Set Analyses:
Advanced Search

Advanced Search

 
Search By
Section (entire)
for


 



MDM2 Gene

protein-coding   GIFtS: 75
GCID: GC12P069201

MDM2 Oncogene, E3 Ubiquitin Protein Ligase

(Previous names: mouse double minute 2, human homolog of; p53-binding protein,...)
  See related diseases
at  

(According to 1HGNC, 2Entrez Gene,
3UniProtKB/Swiss-Prot, 4UniProtKB/TrEMBL, 5OMIM, 6GeneLoc, 7Ensembl, 8DME, 9miRBase, 10fRNAdb, 12H-InvDB, 13NCBI, 14NONCODE, and/or 15RNAdb)
About This Section

TryGeneCards Plus

Aliases
MDM2 Oncogene, E3 Ubiquitin Protein Ligase1 2     E3 Ubiquitin-Protein Ligase Mdm22
Oncoprotein Mdm22 3     hdm22
ACTFS2 5     Mdm2, P53 E3 Ubiquitin Protein Ligase Homolog2
Mdm2 P53 Binding Protein Homolog (Mouse)1     Mdm2, Transformed 3T3 Cell Double Minute 2, P53 Binding Protein2
Mdm2, P53 E3 Ubiquitin Protein Ligase Homolog (Mouse)1     EC 6.3.2.-3
Mdm2, Transformed 3T3 Cell Double Minute 2, P53 Binding Protein (Mouse)1     Hdm23
Mouse Double Minute 2, Human Homolog Of; P53-Binding Protein1     Double Minute 2 Protein3
HDMX2     P53-Binding Protein Mdm23
Double Minute 2, Human Homolog Of; P53-Binding Protein2     EC 6.3.28

External Ids:    HGNC: 69731   Entrez Gene: 41932   Ensembl: ENSG000001356797   OMIM: 1647855   UniProtKB: Q009873   

Export aliases for MDM2 gene to outside databases

Previous GC identifers: GC12M068977 GC12P069030 GC12P068918 GC12P067488 GC12P066253


(According to Entrez Gene, GeneCards, Tocris Bioscience, Wikipedia's Gene Wiki, PharmGKB,
UniProtKB/Swiss-Prot, and/or UniProtKB/TrEMBL)
About This Section

TryGeneCards Plus

Entrez Gene summary for MDM2 Gene:
This gene encodes a nuclear-localized E3 ubiquitin ligase. The encoded protein can promote tumor formation by
targeting tumor suppressor proteins, such as p53, for proteasomal degradation. This gene is itself
transcriptionally-regulated by p53. Overexpression or amplification of this locus is detected in a variety of
different cancers. There is a pseudogene for this gene on chromosome 2. Alternative splicing results in a
multitude of transcript variants, many of which may be expressed only in tumor cells. (provided by RefSeq, Jun
2013)

GeneCards Summary for MDM2 Gene:
MDM2 (MDM2 oncogene, E3 ubiquitin protein ligase) is a protein-coding gene. Diseases associated with MDM2 include accelerated tumor formation, and soft tissue sarcoma. GO annotations related to this gene include enzyme binding and identical protein binding. An important paralog of this gene is MDM4.

UniProtKB/Swiss-Prot: MDM2_HUMAN, Q00987
Function: E3 ubiquitin-protein ligase that mediates ubiquitination of p53/TP53, leading to its degradation by the
proteasome. Inhibits p53/TP53- and p73/TP73-mediated cell cycle arrest and apoptosis by binding its
transcriptional activation domain. Also acts as a ubiquitin ligase E3 toward itself and ARRB1. Permits the
nuclear export of p53/TP53. Promotes proteasome-dependent ubiquitin-independent degradation of retinoblastoma RB1
protein. Inhibits DAXX-mediated apoptosis by inducing its ubiquitination and degradation. Component of the
TRIM28/KAP1-MDM2-p53/TP53 complex involved in stabilizing p53/TP53. Also component of the TRIM28/KAP1-ERBB4-MDM2
complex which links growth factor and DNA damage response pathways. Mediates ubiquitination and subsequent
proteasome degradation of DYRK2 in nucleus. Ubiquitinates IGF1R and SNAI1 and promotes them to proteasomal
degradation

summary for MDM2 Gene:
Ligases catalyze the joining of two molecules with concomitant hydrolysis of the diphosphate bond in ATP or
a similar triphosphate. They belong to the E.C. 6 class, which also includes synthases and carboxylases.
Ubiquitin ligases, such as MDM2, E3A and anaphase-promoting complex, attach ubiquitin molecules onto lysine
residues of target proteins. Ubiquitin ligases function as a complex of an E1-activating enzyme, an
E2-conjugating enzyme and an E3-ubiquiting enzyme. Using ATP, E1 activates the ubiquitin molecule and
transfer it to E2. E2 interacts with E3 partners to transfer the ubiquitin moeity to the target protein.
Generally multiple ubiquitin molecules are attached (polyubiquitination), which marks the target protein for
proteasomal degradation.

Gene Wiki entry for MDM2 (Mdm2) Gene


(According to GeneLoc and/or HGNC, and/or
Entrez Gene (NCBI build 37),
and/or miRBase,
Genomic Views according to UCSC (hg19) and Ensembl (release 75), Regulatory elements and Epigenetics data according to QIAGEN, and/or SwitchGear Genomics)
About This Section

TryGeneCards Plus
RefSeq DNA sequence:
NC_000012.12  NT_029419.13  NC_018923.2  
Regulatory elements:
   Regulatory transcription factor binding sites in the MDM2 gene promoter:
         AP-1   
         Other transcription factors

SwitchGear Promoter luciferase reporter plasmids (see all 2): MDM2 promoter sequence
   Search Chromatin IP Primers for MDM2

Epigenetics:
DNA Methylation CpG Assay Predesigned for Pyrosequencing in human, mouse, rat MDM2


Genomic Location:
Genomic View: UCSC Golden Path with GeneCards custom track

Entrez Gene cytogenetic band: 12q14.3-q15   Ensembl cytogenetic band:  12q15   HGNC cytogenetic band: 12q13-q14

MDM2 Gene in genomic location: bands according to Ensembl, locations according to (and/or Entrez Gene and/or Ensembl if different)
MDM2 gene location

GeneLoc information about chromosome 12         GeneLoc Exon Structure

GeneLoc location for GC12P069201:  view genomic region     (about GC identifiers)

Start:
69,201,956 bp from pter      End:
69,239,214 bp from pter
Size:
37,259 bases      Orientation:
plus strand

(According to 1UniProtKB, HORDE, 2neXtProt, Ensembl, and/or Reactome, Modification sites according to PhosphoSitePlus, Specific Peptides from DME, RefSeq according to NCBI, PDB rendering according to OCA and/or Proteopedia, Recombinant Proteins from EMD Millipore, R&D Systems, GenScript, Enzo Life Sciences, OriGene, Novus Biologicals, Sino Biological, ProSpec, and/or Cloud-Clone Corp.,
Biochemical Assays by EMD Millipore, R&D Systems, OriGene, GenScript, Cell Signaling Technology, Enzo Life Sciences, and/or Cloud-Clone Corp., Antibodies by EMD Millipore, R&D Systems, Cell Signaling Technology, OriGene, Novus Biologicals, Thermo Fisher Scientific, LSBio, Abcam, Cloud-Clone Corp, and/or others.)
About This Section

TryGeneCards Plus

UniProtKB/Swiss-Prot: MDM2_HUMAN, Q00987 (See protein sequence)
Recommended Name: E3 ubiquitin-protein ligase Mdm2  
Size: 491 amino acids; 55233 Da
Subunit: Binds p53/TP53, TP73/p73, ARF/P14, PML, RBL5 and RP11, and specifically to RNA. Can interact with RB1,
E1A-associated protein EP300 and the E2F1 transcription factor. Forms a ternary complex with p53/TP53 and WWOX.
Interacts with CDKN2AIP, MTBP, RFWD3, TBRG1, USP7, PYHIN1, UBXN6, and RBBP6. Isoform Mdm2-F does not interact
with p53/TP53. Interacts with and ubiquitinates HIV-1 Tat. Interacts with ARRB1 and ARRB2. Interacts (isoform 2)
with PSMA3. Found in a trimeric complex with MDM2, MDM4 and UPB2. Interacts with USP2 (via N-terminus and
C-terminus). Interacts with MDM4. Part of a complex with MDM2, DAXX, RASSF1 and USP7. Part of a complex with
DAXX, MDM2 and USP7. Interacts directly with DAXX and USP7. Interacts (via C-terminus) with RASSF1 isoform A (via
N-terminus); the interaction is independent of TP53. Interacts with APEX1; leading to its ubiquitination and
degradation. Interacts with RYBP; this inhibits ubiquitination of TP53. Identified in a complex with RYBP and
p53/TP53. Also component of the TRIM28/KAP1-MDM2-p53/TP53 complex involved in regulating p53/TP53 stabilization
and activity. Binds directly both p53/TP53 and TRIM28. Component of the TRIM28/KAP1-ERBB4-MDM2 complex involved
in connecting growth factor responses with DNA damage. Interacts directly with both TRIM28 and ERBB4 in the
complex. Interacts with DYRK2. Interacts with IGF1R. Interacts with TRIM13; the interaction ubiquitinates MDM2
leading to its proteasomal degradation. Interacts with SNAI1; this interaction promotes SNAI1 ubiquitination.
Interacts with NOTCH1 (via intracellular domain). Interacts with FHIT. Interacts with RFFL. Interacts with herpes
virus 8 protein v-IRF4
Miscellaneous: MDM2 RING finger mutations that failed to ubiquitinate p53 in vitro did not target p53 for
degradation when expressed in cells
Caution: A report observed N-glycosylation at Asn-349 (PubMed:19139490). However, as the protein is not
extracellular, additional evidences are required to confirm this result
Selected PDB 3D structures from and Proteopedia for MDM2 (see all 47):
1RV1 (3D)        1T4E (3D)        1T4F (3D)        1YCR (3D)        1Z1M (3D)        2AXI (3D)    
Secondary accessions: A6NL51 A8K2S6 Q13226 Q13297 Q13298 Q13299 Q13300 Q13301 Q53XW0 Q71TW9
Q8WYJ1 Q8WYJ2 Q9UGI3 Q9UMT8
Alternative splicing: 11 isoforms:  Q00987-1   Q00987-2   Q00987-3   Q00987-4   Q00987-5   Q00987-6   Q00987-7   Q00987-8   
Q00987-9   Q00987-10   Q00987-11   

Explore the universe of human proteins at neXtProt for MDM2: NX_Q00987

Explore proteomics data for MDM2 at MOPED

Post-translational modifications: 

  • Phosphorylation on Ser-166 by SGK1 activates ubiquitination of p53/TP53. Phosphorylated at multiple sites near the
    RING domain by ATM upon DNA damage; this prevents oligomerization and E3 ligase processivity and impedes
    constitutive p53/TP53 degradation1
  • Autoubiquitination leads to proteasomal degradation; resulting in p53/TP53 activation it may be regulated by SFN.
    Also ubiquitinated by TRIM13. Deubiquitinated by USP2 leads to its accumulation and increases deubiquitination
    and degradation of p53/TP53. Deubiquitinated by USP7 leading to its stabilization1
  • Ubiquitination2 at Lys36
  • Modification sites at PhosphoSitePlus
  • Selected DME Specific Peptides for MDM2 (Q00987) (see all 13)
     MIYRNLV  DTYTMKE  DDKITQAS  GESDTDSFE 


    See MDM2 Protein Expression from SPIRE MOPED, PaxDB, and MaxQB

    REFSEQ proteins (5 alternative transcripts): 
    NP_001138809.1  NP_001138811.1  NP_001138812.1  NP_001265391.1  NP_002383.2  

    ENSEMBL proteins: 
     ENSP00000417281   ENSP00000310742   ENSP00000429021   ENSP00000258148   ENSP00000444430  
     ENSP00000377067   ENSP00000427828   ENSP00000439238   ENSP00000377068   ENSP00000441841  
     ENSP00000377062   ENSP00000429692   ENSP00000299252   ENSP00000431110   ENSP00000353611  
     ENSP00000430257   ENSP00000444597   ENSP00000445222   ENSP00000445030   ENSP00000444566  
     ENSP00000443450   ENSP00000444028   ENSP00000377065   ENSP00000266624   ENSP00000335096  
     ENSP00000430906   ENSP00000258149   ENSP00000348637   ENSP00000440932   ENSP00000410694  
     ENSP00000377064  
    Reactome Protein details: Q00987

    MDM2 Human Recombinant Protein Products:

    Browse Purified and Recombinant Proteins at EMD Millipore
    R&D Systems Recombinant & Natural Proteins for MDM2 (MDM2/HDM2)
    Enzo Life Sciences proteins for MDM2
    Browse OriGene full length recombinant human proteins expressed in human HEK293 cells
    OriGene Protein Over-expression Lysate for MDM2
    OriGene Custom MassSpec
    OriGene Custom Protein Services for MDM2
    GenScript Custom Purified and Recombinant Proteins Services for MDM2
    Novus Biologicals MDM2 Proteins
    Novus Biologicals MDM2 Lysates
    Browse Sino Biological Recombinant Proteins
    Browse Sino Biological Cell Lysates
    Browse ProSpec Recombinant Proteins
    Cloud-Clone Corp. Proteins for MDM2

    MDM2 Antibody Products:

    EMD Millipore Mono- and Polyclonal Antibodies for the study of MDM2
    R&D Systems Antibodies for MDM2 (MDM2/HDM2)
    Cell Signaling Technology (CST) Antibodies for MDM2 
    OriGene Antibodies for MDM2
    OriGene Custom Antibody Services for MDM2
    Novus Biologicals MDM2 Antibodies
    Abcam antibodies for MDM2
    Cloud-Clone Corp. Antibodies for MDM2
    ThermoFisher Antibody for MDM2
    LSBio Antibodies in human, mouse, rat for MDM2

    MDM2 Assay Products:

    Browse Kits and Assays available from EMD Millipore
    OriGene Custom Assay Services for MDM2
    R&D Systems ELISAs for MDM2 (MDM2/HDM2)         (see all)
    GenScript Custom Assay Services for MDM2
    Enzo Life Sciences assays for MDM2
    Cloud-Clone Corp. ELISAs for MDM2
    Cloud-Clone Corp. CLIAs for MDM2


    (According to HGNC, IUPHAR, InterPro, ProtoNet, UniProtKB, and/or BLOCKS, Sets of similar genes according to GeneDecks)
    About This Section

    TryGeneCards Plus
    Selected InterPro protein domains (see all 7):
     IPR001841 Znf_RING
     IPR028340 Mdm2
     IPR016495 p53_neg-reg_MDM_2/4
     IPR003121 SWIB_MDM2_domain
     IPR013083 Znf_RING/FYVE/PHD

    Graphical View of Domain Structure for InterPro Entry Q00987

    ProtoNet protein and cluster: Q00987

    2 Blocks protein domains:
    IPB001841 Zn-finger
    IPB001876 Zn-finger


    UniProtKB/Swiss-Prot: MDM2_HUMAN, Q00987
    Domain: Region I is sufficient for binding p53 and inhibiting its G1 arrest and apoptosis functions. It also binds
    p73 and E2F1. Region II contains most of a central acidic region required for interaction with ribosomal protein
    L5 and a putative C4-type zinc finger. The RING finger domain which coordinates two molecules of zinc interacts
    specifically with RNA whether or not zinc is present and mediates the heterooligomerization with MDM4. It is also
    essential for its ubiquitin ligase E3 activity toward p53 and itself
    Similarity: Belongs to the MDM2/MDM4 family
    Similarity: Contains 1 RanBP2-type zinc finger
    Similarity: Contains 1 RING-type zinc finger
    Similarity: Contains 1 SWIB domain


    MDM2 for domains           About GeneDecksing


    (According to 1UniProtKB, Genatlas, LifeMap Discovery™, IUBMB, and/or 2DME, Human phenotypes from GenomeRNAi, Animal models from MGI Mar 06 2013, inGenious Targeting Laboratory, genOway,
    transcription factor targeting from QIAGEN and/or HOMER, miRNA Gene Targets from miRTarBase, shRNA from OriGene, siRNAs from OriGene, QIAGEN, microRNA from QIAGEN, SwitchGear Genomics, Gene Editing from DNA2.0, Clones from OriGene, GenScript, Sino Biological, DNA2.0, and Vector BioLabs, Cell Lines from GenScript, ESI BIO, In Situ Hybridization Assays from Advanced Cell Diagnostics, Ontologies according to Gene Ontology Consortium 01 Apr 2014 via Entrez Gene.)
    About This Section

    TryGeneCards Plus

    Molecular Function:

         UniProtKB/Swiss-Prot Summary: MDM2_HUMAN, Q00987
    Function: E3 ubiquitin-protein ligase that mediates ubiquitination of p53/TP53, leading to its degradation by the
    proteasome. Inhibits p53/TP53- and p73/TP73-mediated cell cycle arrest and apoptosis by binding its
    transcriptional activation domain. Also acts as a ubiquitin ligase E3 toward itself and ARRB1. Permits the
    nuclear export of p53/TP53. Promotes proteasome-dependent ubiquitin-independent degradation of retinoblastoma RB1
    protein. Inhibits DAXX-mediated apoptosis by inducing its ubiquitination and degradation. Component of the
    TRIM28/KAP1-MDM2-p53/TP53 complex involved in stabilizing p53/TP53. Also component of the TRIM28/KAP1-ERBB4-MDM2
    complex which links growth factor and DNA damage response pathways. Mediates ubiquitination and subsequent
    proteasome degradation of DYRK2 in nucleus. Ubiquitinates IGF1R and SNAI1 and promotes them to proteasomal
    degradation
    Induction: By DNA damage

         Genatlas biochemistry entry for MDM2:
    p53 associated protein 9,(homolog to murine oncogene Mdm2,present on a mouse double minute
    chromosome),downregulating TP53,acting as an E3 ubiquitin ligase directly transferring ubiquitin and targetting
    TP53 to proteasome complex for degradation,expressed in different layers of normal skin,amplified in human
    sarcoma,malignant glioma,angiosarcoma,liposarcoma and anaplastic astrocytoma,and diffuse large B cell lymphoma

         Enzyme Numbers (IUBMB): EC 6.3.2.-1 EC 6.3.22

         Gene Ontology (GO): Selected molecular function terms (see all 9):    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0002039p53 binding IPI15053879
    GO:0004842ubiquitin-protein ligase activity IMP19372219
    GO:0005515protein binding IPI10196247
    GO:0008270zinc ion binding IDA10722742
    GO:0019899enzyme binding IPI15577914
         
    MDM2 for ontologies           About GeneDecksing


    Phenotypes:
         3 GenomeRNAi human phenotypes for MDM2:
     Decreased influenza A/WSN/33 r  Increased cell death HMECs cel  Synthetic lethal with c-Myc af 

         Selected MGI mutant phenotypes (inferred from 17 alleles(MGI details for Mdm2) (see all 22):
     behavior/neurological  cardiovascular system  cellular  craniofacial  digestive/alimentary 
     embryogenesis  growth/size/body  hematopoietic system  immune system  integument 
     limbs/digits/tail  liver/biliary system  mortality/aging  muscle  nervous system 

    MDM2 for phenotypes           About GeneDecksing

    Animal Models:
         MGI mouse knock-outs for MDM2: Mdm2tm1Glo Mdm2tm2.2Glo Mdm2tm2.3Glo Mdm2tm1Bay Mdm2tm1.1Mep

       inGenious Targeting Laboratory: Let us create your new Knockout/Knockin mouse model for MDM2
       inGenious Targeting Laboratory: Contact us about creating complex and humanized mouse models for MDM2

       genOway customized KO model: permanent, tissue-specific or time-controlled inactivation for MDM2
       genOway customized Knockin model: humanization, point mutation, expression monitoring, etc. for MDM2

    miRNA
    Products:
        
    miRTarBase miRNAs that target MDM2:
    hsa-mir-26b-5p (MIRT028860), hsa-mir-605-5p (MIRT016157), hsa-mir-3929 (MIRT052891), hsa-mir-18b-5p (MIRT007287), hsa-mir-92a-3p (MIRT049315), hsa-mir-484 (MIRT041992), hsa-mir-504-5p (MIRT016256), hsa-mir-25-3p (MIRT006632), hsa-mir-145-5p (MIRT007257), hsa-mir-32-5p (MIRT006631), hsa-mir-143-3p (MIRT007256)

    Block miRNA regulation of human, mouse, rat MDM2 using miScript Target Protectors
    7 qRT-PCR Assays for microRNAs that regulate MDM2:
    hsa-miR-548a-3p hsa-miR-494 hsa-miR-513a-3p hsa-miR-548e hsa-miR-551b* hsa-miR-548c-3p hsa-miR-556-5p
    SwitchGear 3'UTR luciferase reporter plasmidMDM2 3' UTR sequence
    Inhib. RNA
    Products:
        
    OriGene RNAi products in human, mouse, rat for MDM2
    Predesigned siRNA for gene silencing in human, mouse, rat MDM2

    Gene Editing
    Products:
    DNA2.0 Custom Protein Engineering Service for MDM2

    Clone
    Products:
         
    OriGene clones in human, mouse for MDM2 (see all 24)
    OriGene ORF clones in mouse, rat for MDM2
    OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
    GenScript: all cDNA clones in your preferred vector: MDM2 (NM_002392)
    Sino Biological Human cDNA Clone for MDM2
    DNA2.0 Custom Codon Optimized Gene Synthesis Service for MDM2
    Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat MDM2

    Cell Line
    Products:
         
    GenScript Custom overexpressing Cell Line Services for MDM2
    Browse ESI BIO Cell Lines and PureStem Progenitors for MDM2 
    In Situ Assay
    Products:
       

     
    Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for MDM2


    (According to UniProtKB, COMPARTMENTS Subcellular localization database, Ontologies according to Gene Ontology Consortium 01 Apr 2014 via Entrez Gene.)
    About This Section

    TryGeneCards Plus

    Subcellular locations from UniProtKB/Swiss-Prot
    MDM2_HUMAN, Q00987: Nucleus, nucleoplasm. Cytoplasm. Nucleus, nucleolus. Note=Expressed predominantly in the
    nucleoplasm. Interaction with ARF(P14) results in the localization of both proteins to the nucleolus. The
    nucleolar localization signals in both ARF(P14) and MDM2 may be necessary to allow efficient nucleolar
    localization of both proteins. Colocalizes with RASSF1 isoform A in the nucleus
    Subcellular locations from COMPARTMENTS: 

    CompartmentConfidence
    nucleus5
    cytosol4
    plasma membrane4
    cytoskeleton2
    extracellular2
    mitochondrion2

    Gene Ontology (GO): Selected cellular component terms (see all 10):    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0005634nucleus IMP--
    GO:0005654nucleoplasm TAS--
    GO:0005730nucleolus IDA10707090
    GO:0005737cytoplasm IMP--
    GO:0005829cytosol TAS--

    MDM2 for ontologies           About GeneDecksing


    (SuperPaths according to PathCards, Pathways according to R&D Systems, Cell Signaling Technology, KEGG, PharmGKB, BioSystems, Sino Biological, Reactome, Tocris Bioscience, GeneGo (Thomson Reuters), QIAGEN, and/or UniProtKB, Sets of similar genes according to GeneDecks, Interaction Networks according to QIAGEN, and/or STRING, Interactions according to 1UniProtKB, 2MINT, 3I2D, and/or 4STRING, with links to IntAct and Ensembl, Ontologies according to Gene Ontology Consortium 01 Apr 2014 via Entrez Gene).
    About This Section

    TryGeneCards Plus

    SuperPaths for MDM2 About   (see all 70)  
    See pathways by source

    SuperPathSelected contained pathways About (see all per SuperPath)
    1Glioma
    Glioma0.51
    Signaling Pathways in Glioblastoma0.36
    Melanoma0.43
    Bladder cancer0.31
    Prostate cancer0.39
    2Cell cycle
    Cell cycle0.59
    Cell cycle0.59
    3p53 signaling pathway
    DNA damage response0.41
    p53 signaling pathway0.41
    4p53 Signaling
    p53 Signaling0.38
    p53 Pathway0.38
    5Class I MHC mediated antigen processing and presentation
    Adaptive Immune System0.41
    Ubiquitin mediated proteolysis0.35

    Pathways by source                                                                                                                                                                 See SuperPaths
    Show all pathways

    1 R&D Systems Pathway for MDM2
        Akt Signaling Pathway

    Selected Downloadable PowerPoint Slides of GeneGlobe Pathway Central Maps for MDM2 (see all 15)
        Mitochondrial Apoptosis
    Molecular Mechanisms of Cancer
    HIF1Alpha Pathway
    PTEN Pathway
    Glioblastoma Multiforme

    3 Cell Signaling Technology (CST) Pathways for MDM2
        Cell Cycle / Checkpoint Control
    PI3K / Akt Signaling
    DNA Damage

    1 Tocris Bioscience Pathway for MDM2
        Akt Pathway

    Selected GeneGo (Thomson Reuters) Pathways for MDM2 (see all 8)
        DNA damage ATM/ATR regulation of G1/S checkpoint
    Proteolysis Putative SUMO-1 pathway
    Transcription P53 signaling pathway
    Development Angiotensin signaling via beta-Arrestin
    Signal transduction AKT signaling

    Selected BioSystems Pathways for MDM2 (see all 24)
        Apoptosis
    Cell cycle
    DNA damage response
    Senescence and Autophagy
    G1 to S cell cycle control

    2 Sino Biological Pathways for MDM2
        EGFR Signaling Pathway
    p53 Pathway

    Selected Reactome Pathways for MDM2 (see all 6)
        Oxidative Stress Induced Senescence
    AKT phosphorylates targets in the cytosol
    Trafficking of AMPA receptors
    Stabilization of p53
    Oncogene Induced Senescence


    Selected Kegg Pathways  (Kegg details for MDM2) (see all 18):
        FoxO signaling pathway
    Cell cycle
    p53 signaling pathway
    Ubiquitin mediated proteolysis
    Endocytosis


    MDM2 for pathways           About GeneDecksing

        Pathway & Disease-focused RT2 Profiler PCR Arrays including MDM2 (see all 11): 
              Oncogenes & Tumor Suppressor Genes in human mouse rat
              Nitric Oxide Signaling Pathway in human mouse rat
              Tumor Metastasis in human mouse rat
              Ubiquitin Ligases in human mouse rat
              Ubiquitination (Ubiquitylation) Pathway in human mouse rat

    Interactions:

        GeneGlobe Interaction Network for MDM2

    STRING Interaction Network Preview (showing 5 interactants - click image to see 25)

    Selected Interacting proteins for MDM2 (Q009871, 2, 3 ENSP000004172814) via UniProtKB, MINT, STRING, and/or I2D (see all 541)
    InteractantInteraction Details
    GeneCardExternal ID(s)
    TP53P046371, 2, 3, ENSP000002693054EBI-389668,EBI-366083 MINT-6540920 MINT-4793511 MINT-6823775 MINT-7013943 MINT-8303857 MINT-6540905 MINT-68742 MINT-8385459 MINT-56681 MINT-8374464 MINT-58468 MINT-7013791 MINT-68743 MINT-7013956 MINT-4545014 MINT-8339574 MINT-4049631 MINT-6540776 MINT-6801380 MINT-8374452 MINT-58465 MINT-7013688 MINT-7013802 MINT-4303990 MINT-8339590 MINT-6665330 MINT-4793467 MINT-8380636 MINT-4049616 MINT-4054304 MINT-7905142 MINT-8385480 MINT-7013780 MINT-6540889 MINT-8385531 MINT-8385552 MINT-8385886 MINT-8388795 MINT-8415355 MINT-6540807 MINT-8391984 MINT-7905326 MINT-6540796 I2D: score=12 STRING: ENSP00000269305
    ENSG00000206206Q9UER71, 2, 3EBI-389668,EBI-77321 MINT-6801769 MINT-6801621 MINT-6801754 MINT-6801730 MINT-6801697 I2D: score=4 
    ENSG00000206279Q9UER71, 2, 3EBI-389668,EBI-77321 MINT-6801769 MINT-6801621 MINT-6801754 MINT-6801730 MINT-6801697 I2D: score=4 
    ENSG00000227046Q9UER71, 2, 3EBI-389668,EBI-77321 MINT-6801769 MINT-6801621 MINT-6801754 MINT-6801730 MINT-6801697 I2D: score=4 
    ENSG00000231617Q9UER71, 2, 3EBI-389668,EBI-77321 MINT-6801769 MINT-6801621 MINT-6801754 MINT-6801730 MINT-6801697 I2D: score=4 
    About this table

    Gene Ontology (GO): Selected biological process terms (see all 56):    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0000122negative regulation of transcription from RNA polymerase II promoter IDA9271120
    GO:0006461protein complex assembly IDA10608892
    GO:0006977DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest TAS--
    GO:0007089traversing start control point of mitotic cell cycle IEA--
    GO:0007173epidermal growth factor receptor signaling pathway TAS--

    MDM2 for ontologies           About GeneDecksing



    (Chemical Compounds according to UniProtKB, Enzo Life Sciences, EMD Millipore, Tocris Bioscience, ApexBio, HMDB, BitterDB, and/or Novoseek, Ligands according to IUPHAR, and Drugs according to DrugBank, Enzo Life Sciences, and/or PharmGKB)
    About This Section

    TryGeneCards Plus
    Browse Small Molecules at EMD Millipore
       Browse drugs & compounds from Enzo Life Sciences
    Selected ApexBio Compounds for MDM2 (see all 15)     About this table
    CompoundAction CAS #
    AMG232potent and selective piperidinone inhibitor of the MDM2-p53 interaction--
    CP 31398 dihydrochloridep53 stabilizing agent. [1217195-61-3]
    JNJ-26854165 (Serdemetan)p53 activator, blocking Mdm2-p53 interaction[881202-45-5]
    Nutlin-3inhibitor of the MDM2/p53 interaction[890090-75-2]
    Nutlin-3a chiralinhibits the MDM2-p53 interaction and activates p53. [675576-98-4]
    p53 and MDM2 proteins-interaction-inhibitor chiralinhibitor of the interaction between p53 and MDM2 proteins[939981-37-0]
    Pifithrin-miuInhibits p53 binding to mitochondria[64984-31-2]
    PRIMA-1Cell-permeable BAX inhibitor, restore p53 activity[5608-24-2]
    PRIMA-1METCell-permeable BAX inhibitor, restore p53 activity[5291-32-7]
    RG7112Restoration of p53 activity by inhibiting the p53-MDM2 interaction[939981-39-2]

    Compounds for MDM2 available from Tocris Bioscience    About this table
    CompoundAction CAS #
    Tenovin-1Protects against MDM2-mediated p53 degradation[380315-80-0]
    Nutlin-3MDM2 antagonist; inhibits MDM2-p53 interaction[548472-68-0]
    SKPin C1Inhibits Skp2-mediated p27 degradation; induces cell cycle arrest[432001-69-9]
    TAME hydrochlorideUbiquitin ligase APC/C inhibitor; promotes Cdc20 autoubiquitination[1784-03-8]
    SMER 3Selective inhibitor of E3 ubiquitin ligase[67200-34-4]

    4 HMDB Compounds for MDM2    About this table
    CompoundSynonyms CAS #PubMed Ids
    Adenosine monophosphate5'-AMP (see all 28)61-19-8--
    Adenosine triphosphate5'-(tetrahydrogen triphosphate) Adenosine (see all 24)56-65-5--
    Phosphoric acidacide phosphorique (FRENCH) (see all 20)7664-38-2--
    Pyrophosphate(4-)Diphosphoric acid ion (see all 10)14000-31-8--

    2 DrugBank Compounds for MDM2    About this table
    CompoundSynonyms CAS #TypeActionsPubMed Ids
    Cis-[4,5-Bis-(4-Chlorophenyl)-2-(2-Isopropoxy-4-Methoxyphenyl)-4,5-Dihyd Roimidazol-1-Yl]-Piperazin-1-Yl-Methanone-- --target--17139284 17016423 10592235
    Cis-[4,5-Bis-(4-Bromophenyl)-2-(2-Ethoxy-4-Methoxyphenyl)-4,5-Dihydroimidazol-1-Yl]-[4-(2-Hydroxyethyl)Piperazin-1-Yl]Methanone-- --target--17139284 17016423

    Selected Novoseek inferred chemical compound relationships for MDM2 gene (see all 102)    About this table
    Compound   -log (P-Val)   Hits   PubMed IDs for Articles with Shared Sentences (# sentences)
    noxa 55.7 7 18340116 (1), 14749479 (1), 19934289 (1), 17043642 (1) (see all 7)
    leptomycin b 53.6 13 10222137 (3), 9819415 (2), 12653667 (1), 17178878 (1) (see all 6)
    10-hydroxycamptothecin 47.4 3 12149568 (1), 10493945 (1), 13130078 (1)
    mg 132 46.3 10 9438391 (2), 12640129 (1), 16571800 (1), 11526482 (1) (see all 7)
    camptothecin 44.1 11 19261878 (1), 19136059 (1), 10399957 (1), 17056014 (1) (see all 6)
    cisplatin 39.1 61 16815295 (6), 7761100 (4), 11761456 (4), 9700726 (3) (see all 23)
    p202 38.9 2 8910340 (1)
    adriamycin 38.4 20 10637478 (3), 12640129 (2), 10775510 (2), 15064747 (2) (see all 11)
    doxorubicin 35.4 28 9548451 (4), 10544021 (2), 11964305 (2), 14766674 (2) (see all 15)
    oligonucleotide 33.8 44 18038763 (4), 11894120 (2), 12149568 (2), 11072252 (2) (see all 20)



    MDM2 for compounds           About GeneDecksing



    (Secondary structures according to fRNAdb,
    GenBank/EMBL/DDBJ Accessions according to
    Unigene (Build 236 Homo sapiens; Apr 25 2013) or GenBank,
    RefSeq according to Entrez Gene,
    DOTS (version 10), and/or AceView, transcript ids from Ensembl with links to UCSC,
    exon structure from GeneLoc, alternative splicing isoforms according to ASD and/or ECgene,
    siRNAs from OriGene, QIAGEN, shRNA from OriGene, microRNA from QIAGEN, SwitchGear Genomics,
    Tagged/untagged cDNA clones from OriGene, GenScript, DNA2.0, Vector BioLabs, Primers from OriGene, and/or QIAGEN )
    About This Section

    TryGeneCards Plus

    REFSEQ mRNAs for MDM2 gene (12 alternative transcripts): 
    NM_001145337.2  NM_001145339.2  NM_001145340.2  NM_001278462.1  NM_002392.5  NM_001145336.1  NM_006878.3  NM_006879.3  
    NM_006880.2  NM_006881.3  NM_006882.3  NM_032739.1  

    Unigene Cluster for MDM2:

    MDM2 oncogene, E3 ubiquitin protein ligase
    Hs.484551  [show with all ESTs]
    Unigene Representative Sequence: NM_002392
    Selected Ensembl transcripts including schematic representations, and UCSC links where relevant (see all 37):
    ENST00000462284(uc001sui.3 uc021rad.1 uc009zqx.3 uc001sun.4 uc009zra.3 uc021raf.1 uc009zrc.3 uc009zrd.3 uc009zre.3 uc001suo.3 uc009zrf.3 uc009zrg.3 uc009zrh.3 uc021rag.1 uc021rah.1 uc021rai.1 uc021raj.1)
    ENST00000311420 ENST00000493419 ENST00000393417(uc009zrb.1) ENST00000258148
    ENST00000539479(uc009zqy.1) ENST00000393415(uc021rae.1) ENST00000523991
    ENST00000543323 ENST00000393416 ENST00000544561 ENST00000393410 ENST00000496959
    ENST00000299252 ENST00000481186 ENST00000360430 ENST00000517852 ENST00000545204

    miRNA
    Products:
         
    Block miRNA regulation of human, mouse, rat MDM2 using miScript Target Protectors
    7 qRT-PCR Assays for microRNAs that regulate MDM2:
    hsa-miR-548a-3p hsa-miR-494 hsa-miR-513a-3p hsa-miR-548e hsa-miR-551b* hsa-miR-548c-3p hsa-miR-556-5p
    SwitchGear 3'UTR luciferase reporter plasmidMDM2 3' UTR sequence
    Inhib. RNA
    Products:
         
    OriGene RNAi products in human, mouse, rat for MDM2
    Predesigned siRNA for gene silencing in human, mouse, rat MDM2
    Clone
    Products:
         
    OriGene clones in human, mouse for MDM2 (see all 24)
    OriGene ORF clones in mouse, rat for MDM2
    OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
    GenScript: all cDNA clones in your preferred vector: MDM2 (NM_002392)
    DNA2.0 Custom Codon Optimized Gene Synthesis Service for MDM2
    Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat MDM2
    Primer
    Products:
        
    OriGene qPCR primer pairs and template standards for MDM2
    OriGene qSTAR qPCR primer pairs in human, mouse for MDM2
    Pre-validated RT2 qPCR Primer Assay in human, mouse, rat MDM2
      QuantiTect SYBR Green Assays in human, mouse, rat MDM2
      QuantiFast Probe-based Assays in human, mouse, rat MDM2

    Additional mRNA sequence: 

    AF092843.1 AF092844.1 AF092845.1 AF201370.1 AF201371.1 AF385322.1 AF385323.1 AF385324.1 
    AF385325.1 AF385327.1 AJ278975.1 AJ430612.1 AJ430613.1 AJ430614.1 AJ491698.1 AJ491700.1 
    AJ491701.1 AJ550517.1 AJ550519.1 AK094838.1 AK290341.1 AK312105.1 BC006795.1 BC065505.1 
    BC107414.1 BC152384.1 BC152390.1 BT007258.1 EU076746.1 EU076747.1 EU076748.1 EU076749.1 
    GQ848196.1 JX015379.1 JX015380.1 JX015386.1 JX015389.1 JX015390.1 JX015391.1 JX015392.1 
    M92424.1 U33199.1 U33200.1 U33201.1 U33202.1 U33203.1 Z12020.1 

    Selected DOTS entries (see all 27):

    DT.92448784  DT.100787335  DT.95193404  DT.91749816  DT.100686963  DT.95193408  DT.121211579  DT.204679 
    DT.100787329  DT.40118121  DT.451569  DT.121167413  DT.121211593  DT.92448783  DT.100027326  DT.100651391 
    DT.100787331  DT.40118120  DT.75138122  DT.91749814  DT.95193415  DT.95193421  DT.95306934  DT.100644736 

    Selected AceView cDNA sequences (see all 214):

    AA825908 AI373062 U33201 AA664060 AJ550518 BG235894 AJ278975 AA321304 
    AJ491700 BF446187 CB178722 AJ550520 AJ491698 AF385323 AF385327 AJ278977 
    AF201370 AF201371 BG532258 BT007258 CB269619 NM_006878 BF155177 AJ550517 

    GeneLoc Exon Structure

    Selected Alternative Splicing Database (ASD) splice patterns (SP) for MDM2 (see all 16)    About this scheme

    ExUns: 1a · 1b · 1c ^ 2a · 2b ^ 3 ^ 4 ^ 5 ^ 6a · 6b ^ 7 ^ 8 ^ 9 ^ 10 ^ 11 ^ 12 ^ 13a · 13b · 13c
    SP1:                                      -     -           -                                                         
    SP2:                                      -     -     -     -                                                         
    SP3:                                      -     -           -           -     -                                       
    SP4:                                      -     -           -                                                         
    SP5:                                      -     -     -     -                                                         


    ECgene alternative splicing isoforms for MDM2

    (RNA expression data according to H-InvDB, NONCODE, miRBase, and RNAdb, Expression images according to data from BioGPS, Illumina Human BodyMap, and CGAP SAGE, Sets of similar genes according to GeneDecks, in vivo and in vitro expression data from LifeMap Discovery™, Protein expression images according to data from SPIRE 1MOPED, 2PaxDb, and 3MaxQB, plus additional links to SOURCE, and/or BioGPS, and/or UniProtKB,
    PCR Arrays from QIAGEN, Primers from OriGene, and/or QIAGEN, In Situ Hybridization Assays from Advanced Cell Diagnostics)
    About This Section

    TryGeneCards Plus

    MDM2 expression in normal human tissues (normalized intensities)
    See probesets specificity/sensitivity at GeneAnnot
    About this imageBioGPS <intensity>2/3
    CGAP TAG: TGCAAAGAAG
    MDM2 Expression
    About this image


    MDM2 expression in embryonic tissues and stem cells    About this table
    Data from LifeMap, the Embryonic Development and Stem Cells Database
     selected tissues (see all 7) fully expand
     
     Brain (Nervous System)    fully expand to see all 4 entries
             Cerebral Cortex
     
     Ovary (Reproductive System)    fully expand to see all 2 entries
             Ovarian Mesenchymal Stroma Cells Ovary Interstitium
             Oviduct
     
     Trophoblast (Extraembryonic Tissues)
             Trophoblast Cells Trophoblast
     
     Pancreas (Endocrine System)
             Islets of Langerhans
     
     Testis (Reproductive System)
             Leydig Cells Testis Interstitium
    MDM2 Protein expression data from MOPED1, PaxDb2 and MaxQB3    About this image

    MDM2 Protein Expression

    SOURCE GeneReport for Unigene cluster: Hs.484551

    UniProtKB/Swiss-Prot: MDM2_HUMAN, Q00987
    Tissue specificity: Ubiquitous. Isoform Mdm2-A, isoform Mdm2-B, isoform Mdm2-C, isoform Mdm2-D, isoform Mdm2-E,
    isoform Mdm2-F and isoform Mdm2-G are observed in a range of cancers but absent in normal tissues

        Pathway & Disease-focused RT2 Profiler PCR Arrays including MDM2 (see all 11): 
              Oncogenes & Tumor Suppressor Genes in human mouse rat
              Nitric Oxide Signaling Pathway in human mouse rat
              Tumor Metastasis in human mouse rat
              Ubiquitin Ligases in human mouse rat
              Ubiquitination (Ubiquitylation) Pathway in human mouse rat

    Primer
    Products:
    OriGene qPCR primer pairs and template standards for MDM2
    OriGene qSTAR qPCR primer pairs in human, mouse for MDM2
    Pre-validated RT2 qPCR Primer Assay in human, mouse, rat MDM2
    QuantiTect SYBR Green Assays in human, mouse, rat MDM2
    QuantiFast Probe-based Assays in human, mouse, rat MDM2
    In Situ
    Assay Products:
     

     
    Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for MDM2

    (Orthologs according to 1,2HomoloGene (2older version, for species not in 1newer version), 3euGenes, 4SGD , 5MGI Mar 06 2013, with possible further links to Flybase and/or WormBase, and/or 6Ensembl pan taxonomic compara , Gene Trees according to Ensembl and TreeFam)
    About This Section

    TryGeneCards Plus

    This gene was present in the common ancestor of chordates.

    Orthologs for MDM2 gene from Selected species (see all 14)    About this table
    Organism Taxonomic
    classification
    Gene Description Human
    Similarity
    Orthology
    Type
    Details
    mouse
    (Mus musculus)
    Mammalia Mdm21 , 5 transformed mouse 3T3 cell double minute 21, 5 82.71(n)1
    83.2(a)1
      10 (66.32 cM)5
    172461  NM_010786.31  NP_034916.11 
     1176888885 
    chicken
    (Gallus gallus)
    Aves MDM21 Mdm2, p53 E3 ubiquitin protein ligase homolog (mouse) 72.03(n)
    68.68(a)
      395609  NM_001199384.1  NP_001186313.1 
    lizard
    (Anolis carolinensis)
    Reptilia MDM26
    MDM2 oncogene, E3 ubiquitin protein ligase
    53(a)
    1 ↔ 1
    GL343256.1(1439727-1455148)
    African clawed frog
    (Xenopus laevis)
    Amphibia Xl.108852 Xenopus laevis transcribed sequence with weak similarity more 73.75(n)    BQ385125.1 
    zebrafish
    (Danio rerio)
    Actinopterygii mdm22 murine double minute 2 homolog 71.63(n)   30637  AF356346.1 


    ENSEMBL Gene Tree for MDM2 (if available)
    TreeFam Gene Tree for MDM2 (if available)

    (Paralogs according to 1HomoloGene,
    2Ensembl, and 3SIMAP, Pseudogenes according to 4Pseudogene.org Build 68)
    About This Section

    TryGeneCards Plus
    Paralogs for MDM2 gene
    MDM42  
    10 SIMAP similar genes for MDM2 using alignment to 31 protein entries:     MDM2_HUMAN (see all proteins):
    mdm2    HDM2    L3MBTL2    MDM2 isoform N1_40    MDM2 isoform KB9    DKFZp781B1423
    MDM4    DKFZp686B01123    ETFA    NEURL1B

    MDM2 for paralogs           About GeneDecksing


    2 Pseudogenes.org Pseudogenes for MDM2
    PGOHUM00000259775 PGOHUM00000240593


    (SNPs/Variants according to the 1NCBI SNP Database, 2Ensembl, 3PupaSUITE, 4UniProtKB, and DNA2.0, Linkage Disequilibrium by HapMap, Structural Variations(CNVs/InDels/Inversions) from the Database of Genomic Variants, Mutations from the Human Gene Mutation Database (HGMD), the Human Cytochrome P450 Allele Nomenclature Database, and the Locus Specific Mutation Databases (LSDB), Blood group antigen gene mutations by BGMUT, Resequencing Primers, Cancer Mutation PCR Arrays and Assays, and Copy Number PCR Arrays from QIAGEN)
    About This Section

    TryGeneCards Plus

    Polymorphic Variants from UniProtKB/Swiss-Prot
    MDM2_HUMAN, Q00987: A polymorphism in the MDM2 promoter is associated with susceptibility to accelerated tumor formation
    in both hereditary and sporadic cancers [MIM:614401]. It also contributes to susceptibility to Li-Fraumeni
    syndrome, in patients carrying a TP53 germline mutation


    Selected SNPs for MDM2 (see all 922)    About this table    
    Genomic DataTranscription Related DataAllele Frequencies
    SNP IDValidClinical
    significance
    Chr 12 posSequence#AA
    Chg
    TypeMore#Allele
    freq
    PopTotal
    sample
    More
    ----------
    rs1153999191,2
    C,F--69037213(+) GCACAA/TACCCA 1 -- us2k11Minor allele frequency- T:0.08WA 118
    rs1475658861,2
    --69037234(+) TGATAG/TTTAAC 1 -- us2k10--------
    rs1887975101,2
    --69037357(+) TCTGCC/TTCCCG 1 -- us2k10--------
    rs1403302471,2
    C--69037383(+) TCTGCC/TTCAGC 1 -- us2k10--------
    rs1815507851,2
    --69037499(+) CCTAAC/TCTCGT 1 -- us2k10--------
    rs11449441,2
    C,F,A--69037510(+) GATCCG/ACCCAC 1 -- us2k17Minor allele frequency- A:0.38NA WA CSA 13
    rs1456726811,2
    --69037560(+) CCGTGC/TGCAGC 1 -- us2k10--------
    rs794050011,2
    C,F--69037673(+) GATGAA/GGATGA 1 -- us2k11Minor allele frequency- G:0.03NA 120
    rs1505500231,2
    C--69037801(+) GCGGG-/AGAAGGGAAGGATATAACT
    TTATAAAAAAAAAAAAGCTGC
    AGAAG
    1 -- us2k10--------
    rs37304851,2
    C,F--69037870(+) AAAAA-/AAAAAGCTGCAGAAGGGAAGGATATAACTNTATAAAAAA
    A
    /AAAAAGCTGCAGAAGGGAAGGATATAACTTTATAAAAAAA
    GGTCC
    1 -- us2k11NS 176

    HapMap Linkage Disequilibrium report for MDM2 (69201956 - 69239214 bp)

    Structural Variations
         Database of Genomic Variants (DGV) 2 variations for MDM2:    About this table    
    Variant IDTypeSubtypePubMed ID
    esv1668742CNV Insertion17803354
    nsv899226CNV Loss21882294

    Human Gene Mutation Database (HGMD): MDM2
    Site Specific Mutation Identification with PCR Assays
    2 Copy Number PCR Panels containing MDM2:
    Oncogenes & Tumor Suppressor Genes 384HC
    Lung Cancer
    SeqTarget long-range PCR primers for resequencing MDM2
    DNA2.0 Custom Variant and Variant Library Synthesis for MDM2

    (in which this Gene is Involved, According to MalaCards, OMIM, UniProtKB, the University of Copenhagen DISEASES database, Novoseek, Genatlas, GeneTests, GAD, HuGE Navigator, and/or TGDB.)
    About This Section

    TryGeneCards Plus
    OMIM gene information: 164785   
    OMIM disorders: 614401  
    UniProtKB/Swiss-Prot: MDM2_HUMAN, Q00987
  • Note=Seems to be amplified in certain tumors (including soft tissue sarcomas, osteosarcomas and gliomas).
    A higher frequency of splice variants lacking p53 binding domain sequences was found in late-stage and high-grade
    ovarian and bladder carcinomas. Four of the splice variants show loss of p53 binding

  • Selected diseases for MDM2 (see all 208):    
    About MalaCards
    accelerated tumor formation    soft tissue sarcoma    malignant fibrous histiocytoma of bone    anal squamous cell carcinoma
    perinephritis    adult medulloblastoma    retroperitoneal sarcoma    hodgkin lymphoma, childhood
    non-hodgkin lymphoma, childhood    spindle cell liposarcoma    atypical lipomatous tumor    dedifferentiated liposarcoma
    uterine sarcoma    adult astrocytic tumour    mixed-type liposarcoma    undifferentiated embryonal sarcoma of the liver
    chromosome 5q deletion    orbit rhabdomyosarcoma    retroperitoneal fibrosis    sapho syndrome

    4 diseases from the University of Copenhagen DISEASES database for MDM2:
    Cancer     Lipoma     Li-Fraumeni syndrome     Eye disease

    MDM2 for disorders           About GeneDecksing

    Selected Novoseek inferred disease relationships for MDM2 gene (see all 96)    About this table

    Disease   -log (P-Val)   Hits   PubMed IDs for Articles with Shared Sentences (# sentences)
    liposarcoma dedifferentiated 84.6 30 15221942 (4), 18500263 (3), 9071997 (2), 18214854 (2) (see all 20)
    tumors 80.8 1210 9671804 (7), 10815906 (5), 10072445 (5), 10918230 (5) (see all 99)
    liposarcoma 78.5 80 18836421 (7), 14694526 (4), 18820664 (3), 19820690 (3) (see all 37)
    retinoblastoma 71.4 60 18644346 (5), 19524506 (3), 18045074 (3), 16966622 (2) (see all 37)
    cancer 70.8 340 16243710 (5), 12149568 (4), 15720187 (4), 17931661 (4) (see all 99)
    sarcoma 70.6 144 18521197 (4), 16160477 (4), 8064888 (4), 14614050 (3) (see all 84)
    glioblastoma 63.4 60 9034372 (6), 9810172 (3), 11212898 (3), 12635658 (3) (see all 30)
    osteosarcoma 62.8 79 8416741 (5), 8781571 (4), 10374529 (3), 15310147 (3) (see all 40)
    li-fraumeni syndrome 61.3 5 16478747 (1), 7923211 (1), 16983111 (1), 16203772 (1) (see all 5)
    anaplastic astrocytoma 56.9 7 12700122 (2), 12241107 (1), 7815080 (1), 9266437 (1) (see all 6)

    Genetic Association Database (GAD): MDM2
    Human Genome Epidemiology (HuGE) Navigator: MDM2 (192 documents)
    Tumor Gene Database (TGDB): MDM2

    Export disorders for MDM2 gene to outside databases

    (in PubMed. Associations of this gene to articles via 1Entrez Gene, 2UniProtKB/Swiss-Prot, 3HGNC, 4GAD, 5PharmGKB, 6HMDB, 7DrugBank, 8UniProtKB/TrEMBL, 9 Novoseek, and/or 10fRNAdb)
    About This Section

    TryGeneCards Plus

    PubMed articles for MDM2 gene, integrated from 10 sources (see all 2305):
    (articles sorted by number of sources associating them with MDM2)
        Utopia: connect your pdf to the dynamic
    world of online information

    1. Amplification of a gene encoding a p53-associated protein in human sarcomas. (PubMed id 1614537)1, 2, 3 Oliner J.D.... Vogelstein B. (Nature 1992)
    2. The deubiquitinating enzyme USP2a regulates the p53 pathway by targeting Mdm2. (PubMed id 17290220)1, 2, 9 Stevenson L.F....Saville M.K. (EMBO J. 2007)
    3. Combined effects of p73 and MDM2 polymorphisms on the risk of lung cancer. (PubMed id 17013834)1, 4, 9 Jun H.J....Park J.Y. (Mol. Carcinog. 2007)
    4. Structure of the MDM2 oncoprotein bound to the p53 tumor suppressor transactivation domain. (PubMed id 8875929)1, 2, 9 Kussie P.H.... Pavletich N.P. (Science 1996)
    5. Iron-dependent regulation of MDM2 influences p53 activity and hepatic carcinogenesis. (PubMed id 20019189)1, 4, 9 Dongiovanni P....Valenti L. (Am. J. Pathol. 2010)
    6. MDM2 promotes proteasome-dependent ubiquitin-independent degradation of retinoblastoma protein. (PubMed id 16337594)1, 2, 9 Sdek P.... Xiao Z.X. (Mol. Cell 2005)
    7. A novel functional polymorphism C1797G in the MDM2 promoter is associated with risk of bladder cancer in a Chinese population. (PubMed id 18519798)1, 4, 9 Wang M....Zhang Z. (Clin. Cancer Res. 2008)
    8. Genetic polymorphisms in cell cycle regulatory genes MDM2 and TP53 are associated with susceptibility to lung cancer. (PubMed id 16287156)1, 4, 9 Zhang X....Lin D. (Hum. Mutat. 2006)
    9. Genetic variants in the MDM2 promoter and lung cancer risk in a Chinese population. (PubMed id 16152608)1, 4, 9 Hu Z....Shen H. (Int. J. Cancer 2006)
    10. Polymorphisms in the MDM2 promoter and risk of breast cancer: a case-control analysis in a Chinese population. (PubMed id 16288830)1, 4, 9 Ma H....Shen H. (Cancer Lett. 2006)

    (in PubMed, OMIM, and NCBI Bookshelf)
    About This Section

    TryGeneCards Plus
     ANDOR
    Aliases
    Disorders
    Free Text  

      Query String
    PubMed
    OMIM
    NCBI Bookshelf
      (Note: In FireFox, select the above section and copy using Ctrl-C)

    (According to Entrez Gene, HGNC, AceView, euGenes, Ensembl, miRBase, ECgene, Kegg, and/or H-InvDB)
    About This Section

    TryGeneCards Plus
    Entrez Gene: 4193 HGNC: 6973 AceView: MDM2 Ensembl:ENSG00000135679 euGenes: HUgn4193
    ECgene: MDM2 Kegg: 4193 H-InvDB: MDM2

    (According to HUGE)
    About This Section

    TryGeneCards Plus
      --

    (According to PharmGKB, ATLAS, HORDE, IMGT, LEIDEN, UniProtKB/Swiss-Prot, UniProtKB/TrEMBL, and/or others, e.g. Wikipedia and GeneReviews, via UniProtKB/Swiss-Prot)
    About This Section

    TryGeneCards Plus
    NameDescription
    PharmGKB entry for MDM2 Pharmacogenomics, SNPs, Pathways
    ATLAS Chromosomes in Cancer entry for MDM2 Genetics and Cytogenetics in Oncology and Haematology
    NIEHS-SNPshttp://egp.gs.washington.edu/data/mdm2/
    Wikipedia http://en.wikipedia.org/wiki/Mdm2

    (Patent information from GeneIP,
    Licensable technologies from WIS Yeda, Salk, Tufts,
    IP news from LifeMap Sciences, Inc.)
    About This Section

    TryGeneCards Plus
    Patent Information for MDM2 gene:
    Search GeneIP for patents involving MDM2

    GeneCards and IP:
    Japan Patent Office Licenses GeneCards     European Patent Office Licenses GeneCards     Improving the IP Search



    (Antibodies, recombinant proteins, and assays from EMD Millipore, R&D Systems, OriGene, QIAGEN, GenScript, Cell Signaling Technology, Novus Biologicals, Sino Biological, Enzo Life Sciences, Abcam, ProSpec, Cloud-Clone Corp., Thermo Fisher Scientific, LSBio, Gene Editing from DNA2.0. Clones from OriGene, GenScript, Sino Biological, DNA2.0, SwitchGear Genomics, Vector BioLabs, Cell lines from GenScript, and ESI BIO, PCR Arrays from QIAGEN, Drugs and/or compounds from EMD Millipore, Tocris Bioscience, Enzo Life Sciences, and/or ApexBio, In Situ Hybridization Assays from
    Advanced Cell Diagnostics, Animal models from inGenious Targeting Laboratory, genOway)
    About This Section

    TryGeneCards Plus

     Browse Kits and Assays available from EMD Millipore
     Browse Purified and Recombinant Proteins at EMD Millipore
     EMD Millipore Mono- and Polyclonal Antibodies for the study of MDM2
     Browse Small Molecules at EMD Millipore
     
     EMD Millipore genomic analysis products

      
     Antibodies for MDM2 (MDM2/HDM2)   Browse Cell Culture Products  
     ELISAs for MDM2 (MDM2/HDM2)   Browse Flow Cytometry Kits  
     Browse Primer Pairs   Browse Enzyme Activity Assays/Reagents  
     Browse ELISpot/FluoroSpot Kits/Development Modules   Browse TFB/Immunoprecipitation Assays  
     Browse Apoptosis Detection Kits/Reagents   Ubiquitin Proteasome Pathway (UPP) Assay Kits/Reagents for MDM2 (MDM2/HDM2)  
     Browse DNA Damage/Repair Kits/Reagents   Browse Luminex Assays  
     Browse Cell Selection/Detection Kits/Reagents   Browse Secondary Antibodies/Controls/Staining Reagents  
     Recombinant/Natural Proteins for MDM2 (MDM2/HDM2)   Browse Stem Cell Products  
     Browse cDNA Clones   Browse Proteome Profiler Antibody Arrays  
     OriGene Antibodies for MDM2   OriGene RNAi products in human, mouse, rat for MDM2  
     OriGene qPCR primer pairs and template standards for MDM2   OriGene Protein Over-expression Lysate for MDM2  
     OriGene Custom Mass Spec   OriGene clones in human, mouse for MDM2  
     OriGene qSTAR qPCR primer pairs in human, mouse for MDM2   Browse OriGene full length recombinant human proteins expressed in human HEK293 cells  
     OriGene ORF clones in mouse, rat for MDM2   OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling  
     OriGene Custom Antibody Services for MDM2   OriGene Custom Protein Services for MDM2  

     
     
     Block miRNA regulation of human, mouse, rat MDM2 using miScript Target Protectors SeqTarget long-range PCR primers for resequencing MDM2
     DNA Methylation CpG Assay Predesigned for Pyrosequencing in human, mouse, rat MDM2 Predesigned siRNA for gene silencing in human, mouse, rat MDM2
     QuantiFast Probe-based Assays in human, mouse, rat MDM2 QuantiTect SYBR Green Assays in human, mouse, rat MDM2
     PCR Arrays including human, mouse, rat MDM2 Search Chromatin IP Primers for MDM2
     Pre-validated RT2 qPCR Primer Assay in human, mouse, rat MDM2  GeneGlobe Interaction Network for MDM2
     Regulatory tfbs in MDM2 promoter
     GenScript Custom Purified and Recombinant Proteins Services for MDM2 GenScript cDNA clones with any tag delivered in your preferred vector for MDM2
     GenScript Custom Assay Services for MDM2 GenScript Custom overexpressing Cell Line Services for MDM2
     CloneReady with Over 120,000 Genes  Gene Synthesis: Any Gene in Any Vector
     Vector-based siRNA and miRNA, Ready for Transfection Gene Mutant Library, Variants up to 10^11
     Plasmid Preparation Custom Peptide Services
     Antibodies & Assays for MDM2 

     Tocris compounds for MDM2
     Browse Sino Biological Proteins
     Browse Sino Biological Cell Lysates
     cDNA Clones for MDM2
     4000+ Proteins
     Search Sino Biological for antibodies, proteins & pathways
     Protein Production Services
     Transfection Reagents
     Protein A/G/L resins
     Isotyping reagents
     Assays/Proteins for MDM2
     Search www.enzolifesciences.com for proteins, assays, substrates, inhibitors & antibodies

     Novus Tissue Slides
     MDM2 antibodies
     MDM2 proteins
     MDM2 lysates
     Antibodies for MDM2
     See all of Abcam's Antibodies, Kits and Proteins for MDM2
     Custom Antibody / Protein Production Service
     Bulk Purchasing
     Advantages of Rabbit Monoclonal antibodies
     Abcam protocols and scientific support
     Browse ProSpec Recombinant Proteins
     Proteins for MDM2
     Antibodies for MDM2
     ELISAs for MDM2
     CLIAs for MDM2



     Browse ESI BIO Cell Lines and PureStem Progenitors for MDM2
     Gene Synthesis
     Protein Engineering
     Variant Library Synthesis
     Codon Optimization
     Protein Production and Purification
     Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for MDM2
     SwitchGear 3'UTR luciferase reporter plasmids for MDM2
     SwitchGear Promoter luciferase reporter plasmids for MDM2
     ThermoFisher Antibody for MDM2
     Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat MDM2
     inGenious Targeting Laboratory: Let us create your new Knockout/Knockin mouse model for MDM2
     inGenious Targeting Laboratory: Contact us about creating complex and humanized mouse models for MDM2
     LSBio Antibodies in human, mouse, rat for MDM2
    Customized transgenic rodents for:
     Humanization
     Biomarker expression
     Off-target effect monitoring
     Translational medicine
     Tissue-specific gene expresssion
     Time-controlled gene expresssion
     ApexBio compounds for MDM2
           
    GeneCards Homepage - Last full update: 7 May 2014 - Incrementals: 9 May 2014 , 2 Jun 2014 , 26 Jun 2014 , 30 Jun 2014

    View Random Gene

    Category
    (GIFtS: )
    GIFtS Group
    The GeneCards human gene database gene index: 1 3 5 A B C D E F G H I J K L M N O P Q R S T U V W X Y Z 


    Developed at the Crown Human Genome Center, Department of Molecular Genetics, the Weizmann Institute of Science

    Hot genes      Disease genes      MDM2 gene at Home site.
    Version: 3.12.162 20 Aug 2014
    hostname: 356977-web1.xennexinc.com index build: 126 solr: 1.4