-) CCCACA/C/G/
            
    GTCCC
    9 -- spa10--------
    rs1910769201,2
    Cuntested1153165101(+) TCAGAC/GATAGG 3 -- int10--------
    rs20715691,2
    Cuntested1153165114(+) AGAGCA/C/GGATGG 3 -- int10--------
    rs38503261,2
    Cuntested1153165149(+) TACTAC/TTGAAC 3 -- int10--------
    rs30279311,2
    Cuntested1153165281(+) GAAGGA/GTTGTC 3 -- int10--------
    rs20755961,2
    C,F,A,Huntested1153165531(+) CCCCTG/AGCTCT 3 -- int119Minor allele frequency- A:0.35NS EA WA NA CSA 1989
    rs1850360261,2
    Cuntested1153165769(+) TGCCCC/TGTAGA 3 -- int10--------
    rs20755971,2
    C,F,Huntested1153165775(+) GTAGAG/CATAGG 3 -- int19Minor allele frequency- C:0.05NS EA NA 958
    rs2676084631,2
    Cuntested1153165796(-) ATCAAA/G/TTAAGT 6 -- spd10--------
    rs1461075171,2
    C,Funtested1153165799(+) TACTTG/TATCAA 6 I syn11Minor allele frequency- T:0.00NA 4546
    rs617557631,2
    Cuntested1153165802(-) TATTTC/G/TATCAA 9 F L mis10--------
    rs617544571,2
    Cuntested1153165857(-) GACACA/G/TGAAGC 9 Q R L mis10--------
    rs617544531,2
    Cuntested1153165872(-) CCTGCA/C/G/
            
    TGAAG
    12 H P R L mis10--------
    rs617544411,2
    Cuntested1153165958(-) GCCCC-/C/TGGCTG 9 A G fra10--------
    rs617544401,2
    Cuntested1153165959(-) CGCCCC/TGGCTG 6 P L mis10--------
    rs617544391,2
    C,Funtested1153165964(-) GGCTCC/TGCCCC 6 S syn12Minor allele frequency- T:0.00CSA NA 4499
    rs617544351,2
    Cuntested1153166006(-) GAGCCC/TGCAGA 6 P syn10--------
    rs617544321,2
    Cuntested1153166028(-) GCCATA/C/GAGCCC 9 * S stg10--------
    rs617544211,2
    Cuntested1153166146(-) TCAGGC/G/TAAGAA 9 Q E * mis1 stg10--------
    rs1470172391,2
    C,Funknown1153164346(+) GGAGGC/TGCTGC 6 T A mis11Minor allele frequency- T:0.00NA 3210
    VAR_0181964
    ----see VAR_0181962 T M mis40--------
    VAR_0182164
    ----see VAR_0182162 P S mis40--------
    VAR_0181814
    ----see VAR_0181812 S C mis40--------
    VAR_0182234
    ----see VAR_0182232 A T mis40--------
    VAR_0174634
    ----see VAR_0174632 G S mis40--------
    VAR_0182054
    ----see VAR_0182052 S A mis40--------
    VAR_0182194
    ----see VAR_0182192 E K mis40--------
    VAR_0182004
    ----see VAR_0182002 S L mis40--------
    VAR_0235594
    ----see VAR_0235592 P L mis40--------
    VAR_0182264
    ----see VAR_0182262 P S mis40--------
    VAR_0181934
    ----see VAR_0181932 A V mis40--------
    VAR_0182044
    ----see VAR_0182042 A P mis40--------
    VAR_0181954
    ----see VAR_0181952 T M mis40--------
    VAR_0182154
    ----see VAR_0182152 S P mis40--------
    VAR_0182204
    ----see VAR_0182202 P L mis40--------
    VAR_0182214
    ----see VAR_0182212 P L mis40--------
    VAR_0182024
    ----see VAR_0182022 P L mis40--------
    VAR_0182184
    ----see VAR_0182182 P S mis40--------
    VAR_0181944
    ----see VAR_0181942 T S mis40--------
    rs1921813261,2
    --153154940(+) CTTCCC/GGTCAC 2 -- ds50010--------
    rs1826374001,2
    --153155235(+) GCAAAC/TGCGTC 2 -- ds50010--------
    rs1877234941,2
    --153155350(+) CCTTAA/TGAAAA 2 -- ds50010--------
    rs578550751,2
    C--153155463(+) GGGGG-/GTGTTT 2 -- ut310--------
    rs31773411,2
    C--153155520(-) TAAGGA/GAATTT 2 -- ut310--------
    rs1917971551,2
    --153155696(+) AATACA/GATACA 2 -- ut310--------
    rs70667871,2
    C--153155740(+) CCGGCC/TTCTCC 2 -- ut31 ese30--------
    rs30279161,2
    C--153156109(+) CGATCA/GGGTGA 2 -- ut31 ese30--------
    rs1445867171,2
    --153156315(+) TCTGCA/CAACAT 2 -- ut310--------
    rs125561781,2
    H--153156499(+) GAGGGC/GAAGCA 2 -- ut31 ese3 trp30--------
    rs1871252701,2
    --153156523(+) CTGGGC/TGGAAC 2 -- ut310--------
    rs1922710391,2
    --153157150(+) CAAACA/GGAAAG 2 -- ut310--------
    rs1851647501,2
    --153157328(+) AAACAC/TGCACG 2 -- ut310--------
    rs1390537161,2
    C--153157477(+) CCCCGC/GATGTG 2 -- ut310--------
    rs1429487431,2
    --153157610(+) GGAAGC/GTTTTG 2 -- ut310--------
    rs1904443361,2
    --153157904(+) AGACAA/GGCCAG 2 -- ut310--------
    rs1822218081,2
    --153157994(+) CCTGCA/GAGGCT 2 -- ut310--------
    rs1843533991,2
    --153158107(+) GTGCCA/GACTAC 2 -- ut310--------
    rs614950571,2
    C,F--153158316(+) TGTCGG/TTTTTT 2 -- ut311Minor allele frequency- T:0.00WA 2
    rs1807986921,2
    --153158481(+) ATATAA/TAAATT 2 -- ut310--------
    rs1474954081,2
    C--153158566(+) ACAAAA/CGCCCA 2 -- ut310--------
    rs1856175171,2
    --153158709(+) CCAAAC/TCTCTT 2 -- ut310--------
    rs1900311831,2
    --153158756(+) GACCTC/GATTAA 2 -- ut310--------
    rs2006025541,2
    --153158790(+) GGGGC-/AAAGAGA 2 -- ut310--------
    rs1816145051,2
    --153159094(+) TGACAC/TGTCAG 2 -- ut310--------
    rs1868419691,2
    --153159120(+) TGTCAA/GGATGA 2 -- ut310--------
    rs27346431,2
    C,F,H--153159326(+) TTGCTC/TGTATT 2 -- ut3110Minor allele frequency- T:0.10NS EA NA CSA 1289
    rs1919978251,2
    --153159560(+) ATCCCA/GTCAGA 2 -- ut310--------
    rs1506607021,2
    C--153159613(+) CCCCCC/GCACCG 2 -- ut310--------
    rs1838697361,2
    --153159637(+) GACCCA/CCTCCA 2 -- ut310--------
    rs1887643271,2
    --153159994(+) TTAAAA/GTTCAG 2 -- ut310--------
    rs1821886161,2
    --153160150(+) TGCACC/TGTTCA 2 -- ut310--------
    rs1398497091,2
    --153160220(+) CACGAC/GTAGCA 2 -- ut310--------
    rs1872500571,2
    --153160241(+) TCCAGA/CGAGCT 2 -- ut310--------
    rs27346471,2
    C,F,A,H--153160319(+) CTGTGC/TCTTTT 2 -- ut31 ese319Minor allele frequency- T:0.32MN NS EA WA NA CSA 2172
    rs1916608011,2
    --153160471(+) ACCTGC/GGGGGA 2 -- ut310--------
    rs284036281,2
    C--153160838(-) CAGTCG/ACCTTT 2 -- ut31 ese34Minor allele frequency- A:0.01MN EA NA 1256
    rs2010273771,2
    --153161410(+) AAGCT-/GGGGGG 2 -- ut310--------
    rs1852030121,2
    --153161417(+) GGGGGA/GTCATC 2 -- ut310--------
    rs1884691871,2
    --153161489(+) ACTTGC/TTTTTA 2 -- ut310--------
    rs38134591,2
    C,F,H--153161499(-) CCTTAT/CGCTGT 2 -- ut314Minor allele frequency- C:0.00NS EA 416
    rs38134581,2
    C,F,H--153161554(-) CCGTTC/GTGTTT 2 -- ut314Minor allele frequency- G:0.01NS EA 418
    rs785431901,2
    C--153161730(+) AAGCCA/TGGGAC 2 -- ut310--------
    rs1892532981,2
    C--153162092(+) CCCCCC/TGTCTG 2 -- ut310--------
    rs1490551021,2
    --153162152(+) AGGGGA/GAGCAG 2 -- ut310--------
    rs1914062521,2
    --153162241(+) CACTAC/TGCTAG 2 -- ut310--------
    rs413049861,2
    --153162314(+) GACTGA/GCAGGC 2 -- ut310--------
    rs27346451,2
    C--153162515(+) CAGGTC/TGGACT 2 -- ut310--------
    rs1402638781,2
    C--153162536(+) CAAGGA/CCTCCT 2 -- ut310--------
    rs30279231,2
    C,F--153162557(+) AACAGC/GGTGGG 2 -- ut31 ese31Minor allele frequency- G:0.00WA 2
    rs1886157451,2
    --153162637(+) GGCACC/TGCGGC 2 -- ut310--------
    rs28533371,2
    C,H--153162681(-) CCTCCG/ATCCTC 2 -- ut31 ese38Minor allele frequency- A:0.00WA NA CSA 13
    rs1811308161,2
    --153162811(+) GAACCC/GTATGT 2 -- ut310--------
    rs1867745701,2
    --153162839(+) ACAAGC/TGCAGG 2 -- ut310--------
    rs1904254831,2
    --153162848(+) GGTATA/GTATAC 2 -- ut310--------
    rs59871931,2
    C--153162893(+) TGGCTA/TGAGGG 2 -- ut31 ese30--------
    rs1816973511,2
    --153163053(+) CTTTGC/TCCCCT 2 -- ut310--------
    rs1823449201,2
    --153163127(+) CTGCCC/TGGCCT 2 -- ut310--------
    rs1851460541,2
    --153163137(+) TGACCC/GCAGGC 2 -- ut310--------
    rs1902495951,2
    --153163147(+) CCAGCA/CTGCCT 2 -- ut310--------
    rs1834419611,2
    --153163185(+) TCTAGC/TGCCAC 2 -- ut310--------
    rs1879327181,2
    --153163193(+) CACCCC/GTTGGA 2 -- ut310--------
    rs1931857251,2
    --153163272(+) TACACC/GCAGTA 2 -- ut310--------
    rs30279251,2
    C,F,H--153163330(+) GGTGCC/TACTTT 3 -- ut31 int1 ese39Minor allele frequency- T:0.05NS NA 1372
    rs1495936191,2
    --153163350(+) TGAAGC/TGTCCT 3 -- ut31 int10--------
    rs1442674711,2
    --153163449(+) CTTCTC/GTAAAG 3 -- ut31 int10--------
    rs1414976031,2
    --153163541(+) GTAGAC/TGGGGC 3 -- ut31 int10--------
    rs1464079321,2
    --153163584(+) AACTGC/TTCTGT 3 -- ut31 int10--------
    rs1836555991,2
    C--153163677(+) ATCTGA/C/TAGCAA 5 -- ut31 int10--------
    rs1879695331,2
    --153163699(+) GGAGCC/GTAGTT 3 -- ut31 int10--------
    rs30279261,2
    C,F--153163763(+) CTTGTC/TGGTAA 3 -- ut31 int1 ese30--------
    rs736272911,2
    --153163801(+) TCCCAA/CCCTGA 3 -- ut31 int10--------
    rs1850481241,2
    --153163812(+) AGCCAC/TGAAAC 3 -- ut31 int10--------
    rs1895086711,2
    --153163843(+) AAAAAA/GTATTT 3 -- ut310--------
    rs1820661271,2
    C--153163932(+) GGTTTA/GCTTTG 3 -- ut310--------
    rs2021822461,2
    --153163937(+) GCTTTC/GCAATC 3 -- ut310--------
    rs754982681,2
    C--153163999(-) GAGGAC/GCCTGT 6 D E mis10--------
    rs1466322231,2
    C--153164101(+) GCAACC/TGCGGG 6 A syn11Minor allele frequency- T:0.00NA 4546
    rs1995405751,2
    --153164161(+) CCTCTA/GGGCAT 6 P syn10--------
    rs2017114541,2
    C--153164278(+) AGTGGC/TACGGG 6 V syn10--------
    rs1393782241,2
    C,F--153164557(+) TTCACG/AGCTTT 6 /A syn11Minor allele frequency- A:0.00NA 4544
    rs1413829701,2
    F--153164670(+) GGGGCG/ATTTGA 6 /R /C mis11Minor allele frequency- A:0.00NA 4284
    rs1382113451,2
    C--153164717(+) CCTCAC/GCCTTG 6 A G mis10--------
    rs2000748661,2
    --153164857(+) CCCCGG/TCCTCT 6 G syn10--------
    rs1866633141,2
    C--153164892(+) TTTGGA/GCTTCT 6 P S mis10--------
    rs2012543761,2
    --153165088(+) CTCCAC/TAGCAA 3 -- int10--------
    rs30279291,2
    C--153165130(+) ACAACA/GCTCTG 3 -- int10--------
    rs1837464171,2
    --153165155(+) TGAACA/GAGAGT 3 -- int10--------
    rs1872419331,2
    --153165183(+) CCTGAA/GGACCT 3 -- int10--------
    rs1925170481,2
    --153165276(+) GTACAC/GAAGGG 3 -- int10--------
    rs30279301,2
    C--153165279(+) CAGAAA/C/GGGTTG 3 -- int10--------
    rs1877332381,2
    --153165280(+) AGAAGG/TGTTGT 3 -- int10--------
    rs1383107821,2
    --153165284(+) GGGTTA/GTCAGG 3 -- int10--------
    rs1927838331,2
    --153165312(+) GGTTGC/GTGCCT 3 -- int10--------
    rs1842303701,2
    --153165323(+) GGGCCC/TGAGTC 3 -- int10--------
    rs1418184871,2
    --153165373(+) GCTCAC/GTCTCT 3 -- int10--------
    rs1883217751,2
    --153165492(+) AAAAGC/GCAGAA 3 -- int10--------
    rs1925571701,2
    --153165554(+) GCTTCC/TGCAGC 3 -- int10--------
    rs1388033411,2
    C--153165555(+) CTTCCA/GCAGCT 3 -- int10--------
    rs1845445171,2
    --153165615(+) CTACCG/TTGAGA 3 -- int10--------
    rs1892493461,2
    --153165640(+) GCAGCA/GACCTC 3 -- int10--------
    rs1815570821,2
    --153165703(+) CCCCCA/GACCCC 3 -- int10--------
    rs2001842941,2
    --153165756(+) TCCCTA/GCCCTC 3 -- int10--------
    rs2019172311,2
    --153165783(+) AGGAGC/TTGCTC 3 -- int10--------
    rs2014275061,2
    --153165788(+) TTGCTC/TTTACT 3 -- int10--------
    rs1401915611,2
    F--153165898(+) ATGGGT/CCCCCG 6 /G syn11Minor allele frequency- C:0.00NA 4550
    rs1394778571,2
    F--153166039(+) TGCACG/AGGCTC 6 /P syn11Minor allele frequency- A:0.00NA 4422
    rs1902893471,2
    --153166275(+) TGATGC/TCCTTC 3 -- int10--------
    rs1809970411,2
    --153166339(+) TTTGGA/GCTGTG 3 -- int10--------
    rs1858295661,2
    --153166358(+) TGGCCA/GGTGTG 3 -- int10--------
    rs30279321,2
    C,A--153166573(+) CCGGGC/GCTTGG 3 -- int10--------
    rs1397760651,2
    --153167008(+) CCTGCC/TGGTGG 3 -- int10--------
    rs1914657381,2
    --153167009(+) CTGCCA/GGTGGA 3 -- int10--------
    rs30279331,2
    C,F,A,H--153167013(+) CGGTGC/GAGAAG 3 -- int114Minor allele frequency- G:0.45NS EA NA WA CSA 790
    rs1810443731,2
    --153167071(+) TGACCA/GAAGCA 3 -- int10--------
    rs1854632851,2
    --153167187(+) CTGTCA/GAGTAT 3 -- int10--------
    rs1461434271,2
    C--153167280(+) CCTTCA/GTTAGC 3 -- int10--------
    rs1486146841,2
    --153167287(+) TAGCAA/GTTCAT 3 -- int10--------
    rs1420583961,2
    C--153167321(+) CCACCC/TTCCGT 3 -- int10--------
    rs30279341,2
    C--153167594(+) GGCAAC/GAGATG 3 -- int10--------
    rs125570661,2
    C,F,H--153167659(+) CTCACG/CCCTGA 3 -- int11Minor allele frequency- C:0.00NA 2
    rs1124451021,2
    C--153167661(+) CACCC-/CTGAGTT 3 -- int11Minor allele frequency- CT:0.00CSA 2
    rs1828348361,2
    --153167824(+) AGCTCA/GCCTTG 3 -- int10--------
    rs2005822371,2
    --153167831(+) CTTGT-/TTTG  
            
    TTTTT
    3 -- int10--------
    rs1878698631,2
    --153167903(+) GCAACA/CTCCGC 3 -- int10--------
    rs48984671,2
    C,F,A,H--153168063(+) TGATCA/GACCCG 3 -- int15Minor allele frequency- G:0.20NA CSA 10
    rs1452588701,2
    C--153168110(+) GCCACC/TGTGCC 3 -- int10--------
    rs38905661,2
    C,H--153168136(+) TTTCAA/TGTCTC 3 -- int18Minor allele frequency- T:0.00WA NA CSA 15
    rs1421333521,2
    C--153168171(+) AATGAC/TGAAGA 3 -- int10--------
    rs1445270941,2
    C--153168172(+) ATGACA/GAAGAA 3 -- int10--------
    rs1918456801,2
    --153168382(+) AACCCA/GGACGG 3 -- int10--------
    rs1455925241,2
    --153168386(+) CGGACA/GGTCCT 3 -- int10--------
    rs1828880281,2
    --153168452(+) CATTTA/GCATTT 3 -- int10--------
    rs1874376571,2
    --153168478(+) CACCAC/TGAGGT 3 -- int10--------
    rs1927063431,2
    --153168501(+) CTAAAC/TGTGAC 3 -- int10--------
    rs1843102601,2
    C--153169065(+) CCTACA/GATCCC 3 -- int10--------
    rs2019475361,2
    --153169182(+) CCCTG-/TCTC  
            
    TCTCT
    3 -- int10--------
    rs2004477381,2
    --153169192(+) CTCTC-/TCTCT 
            
    TTTTT
    3 -- int10--------
    rs1870971781,2
    --153169370(+) GGGGTC/TTCACC 3 -- int10--------
    rs59871941,2
    C,A--153169607(+) CTCTGG/CAAACC 3 -- int15Minor allele frequency- C:0.00NA WA CSA 8
    rs1922608811,2
    --153169629(+) ATATTA/CTAAGG 3 -- int10--------
    rs2012526781,2
    C--153169777(+) TAGCA-/GTGG  
     TCCAGGT
    GTGGT
    3 -- int10--------
    rs17347901,2
    C,A,H--153169793(+) TGTGGA/CCCAGG 3 -- int15Minor allele frequency- C:0.16MN NA CSA 190
    rs626177611,2
    C,F--153169852(+) AGCTCA/GCAGGT 3 -- int11Minor allele frequency- G:0.00NA 2
    rs59871951,2
    C,F,A,H--153169882(+) GGGCAA/GGGGTG 3 -- int114Minor allele frequency- G:0.08NS EA NA 1982
    rs1456780131,2
    C--153169993(+) CCCAGC/TACTGT 3 -- int10--------
    rs59871961,2
    C--153170075(+) GTCTCA/TACTAA 3 -- int10--------
    rs125566681,2
    H--153170095(+) aatgaA/Gccggg 3 -- int10--------
    rs1844143191,2
    --153170246(+) GGAGCA/GGCAGG 3 -- int10--------
    rs201729522