Set Analyses:
Advanced Search

Advanced Search

 
Search By
Section (entire)
for


 
or upload a file of gene symbols


Category   Symbol Source: HGNC EntrezGene Ensembl GeneCards RNA genes CroW21
GIFtS

MDM2 Gene

protein-coding   GIFtS: 74
GCID: GC12P069201

MDM2 Oncogene, E3 Ubiquitin Protein Ligase

(Previous names: mouse double minute 2, human homolog of; p53-binding protein,...)
Microbiology & Infectious Diseases Congress
  See related diseases
at  

(According to 1HGNC, 2Entrez Gene,
3UniProtKB/Swiss-Prot, 4UniProtKB/TrEMBL, 5OMIM, 6GeneLoc, 7Ensembl, 8DME, 9miRBase, 10fRNAdb, 12H-InvDB, 13NCBI, 14NONCODE, and/or 15RNAdb)
About This Section

Aliases
MDM2 Oncogene, E3 Ubiquitin Protein Ligase1 2     E3 Ubiquitin-Protein Ligase Mdm22
Oncoprotein Mdm22 3     hdm22
Mdm2 P53 Binding Protein Homolog (Mouse)1     Mdm2, P53 E3 Ubiquitin Protein Ligase Homolog2
Mdm2, P53 E3 Ubiquitin Protein Ligase Homolog (Mouse)1     Mdm2, Transformed 3T3 Cell Double Minute 2, P53 Binding Protein2
Mdm2, Transformed 3T3 Cell Double Minute 2, P53 Binding Protein (Mouse)1     EC 6.3.2.-3
Mouse Double Minute 2, Human Homolog Of; P53-Binding Protein1     Hdm23
ACTFS2     Double Minute 2 Protein3
HDMX2     P53-Binding Protein Mdm23
Double Minute 2, Human Homolog Of; P53-Binding Protein2     EC 6.3.28

External Ids:    HGNC: 69731   Entrez Gene: 41932   Ensembl: ENSG000001356797   OMIM: 1647855   UniProtKB: Q009873   

Export aliases for MDM2 gene to outside databases

Previous GC identifers: GC12M068977 GC12P069030 GC12P068918 GC12P067488 GC12P066253


(According to Entrez Gene, Tocris Bioscience, Wikipedia's Gene Wiki, PharmGKB,
UniProtKB/Swiss-Prot, and/or UniProtKB/TrEMBL)
About This Section

Entrez Gene summary for MDM2 Gene:
This gene encodes a nuclear-localized E3 ubiquitin ligase. The encoded protein can promote tumor formation by
targeting tumor suppressor proteins, such as p53, for proteasomal degradation. This gene is itself
transcriptionally-regulated by p53. Overexpression or amplification of this locus is detected in a variety of
different cancers. There is a pseudogene for this gene on chromosome 2. Alternative splicing results in a
multitude of transcript variants, many of which may be expressed only in tumor cells. (provided by RefSeq, Jun
2013)

GeneCards Summary for MDM2 Gene: 
MDM2 (MDM2 oncogene, E3 ubiquitin protein ligase) is a protein-coding gene. Diseases associated with MDM2 include soft tissue sarcoma, and malignant fibrous histiocytoma of bone, and among its related super-pathways are Glioma and p53 Signaling. GO annotations related to this gene include enzyme binding and identical protein binding. An important paralog of this gene is MDM4.

UniProtKB/Swiss-Prot: MDM2_HUMAN, Q00987
Function: E3 ubiquitin-protein ligase that mediates ubiquitination of p53/TP53, leading to its degradation by the
proteasome. Inhibits p53/TP53- and p73/TP73-mediated cell cycle arrest and apoptosis by binding its
transcriptional activation domain. Also acts as an ubiquitin ligase E3 toward itself and ARRB1. Permits the
nuclear export of p53/TP53. Promotes proteasome-dependent ubiquitin-independent degradation of retinoblastoma RB1
protein. Inhibits DAXX-mediated apoptosis by inducing its ubiquitination and degradation. Component of the
TRIM28/KAP1-MDM2-p53/TP53 complex involved in stabilizing p53/TP53. Also component of the TRIM28/KAP1-ERBB4-MDM2
complex which links growth factor and DNA damage response pathways. Mediates ubiquitination and subsequent
proteasome degradation of DYRK2 in nucleus. Ubiquitinates IGF1R and SNAI1 and promotes them to proteasomal
degradation

summary for MDM2 Gene:
Ligases catalyze the joining of two molecules with concomitant hydrolysis of the diphosphate bond in ATP or
a similar triphosphate. They belong to the E.C. 6 class, which also includes synthases and carboxylases.
Ubiquitin ligases, such as MDM2, E3A and anaphase-promoting complex, attach ubiquitin molecules onto lysine
residues of target proteins. Ubiquitin ligases function as a complex of an E1-activating enzyme, an
E2-conjugating enzyme and an E3-ubiquiting enzyme. Using ATP, E1 activates the ubiquitin molecule and
transfer it to E2. E2 interacts with E3 partners to transfer the ubiquitin moeity to the target protein.
Generally multiple ubiquitin molecules are attached (polyubiquitination), which marks the target protein for
proteasomal degradation.

Gene Wiki entry for MDM2 (Mdm2) Gene


(According to GeneLoc and/or HGNC, and/or
Entrez Gene (NCBI build 37),
and/or miRBase,
Genomic Views according to UCSC (hg19) and Ensembl (release 73), Regulatory elements and Epigenetics data according to QIAGEN, SABiosciences, and/or SwitchGear Genomics)
About This Section
RefSeq DNA sequence:
NC_000012.11  NT_029419.12  NC_018923.2  
Regulatory elements:
   SABiosciences Regulatory transcription factor binding sites in the MDM2 gene promoter:
         AP-1   
         Other transcription factors

SwitchGear Promoter luciferase reporter plasmids (see all 2): MDM2 promoter sequence
   Search SABiosciences Chromatin IP Primers for MDM2

Epigenetics:
QIAGEN PyroMark CpG Assay predesigned Pyrosequencing DNA Methylation assays in human, mouse, rat MDM2


Genomic Location:
Genomic View: UCSC Golden Path with GeneCards custom track

Entrez Gene cytogenetic band: 12q14.3-q15   Ensembl cytogenetic band:  12q15   HGNC cytogenetic band: 12q13-q14

MDM2 Gene in genomic location: bands according to Ensembl, locations according to (and/or Entrez Gene and/or Ensembl if different)
MDM2 gene location

GeneLoc information about chromosome 12         GeneLoc Exon Structure

GeneLoc location for GC12P069201:  view genomic region     (about GC identifiers)

Start:
69,201,956 bp from pter      End:
69,239,214 bp from pter
Size:
37,259 bases      Orientation:
plus strand

(According to UniProtKB, HORDE, neXtProt, Ensembl, and/or Reactome, Modification sites according to PhosphoSitePlus, Specific Peptides from DME, Protein expression images according to data from SPIRE 1MOPED, 2PaxDb, and 3MAXQB RefSeq according to NCBI, PDB rendering according to OCA and/or Proteopedia, Recombinant Proteins from EMD Millipore, R&D Systems, GenScript, Enzo Life Sciences, OriGene, Novus Biologicals, Sino Biological, ProSpec, and/or Cloud-Clone Corp.,
Biochemical Assays by EMD Millipore, R&D Systems, OriGene, GenScript, Cell Signaling Technology, Enzo Life Sciences, and/or Cloud-Clone Corp., Ontologies according to Gene Ontology Consortium 01 Oct 2013 and Entrez Gene, Antibodies by EMD Millipore, R&D Systems, GenScript, Cell Signaling Technology, OriGene, Novus Biologicals, Thermo Fisher Scientific, LSBio, Abcam, and/or Cloud-Clone Corp.)
About This Section

UniProtKB/Swiss-Prot: MDM2_HUMAN, Q00987 (See protein sequence)
Recommended Name: E3 ubiquitin-protein ligase Mdm2  
Size: 491 amino acids; 55233 Da
Subunit: Binds p53/TP53, TP73/p73, ARF/P14, PML, RBL5 and RP11, and specifically to RNA. Can interact with RB1,
E1A-associated protein EP300 and the E2F1 transcription factor. Forms a ternary complex with p53/TP53 and WWOX.
Interacts with CDKN2AIP, MTBP, RFWD3, TBRG1, USP7, PYHIN1, UBXN6, and RBBP6. Isoform Mdm2-F does not interact
with p53/TP53. Interacts with and ubiquitinates HIV-1 Tat. Interacts with ARRB1 and ARRB2. Interacts (isoform 2)
with PSMA3. Found in a trimeric complex with MDM2, MDM4 and UPB2. Interacts with USP2 (via N-terminus and
C-terminus). Interacts with MDM4. Part of a complex with MDM2, DAXX, RASSF1 and USP7. Part of a complex with
DAXX, MDM2 and USP7. Interacts directly with DAXX and USP7. Interacts (via C-terminus) with RASSF1 isoform A (via
N-terminus); the interaction is independent of TP53. Interacts with APEX1; leading to its ubiquitination and
degradation. Interacts with RYBP; this inhibits ubiquitination of TP53. Identified in a complex with RYBP and
p53/TP53. Also component of the TRIM28/KAP1-MDM2-p53/TP53 complex involved in regulating p53/TP53 stabilization
and activity. Binds directly both p53/TP53 and TRIM28. Component of the TRIM28/KAP1-ERBB4-MDM2 complex involved
in connecting growth factor responses with DNA damage. Interacts directly with both TRIM28 and ERBB4 in the
complex. Interacts with DYRK2. Interacts with IGF1R. Interacts with TRIM13; the interaction ubiquitinates MDM2
leading to its proteasomal degradation. Interacts with SNAI1; this interaction promotes SNAI1 ubiquitination.
Interacts with NOTCH1 (via intracellular domain). Interacts with FHIT
Subcellular location: Nucleus, nucleoplasm. Cytoplasm. Nucleus, nucleolus. Note=Expressed predominantly in the
nucleoplasm. Interaction with ARF(P14) results in the localization of both proteins to the nucleolus. The
nucleolar localization signals in both ARF(P14) and MDM2 may be necessary to allow efficient nucleolar
localization of both proteins. Colocalizes with RASSF1 isoform A in the nucleus
Miscellaneous: MDM2 RING finger mutations that failed to ubiquitinate p53 in vitro did not target p53 for
degradation when expressed in cells
6/42 PDB 3D structures from and Proteopedia for MDM2 (see all 42):
1RV1 (3D)        1T4E (3D)        1T4F (3D)        1YCR (3D)        1Z1M (3D)        2AXI (3D)    
Secondary accessions: A6NL51 A8K2S6 Q13226 Q13297 Q13298 Q13299 Q13300 Q13301 Q53XW0 Q71TW9
Q8WYJ1 Q8WYJ2 Q9UGI3 Q9UMT8
Alternative splicing: 11 isoforms:  Q00987-1   Q00987-2   Q00987-3   Q00987-4   Q00987-5   Q00987-6   Q00987-7   Q00987-8   
Q00987-9   Q00987-10   Q00987-11   

Explore the universe of human proteins at neXtProt for MDM2: NX_Q00987

Explore proteomics data for MDM2 at MOPED 

Post-translational modifications:

  • UniProtKB: Phosphorylation on Ser-166 by SGK1 activates ubiquitination of p53/TP53. Phosphorylated at multiple sites near the
    RING domain by ATM upon DNA damage; this prevents oligomerization and E3 ligase processivity and impedes
    constitutive p53/TP53 degradation
  • UniProtKB: Auto-ubiquitinated; which leads to proteasomal degradation. Also ubiquitinated by TRIM13. Deubiquitinated by USP2
    leads to its accumulation and increases deubiquitination and degradation of p53/TP53. Deubiquitinated by USP7
    leading to its stabilization
  • View modification sites using PhosphoSitePlus
  • View neXtProt modification sites for NX_Q00987

  • 4/13 DME Specific Peptides for MDM2 (Q00987) (see all 13)
     MIYRNLV  DTYTMKE  DDKITQAS  GESDTDSFE 

    MDM2 Protein expression data from MOPED1, PaxDb2 and MAXQB3 :    About this image 

    MDM2 Protein Expression
    REFSEQ proteins (5 alternative transcripts): 
    NP_001138809.1  NP_001138811.1  NP_001138812.1  NP_001265391.1  NP_002383.2  

    ENSEMBL proteins: 
     ENSP00000417281   ENSP00000310742   ENSP00000429021   ENSP00000258148   ENSP00000444430  
     ENSP00000377067   ENSP00000427828   ENSP00000439238   ENSP00000377068   ENSP00000441841  
     ENSP00000377062   ENSP00000429692   ENSP00000299252   ENSP00000431110   ENSP00000353611  
     ENSP00000430257   ENSP00000444597   ENSP00000445222   ENSP00000445030   ENSP00000444566  
     ENSP00000443450   ENSP00000444028   ENSP00000377065   ENSP00000266624   ENSP00000335096  
     ENSP00000430906   ENSP00000258149   ENSP00000348637   ENSP00000440932   ENSP00000410694  
     ENSP00000377064  
    Reactome Protein details: Q00987
    Human Recombinant Protein Products for MDM2: 
    Browse Purified and Recombinant Proteins at EMD Millipore
    R&D Systems Recombinant & Natural Proteins for MDM2 (MDM2/HDM2)
    Enzo Life Sciences proteins for MDM2
    Browse OriGene full length recombinant human proteins expressed in human HEK293 cells
    OriGene Protein Over-expression Lysate for MDM2
    OriGene Custom MassSpec 
    OriGene Custom Protein Services for MDM2
    GenScript Custom Purified and Recombinant Proteins Services for MDM2
    Novus Biologicals MDM2 Proteins
    Novus Biologicals MDM2 Lysates
    Browse Sino Biological Recombinant Proteins
    Browse Sino Biological Cell Lysates 
    Browse ProSpec Recombinant Proteins
    Cloud-Clone Corp. Proteins for MDM2 

    Gene Ontology (GO): 5/10 cellular component terms (GO ID links to tree view) (see all 10):    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0005634nucleus IMP--
    GO:0005654nucleoplasm TAS--
    GO:0005730nucleolus IDA10707090
    GO:0005737cytoplasm IMP--
    GO:0005829cytosol TAS--

    MDM2 for ontologies           About GeneDecksing



    MDM2 Antibody Products: 
    EMD Millipore Mono- and Polyclonal Antibodies for the study of MDM2
    R&D Systems Antibodies for MDM2 (MDM2/HDM2)
    Cell Signaling Technology (CST) Antibodies for MDM2 
    OriGene Antibodies for MDM2
    OriGene Custom Antibody Services for MDM2
    GenScript Custom Superior Antibodies Services for MDM2
    Novus Biologicals MDM2 Antibodies
    Abcam antibodies for MDM2
    Cloud-Clone Corp. Antibodies for MDM2 
    ThermoFisher Antibody for MDM2
    LSBio Antibodies in human, mouse, rat for MDM2 

    Assay Products for MDM2: 
    Browse Kits and Assays available from EMD Millipore
    OriGene Custom Assay Services for MDM2
    R&D Systems ELISAs for MDM2 (MDM2/HDM2)         (see all)
    GenScript Custom Assay Services for MDM2
    Enzo Life Sciences assays for MDM2
    Cloud-Clone Corp. ELISAs for MDM2 
    Cloud-Clone Corp. CLIAs for MDM2


    (According to HGNC, IUPHAR, InterPro, ProtoNet, UniProtKB, and/or BLOCKS, Sets of similar genes according to GeneDecks)
    About This Section
    5/6 InterPro protein domains (see all 6):
     IPR001841 Znf_RING
     IPR016495 p53_neg-reg_MDM_2/4
     IPR003121 SWIB_MDM2_domain
     IPR013083 Znf_RING/FYVE/PHD
     IPR015459 MDM2_E3_ligase

    Graphical View of Domain Structure for InterPro Entry Q00987

    ProtoNet protein and cluster: Q00987

    2 Blocks protein domains:
    IPB001841 Zn-finger
    IPB001876 Zn-finger


    UniProtKB/Swiss-Prot: MDM2_HUMAN, Q00987
    Domain: Region I is sufficient for binding p53 and inhibiting its G1 arrest and apoptosis functions. It also binds
    p73 and E2F1. Region II contains most of a central acidic region required for interaction with ribosomal protein
    L5 and a putative C4-type zinc finger. The RING finger domain which coordinates two molecules of zinc interacts
    specifically with RNA whether or not zinc is present and mediates the heterooligomerization with MDM4. It is also
    essential for its ubiquitin ligase E3 activity toward p53 and itself
    Similarity: Belongs to the MDM2/MDM4 family
    Similarity: Contains 1 RanBP2-type zinc finger
    Similarity: Contains 1 RING-type zinc finger
    Similarity: Contains 1 SWIB domain


    MDM2 for domains           About GeneDecksing


    (According to 1UniProtKB, Genatlas, LifeMap Discovery™, IUBMB, and/or 2DME, Human phenotypes from GenomeRNAi, Animal models from MGI Mar 06 2013, inGenious Targeting Laboratory, genOway,
    bound targets from SABiosciences, miRNA Gene Targets from miRTarBase, shRNA from OriGene, RNAi from EMD Millipore, siRNAs from OriGene, QIAGEN, microRNA from QIAGEN, Gene Editing from DNA2.0, Sirion Biotech, Clones from EMD Millipore, OriGene, SwitchGear Genomics, GenScript, Sino Biological, DNA2.0, Vector BioLabs, and Sirion Biotech, Cell Lines from GenScript, LifeMap BioReagents, In Situ Hybridization Assays from Advanced Cell Diagnostics, Ontologies according to Gene Ontology Consortium 01 Oct 2013 via Entrez Gene.)
    About This Section

    Molecular Function:

         UniProtKB/Swiss-Prot Summary: MDM2_HUMAN, Q00987
    Function: E3 ubiquitin-protein ligase that mediates ubiquitination of p53/TP53, leading to its degradation by the
    proteasome. Inhibits p53/TP53- and p73/TP73-mediated cell cycle arrest and apoptosis by binding its
    transcriptional activation domain. Also acts as an ubiquitin ligase E3 toward itself and ARRB1. Permits the
    nuclear export of p53/TP53. Promotes proteasome-dependent ubiquitin-independent degradation of retinoblastoma RB1
    protein. Inhibits DAXX-mediated apoptosis by inducing its ubiquitination and degradation. Component of the
    TRIM28/KAP1-MDM2-p53/TP53 complex involved in stabilizing p53/TP53. Also component of the TRIM28/KAP1-ERBB4-MDM2
    complex which links growth factor and DNA damage response pathways. Mediates ubiquitination and subsequent
    proteasome degradation of DYRK2 in nucleus. Ubiquitinates IGF1R and SNAI1 and promotes them to proteasomal
    degradation
    Induction: By DNA damage

         Genatlas biochemistry entry for MDM2:
    p53 associated protein 9,(homolog to murine oncogene Mdm2,present on a mouse double minute
    chromosome),downregulating TP53,acting as an E3 ubiquitin ligase directly transferring ubiquitin and targetting
    TP53 to proteasome complex for degradation,expressed in different layers of normal skin,amplified in human
    sarcoma,malignant glioma,angiosarcoma,liposarcoma and anaplastic astrocytoma,and diffuse large B cell lymphoma

         Enzyme Numbers (IUBMB): EC 6.3.2.-1 EC 6.3.22

         Gene Ontology (GO): 5/8 molecular function terms (GO ID links to tree view) (see all 8):    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0002039p53 binding IPI15053879
    GO:0004842ubiquitin-protein ligase activity IMP19372219
    GO:0005515protein binding IPI10196247
    GO:0008270zinc ion binding IDA10722742
    GO:0019899enzyme binding IPI15577914
         
    MDM2 for ontologies           About GeneDecksing


    Phenotypes:
         3 GenomeRNAi human phenotypes for MDM2:
     Decreased influenza A/WSN/33 r  Increased cell death HMECs cel  Synthetic lethal with c-Myc af 

         15/22 MGI mutant phenotypes (inferred from 17 alleles(MGI details for Mdm2) (see all 22):
     behavior/neurological  cardiovascular system  cellular  craniofacial  digestive/alimentary 
     embryogenesis  growth/size  hematopoietic system  immune system  integument 
     limbs/digits/tail  liver/biliary system  mortality/aging  muscle  nervous system 

    MDM2 for phenotypes           About GeneDecksing

    Animal Models:
         MGI mouse knock-outs for MDM2: Mdm2tm1Glo Mdm2tm2.2Glo Mdm2tm2.3Glo Mdm2tm1Bay Mdm2tm1.1Mep

       inGenious Targeting Laboratory - Custom generated mouse model solutions for MDM2 
       inGenious Targeting Laboratory - Custom generated inducible mouse model solutions for MDM2

       genOway customized KO model: permanent, tissue-specific or time-controlled inactivation for MDM2 
       genOway customized Knockin model: humanization, point mutation, expression monitoring, etc. for MDM2 

    miRNA
    Products:
        
    QIAGEN Custom miScript Target Protector blocks miRNA-binding site of human, mouse, rat MDM2
    7 QIAGEN miScript miRNA Assays for microRNAs that regulate MDM2:
    hsa-miR-548a-3p hsa-miR-494 hsa-miR-513a-3p hsa-miR-548e hsa-miR-551b* hsa-miR-548c-3p hsa-miR-556-5p
    SwitchGear 3'UTR luciferase reporter plasmidMDM2 3' UTR sequence
    Inhib. RNA
    Products:
        
    Browse for Gene Knock-down Tools from EMD Millipore
    OriGene RNAi products in human, mouse, rat for MDM2
    QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat MDM2

    Gene Editing
    Products:
    DNA2.0 Custom Protein Engineering Service for MDM2
    Sirion Biotech Customized adenovirus for overexpression of MDM2

    Clone
    Products:
         
    Browse Clones for the Expression of Recombinant Proteins Available from EMD Millipore
    OriGene clones in human, mouse for MDM2 (see all 21)
    OriGene ORF clones in mouse, rat for MDM2
    OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
    GenScript: all cDNA clones in your preferred vector: MDM2 (NM_002392)
    Sino Biological Human cDNA Clone for MDM2
    DNA2.0 Custom Codon Optimized Gene Synthesis Service for MDM2
    Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat MDM2
    Sirion Biotech Customized lentivirus for stable overexpression of MDM2 
                         Customized lentivirus expression plasmids for stable overexpression of MDM2 

    Cell Line
    Products:
         
    GenScript Custom overexpressing Cell Line Services for MDM2
    Search LifeMap BioReagents cell lines for MDM2
    In Situ Assay
    Products:
       

     
    Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for MDM2


    (Pathways according to EMD Millipore, R&D Systems, Cell Signaling Technology, KEGG, PharmGKB, BioSystems, Sino Biological, Reactome, Tocris Bioscience, GeneGo (Thomson Reuters), QIAGEN, and/or UniProtKB, Sets of similar genes according to GeneDecks, Interaction Networks according to SABiosciences, and/or STRING, Interactions according to 1UniProtKB, 2MINT, 3I2D, and/or 4STRING, with links to IntAct and Ensembl, Ontologies according to Gene Ontology Consortium 01 Oct 2013 via Entrez Gene).
    About This Section

    SuperPaths for MDM2 About   (see all 68)                                                                                              See pathways by source

    SuperPathSelected contained pathways About (see all per SuperPath)
    1Glioma
    Glioma0.51
    Signaling Pathways in Glioblastoma0.36
    Melanoma0.43
    Bladder cancer0.31
    Prostate cancer0.39
    2p53 Pathway
    p53 Signaling0.38
    p53 Pathway0.38
    3Cell cycle
    Cell cycle0.59
    Cell cycle0.59
    4p53 signaling pathway
    DNA damage response0.41
    p53 signaling pathway0.41
    5Signaling by FGFR
    Downstream signaling of activated FGFR0.92
    Downstream signal transduction0.90
    Signaling by FGFR0.92
    Signaling by PDGF0.85
    Signaling by FGFR in disease0.91
    Signaling by EGFR0.84
    DAP12 signaling0.91
    Signaling by EGFR in Cancer0.83

    Pathways by source                                                                                                                                                                 See SuperPaths
    Show all pathways

    5/9 EMD Millipore Pathways for MDM2 (see all 9)
        DNA damage ATM/ATR regulation of G1/S checkpoint
    Development Angiotensin signaling via beta-Arrestin
    Signal transduction PTEN pathway
    Proteolysis Putative SUMO-1 pathway
    Translation Non-genomic (rapid) action of Androgen Receptor

    1 R&D Systems Pathway for MDM2
        Akt Signaling Pathway

    5/15 Downloadable PowerPoint Slides of QIAGEN Pathway Central Maps for MDM2 (see all 15)
        Mitochondrial Apoptosis
    Molecular Mechanisms of Cancer
    HIF1Alpha Pathway
    PTEN Pathway
    Glioblastoma Multiforme

    3 Cell Signaling Technology (CST) Pathways for MDM2
        Cell Cycle / Checkpoint Control
    PI3K / Akt Signaling
    DNA Damage

    1 Tocris Bioscience Pathway for MDM2
        Akt Pathway

    5/8 GeneGo (Thomson Reuters) Pathways for MDM2 (see all 8)
        DNA damage ATM/ATR regulation of G1/S checkpoint
    Proteolysis Putative SUMO-1 pathway
    Transcription P53 signaling pathway
    Development Angiotensin signaling via beta-Arrestin
    Signal transduction AKT signaling

    5/23 BioSystems Pathways for MDM2 (see all 23)
        DNA damage response
    Apoptosis
    Senescence and Autophagy
    Cell cycle
    G1 to S cell cycle control

    2 Sino Biological Pathways for MDM2 
        EGFR Signaling Pathway
    p53 Pathway

    5/43        Reactome Pathways for MDM2 (see all 43)
        Signaling by EGFR in Cancer
    G1/S DNA Damage Checkpoints
    Downstream signal transduction
    Signal Transduction
    p53-Dependent G1/S DNA damage checkpoint


    5/16         Kegg Pathways  (Kegg details for MDM2) (see all 16):
        Cell cycle
    p53 signaling pathway
    Ubiquitin mediated proteolysis
    Endocytosis
    PI3K-Akt signaling pathway


    MDM2 for pathways           About GeneDecksing

    Interactions:

        SABiosciences Gene Network CentralTM Interacting Genes and Proteins Network for MDM2

    STRING Interaction Network Preview (showing 5 interactants - click image to see 25)

    5/532 Interacting proteins for MDM2 (Q009871, 2, 3 ENSP000004172814) via UniProtKB, MINT, STRING, and/or I2D (see all 532)
    InteractantInteraction Details
    GeneCardExternal ID(s)
    TP53P046371, 2, 3, ENSP000002693054EBI-389668,EBI-366083 MINT-6540920 MINT-4793511 MINT-6823775 MINT-7013943 MINT-8303857 MINT-6540905 MINT-68742 MINT-8385459 MINT-56681 MINT-8374464 MINT-58468 MINT-7013791 MINT-68743 MINT-7013956 MINT-4545014 MINT-8339574 MINT-4049631 MINT-6540776 MINT-6801380 MINT-8374452 MINT-58465 MINT-7013688 MINT-7013802 MINT-4303990 MINT-8339590 MINT-6665330 MINT-4793467 MINT-8380636 MINT-4049616 MINT-4054304 MINT-7905142 MINT-8385480 MINT-7013780 MINT-6540889 MINT-8385531 MINT-8385552 MINT-8385886 MINT-8388795 MINT-8415355 MINT-6540807 MINT-8391984 MINT-7905326 MINT-6540796 I2D: score=12 STRING: ENSP00000269305
    ENSG00000206206Q9UER71, 2, 3EBI-389668,EBI-77321 MINT-6801769 MINT-6801621 MINT-6801754 MINT-6801730 MINT-6801697 I2D: score=4 
    ENSG00000206279Q9UER71, 2, 3EBI-389668,EBI-77321 MINT-6801769 MINT-6801621 MINT-6801754 MINT-6801730 MINT-6801697 I2D: score=4 
    ENSG00000227046Q9UER71, 2, 3EBI-389668,EBI-77321 MINT-6801769 MINT-6801621 MINT-6801754 MINT-6801730 MINT-6801697 I2D: score=4 
    ENSG00000231617Q9UER71, 2, 3EBI-389668,EBI-77321 MINT-6801769 MINT-6801621 MINT-6801754 MINT-6801730 MINT-6801697 I2D: score=4 
    About this table

    Gene Ontology (GO): 5/55 biological process terms (GO ID links to tree view) (see all 55):    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0000122negative regulation of transcription from RNA polymerase II promoter IDA9271120
    GO:0006461protein complex assembly IDA10608892
    GO:0006977DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest TAS--
    GO:0007089traversing start control point of mitotic cell cycle IEA--
    GO:0007173epidermal growth factor receptor signaling pathway TAS--

    MDM2 for ontologies           About GeneDecksing



    (Chemical Compounds according to UniProtKB, Enzo Life Sciences, EMD Millipore, Tocris Bioscience HMDB, BitterDB, and/or Novoseek, Ligands according to IUPHAR, and Drugs according to DrugBank, Enzo Life Sciences, and/or PharmGKB, with drugs/clinical trials/news search links to CenterWatch)
    About This Section

    MDM2 for compounds           About GeneDecksing

    EMD Millipore small molecules for MDM2:
    Small Molecule - inhibitor
    Browse drugs & compounds from Enzo Life Sciences

    Compounds for MDM2 available from Tocris Bioscience    About this table
    CompoundAction CAS #
    Tenovin-1Protects against MDM2-mediated p53 degradation[380315-80-0]
    Nutlin-3MDM2 antagonist; inhibits MDM2-p53 interaction[548472-68-0]
    SKPin C1Inhibits Skp2-mediated p27 degradation; induces cell cycle arrest[432001-69-9]
    TAME hydrochlorideUbiquitin ligase APC/C inhibitor; promotes Cdc20 autoubiquitination[1784-03-8]
    SMER 3Selective inhibitor of E3 ubiquitin ligase[67200-34-4]

    4 HMDB Compounds for MDM2    About this table
    CompoundSynonyms CAS #PubMed Ids
    Adenosine monophosphate5'-AMP (see all 28)61-19-8--
    Adenosine triphosphate5'-(tetrahydrogen triphosphate) Adenosine (see all 24)56-65-5--
    Phosphoric acidacide phosphorique (FRENCH) (see all 20)7664-38-2--
    Pyrophosphate(4-)Diphosphoric acid ion (see all 10)14000-31-8--

    2 DrugBank Compounds for MDM2    About this table
    CompoundSynonyms CAS #TypeActionsPubMed Ids
    Cis-[4,5-Bis-(4-Chlorophenyl)-2-(2-Isopropoxy-4-Methoxyphenyl)-4,5-Dihyd Roimidazol-1-Yl]-Piperazin-1-Yl-Methanone-- --target--17139284 17016423 10592235
    Cis-[4,5-Bis-(4-Bromophenyl)-2-(2-Ethoxy-4-Methoxyphenyl)-4,5-Dihydroimidazol-1-Yl]-[4-(2-Hydroxyethyl)Piperazin-1-Yl]Methanone-- --target--17139284 17016423

    10/102 Novoseek inferred chemical compound relationships for MDM2 gene (see all 102)    About this table
    Compound   -log (P-Val)   Hits   PubMed IDs for Articles with Shared Sentences (# sentences)
    noxa 55.7 7 18340116 (1), 14749479 (1), 19934289 (1), 17043642 (1) (see all 7)
    leptomycin b 53.6 13 10222137 (3), 9819415 (2), 12653667 (1), 17178878 (1) (see all 6)
    10-hydroxycamptothecin 47.4 3 12149568 (1), 10493945 (1), 13130078 (1)
    mg 132 46.3 10 9438391 (2), 12640129 (1), 16571800 (1), 11526482 (1) (see all 7)
    camptothecin 44.1 11 19261878 (1), 19136059 (1), 10399957 (1), 17056014 (1) (see all 6)
    cisplatin 39.1 61 16815295 (6), 7761100 (4), 11761456 (4), 9700726 (3) (see all 23)
    p202 38.9 2 8910340 (1)
    adriamycin 38.4 20 10637478 (3), 12640129 (2), 10775510 (2), 15064747 (2) (see all 11)
    doxorubicin 35.4 28 9548451 (4), 10544021 (2), 11964305 (2), 14766674 (2) (see all 15)
    oligonucleotide 33.8 44 18038763 (4), 11894120 (2), 12149568 (2), 11072252 (2) (see all 20)

    Search CenterWatch for drugs/clinical trials and news about MDM2

    (Secondary structures according to fRNAdb,
    GenBank/EMBL/DDBJ Accessions according to
    Unigene (Build 236 Homo sapiens; Apr 25 2013) or GenBank,
    RefSeq according to Entrez Gene,
    DOTS (version 10), and/or AceView, transcript ids from Ensembl with links to UCSC,
    Conferences by KenesGroup, exon structure from GeneLoc, alternative splicing isoforms according to ASD and/or ECgene,
    RNAi Products from EMD Millipore,
    siRNAs from OriGene, QIAGEN, shRNA from OriGene, microRNA from QIAGEN,
    Tagged/untagged cDNA clones from OriGene, SwitchGear Genomics, GenScript, DNA2.0, Vector BioLabs, Sirion Biotech, Primers from OriGene, SABiosciences, and/or QIAGEN )
    About This Section

    REFSEQ mRNAs for MDM2 gene (12 alternative transcripts): 
    NM_001145337.2  NM_001145339.2  NM_001145340.2  NM_001278462.1  NM_002392.5  NM_001145336.1  NM_006878.3  NM_006879.3  
    NM_006880.2  NM_006881.3  NM_006882.3  NM_032739.1  

    Unigene Clusters for MDM2:

    MDM2 oncogene, E3 ubiquitin protein ligase
    Hs.484551  [show with all ESTs], Hs.733536  [show with all ESTs]
    Unigene Representative Sequences: NM_002392, JX015388
    18/37 Ensembl transcripts including schematic representations, and UCSC links where relevant (see all 37):
    ENST00000462284(uc001sui.3 uc021rad.1 uc009zqx.3 uc001sun.4 uc009zra.3 uc021raf.1 uc009zrc.3 uc009zrd.3 uc009zre.3 uc001suo.3 uc009zrf.3 uc009zrg.3 uc009zrh.3 uc021rag.1 uc021rah.1 uc021rai.1 uc021raj.1)
    ENST00000311420 ENST00000493419 ENST00000393417(uc009zrb.1) ENST00000258148
    ENST00000539479(uc009zqy.1) ENST00000393415(uc021rae.1) ENST00000523991
    ENST00000543323 ENST00000393416 ENST00000544561 ENST00000393410 ENST00000496959
    ENST00000299252 ENST00000481186 ENST00000360430 ENST00000517852 ENST00000545204

    Congresses - knowledge worth sharing:  
    European Congress of Clinical Microbiology and Infectious Diseases (ECCMID) 10 - 13 May 2014

    miRNA
    Products:
         
    QIAGEN Custom miScript Target Protector blocks miRNA-binding site of human, mouse, rat MDM2
    7 QIAGEN miScript miRNA Assays for microRNAs that regulate MDM2:
    hsa-miR-548a-3p hsa-miR-494 hsa-miR-513a-3p hsa-miR-548e hsa-miR-551b* hsa-miR-548c-3p hsa-miR-556-5p
    SwitchGear 3'UTR luciferase reporter plasmidMDM2 3' UTR sequence
    Inhib. RNA
    Products:
         
    Browse for Gene Knock-down Tools from EMD Millipore
    OriGene RNAi products in human, mouse, rat for MDM2
    QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat MDM2
    Clone
    Products:
         
    OriGene clones in human, mouse for MDM2 (see all 21)
    OriGene ORF clones in mouse, rat for MDM2
    OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
    GenScript: all cDNA clones in your preferred vector: MDM2 (NM_002392)
    DNA2.0 Custom Codon Optimized Gene Synthesis Service for MDM2
    Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat MDM2
    Sirion Biotech Customized lentivirus for stable overexpression of MDM2 
                         Customized lentivirus expression plasmids for stable overexpression of MDM2 
    Primer
    Products:
        
    OriGene qPCR primer pairs and template standards for MDM2
    OriGene qSTAR qPCR primer pairs in human, mouse for MDM2
    SABiosciences RT2 qPCR Primer Assay in human, mouse, rat MDM2
      QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat MDM2
      QIAGEN QuantiFast Probe-based Assays in human, mouse, rat MDM2

    Additional mRNA sequence: 

    AF385326.1 AJ278976.1 AJ278977.1 AJ278978.1 AJ550516.1 AJ550518.1 AJ550520.1 JX015381.1 
    JX015382.1 JX015383.1 JX015384.1 JX015385.1 JX015387.1 JX015388.1 

    24/27 DOTS entries (see all 27):

    DT.92448784  DT.100787335  DT.95193404  DT.91749816  DT.100686963  DT.95193408  DT.121211579  DT.204679 
    DT.121211593  DT.100787329  DT.40118121  DT.451569  DT.121167413  DT.92448783  DT.100027326  DT.100651391 
    DT.100787331  DT.40118120  DT.75138122  DT.91749814  DT.95193415  DT.95193421  DT.95306934  DT.100644736 

    24/214 AceView cDNA sequences (see all 214):

    AJ491700 AA769560 AI420596 AF385322 CB178767 AA825908 AA321304 CB178722 
    CB151943 BM463523 AJ430612 AI123032 CB269619 BE018851 AJ430614 AJ278977 
    NM_006881 U33200 AF385323 AW630683 BE468241 BQ001500 AJ550517 BM980488 

    GeneLoc Exon Structure

    5/16 Alternative Splicing Database (ASD) splice patterns (SP) for MDM2 (see all 16)    About this scheme

    ExUns: 1a · 1b · 1c ^ 2a · 2b ^ 3 ^ 4 ^ 5 ^ 6a · 6b ^ 7 ^ 8 ^ 9 ^ 10 ^ 11 ^ 12 ^ 13a · 13b · 13c
    SP1:                                      -     -           -                                                         
    SP2:                                      -     -     -     -                                                         
    SP3:                                      -     -           -           -     -                                       
    SP4:                                      -     -           -                                                         
    SP5:                                      -     -     -     -                                                         


    ECgene alternative splicing isoforms for MDM2

    (RNA expression data according to H-InvDB, NONCODE, miRBase, and RNAdb, Expression images according to data from BioGPS, Illumina Human BodyMap, and CGAP SAGE, Sets of similar genes according to GeneDecks, in vivo and in vitro expression data from LifeMap Discovery™, plus additional links to Genevestigator, and/or SOURCE, and/or BioGPS, and/or UniProtKB,
    PCR Arrays from SABiosciences, Primers from OriGene, SABiosciences, and/or QIAGEN, In Situ Hybridization Assays from Advanced Cell Diagnostics)
    About This Section

    MDM2 expression in normal human tissues (normalized intensities)      MDM2 embryonic expression: see
    See probesets specificity/sensitivity at GeneAnnot
    About this imageBioGPS <intensity>2/3
    CGAP TAG: TGCAAAGAAG
    MDM2 Expression
    About this image


    MDM2 expression in embryonic tissues and stem cells    About this table
    Data from LifeMap, the Embryonic Development and Stem Cells Database 
     5/35 selected tissues (see all 35) fully expand
     
     Epithelium
             vagina ; squamous epithelial cells   
             bronchial epithelial cells   
     
     Uterus
             uterus, post-menopause ; glandular cells   
             endometrial endothelial cell   
     
     Testis (Reproductive System)    fully expand to see all 4 entries
             Leydig Cells Testis Interstitium
             seminal vesicle ; glandular cells   
     
     Colon (Gastrointestinal Tract)    fully expand to see all 4 entries
             colon ; peripheral nerve/ganglion   
     
     Brain (Nervous System)    fully expand to see all 4 entries
             Cerebral Cortex

    See MDM2 Protein Expression from SPIRE MOPED and PaxDB
    Genevestigator expression for MDM2

    SOURCE GeneReport for Unigene clusters: Hs.484551 Hs.733536

    UniProtKB/Swiss-Prot: MDM2_HUMAN, Q00987
    Tissue specificity: Ubiquitous. Isoform Mdm2-A, isoform Mdm2-B, isoform Mdm2-C, isoform Mdm2-D, isoform Mdm2-E,
    isoform Mdm2-F and isoform Mdm2-G are observed in a range of cancers but absent in normal tissues

        SABiosciences Expression via Pathway-Focused PCR Arrays including MDM2 (see all 11): 
              Oncogenes & Tumor Suppressor Genes in human mouse rat
              Nitric Oxide Signaling Pathway in human mouse rat
              Tumor Metastasis in human mouse rat
              Ubiquitin Ligases in human mouse rat
              Ubiquitination (Ubiquitylation) Pathway in human mouse rat

    Primer
    Products:
    OriGene qPCR primer pairs and template standards for MDM2
    OriGene qSTAR qPCR primer pairs in human, mouse for MDM2
    SABiosciences RT2 qPCR Primer Assay in human, mouse, rat MDM2
    QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat MDM2
    QIAGEN QuantiFast Probe-based Assays in human, mouse, rat MDM2
    In Situ
    Assay Products:
     

     
    Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for MDM2

    (Orthologs according to 1,2HomoloGene (2older version, for species not in 1newer version), 3euGenes, 4SGD , 5MGI Mar 06 2013, with possible further links to Flybase and/or WormBase, and/or 6Ensembl pan taxonomic compara , Gene Trees according to Ensembl and TreeFam)
    About This Section

    This gene was present in the common ancestor of chordates.

    Orthologs for MDM2 gene from 5/14 species (see all 14)    About this table
    Organism Taxonomic
    classification
    Gene Description Human
    Similarity
    Orthology
    Type
    Details
    mouse
    (Mus musculus)
    Mammalia Mdm21 , 5 transformed mouse 3T3 cell double minute 21, 5 82.71(n)1
    83.2(a)1
      10 (66.32 cM)5
    172461  NM_010786.31  NP_034916.11 
     1176888885 
    chicken
    (Gallus gallus)
    Aves MDM21 Mdm2 p53 binding protein homolog (mouse) 72.3(n)
    69.31(a)
      395609  NM_001199384.1  NP_001186313.1 
    lizard
    (Anolis carolinensis)
    Reptilia MDM26
    MDM2 oncogene, E3 ubiquitin protein ligase
    49(a)
    1 ↔ 1
    GL343256.1(1439727-1455148)
    African clawed frog
    (Xenopus laevis)
    Amphibia Xl.108852 Xenopus laevis transcribed sequence with weak similarity more 73.75(n)    BQ385125.1 
    zebrafish
    (Danio rerio)
    Actinopterygii mdm22 murine double minute 2 homolog 71.63(n)   30637  AF356346.1 


    ENSEMBL Gene Tree for MDM2 (if available)
    TreeFam Gene Tree for MDM2 (if available)

    (Paralogs according to 1HomoloGene,
    2Ensembl, and 3SIMAP, Pseudogenes according to 4Pseudogene.org Build 68)
    About This Section
    Paralogs for MDM2 gene
    MDM42  
    10 SIMAP similar genes for MDM2 using alignment to 31 protein entries:     MDM2_HUMAN (see all proteins):
    mdm2    HDM2    L3MBTL2    MDM2 isoform N1_40    MDM2 isoform KB9    DKFZp781B1423
    MDM4    DKFZp686B01123    ETFA    NEURL1B

    MDM2 for paralogs           About GeneDecksing


    2 Pseudogenes.org Pseudogenes for MDM2
    PGOHUM00000259775 PGOHUM00000240593


    (SNPs/Variants according to the 1NCBI SNP Database, 2Ensembl, 3PupaSUITE, 4UniProtKB, and DNA2.0, Linkage Disequilibrium by HapMap, Structural Variations(CNVs/InDels/Inversions) from the Database of Genomic Variants, Mutations from the Human Gene Mutation Database (HGMD) and the Locus Specific Mutation Databases (LSDB), Blood group antigen gene mutations by BGMUT, Resequencing Primers from QIAGEN, Cancer Mutation PCR Arrays and Assays and Copy Number PCR Arrays from SABiosciences)
    About This Section

    UniProtKB/Swiss-Prot: MDM2_HUMAN, Q00987
    Polymorphism: A polymorphism in the MDM2 promoter is associated with susceptibility to accelerated tumor formation
    in both hereditary and sporadic cancers [MIM:614401]. It also contributes to susceptibility to Li-Fraumeni
    syndrome, in patients carrying a TP53 germline mutation


    10/922 SNPs in MDM2 are shown (see all 922)    About this table     
    Genomic DataTranscription Related DataAllele Frequencies
    SNP IDValidClinical
    significance
    Chr 12 posSequence#AA
    Chg
    TypeMore#Allele
    freq
    PopTotal
    sample
    More
    ----------
    rs1153999191,2
    C,F--69037213(+) GCACAA/TACCCA 1 -- us2k11Minor allele frequency- T:0.08WA 118
    rs1475658861,2
    --69037234(+) TGATAG/TTTAAC 1 -- us2k10--------
    rs1887975101,2
    --69037357(+) TCTGCC/TTCCCG 1 -- us2k10--------
    rs1403302471,2
    C--69037383(+) TCTGCC/TTCAGC 1 -- us2k10--------
    rs1815507851,2
    --69037499(+) CCTAAC/TCTCGT 1 -- us2k10--------
    rs11449441,2
    C,F,A--69037510(+) GATCCG/ACCCAC 1 -- us2k17Minor allele frequency- A:0.38NA WA CSA 13
    rs1456726811,2
    --69037560(+) CCGTGC/TGCAGC 1 -- us2k10--------
    rs794050011,2
    C,F--69037673(+) GATGAA/GGATGA 1 -- us2k11Minor allele frequency- G:0.03NA 120
    rs1505500231,2
    C--69037801(+) GCGGG-/AGAAGGGAAGGATATAACT
    TTATAAAAAAAAAAAAGCTGC
    AGAAG
    1 -- us2k10--------
    rs37304851,2
    C,F--69037870(+) AAAAA-/AAAAAGCTGCAGAAGGGAAGGATATAACTNTATAAAAAA
    A
    /AAAAAGCTGCAGAAGGGAAGGATATAACTTTATAAAAAAA
    GGTCC
    1 -- us2k11NS 176

    HapMap Linkage Disequilibrium report for MDM2 (69201956 - 69239214 bp)

    Structural Variations
         Database of Genomic Variants (DGV) 2 variations for MDM2:    About this table     
    Variant IDTypeSubtypePubMed ID
    esv1668742CNV Insertion17803354
    nsv899226CNV Loss21882294


    Human Gene Mutation Database (HGMD): MDM2
    SABiosciences Cancer Mutation PCR Assays
    2 SABiosciences qBiomarker Copy Number PCR Arrays containing MDM2:
    Oncogenes & Tumor Suppressor Genes 384HC
    Lung Cancer
    SeqTarget long-range PCR primers for resequencing MDM2
    DNA2.0 Custom Variant and Variant Library Synthesis for MDM2

    (in which this Gene is Involved, According to MalaCards, OMIM, UniProtKB, the University of Copenhagen DISEASES database, Conferences by KenesGroup, Novoseek, Genatlas, GeneTests, GAD, HuGE Navigator, and/or TGDB.)
    About This Section
    OMIM gene information: 164785    OMIM disorders: --

    UniProtKB/Swiss-Prot: MDM2_HUMAN, Q00987
  • Note=Seems to be amplified in certain tumors (including soft tissue sarcomas, osteosarcomas and gliomas).
    A higher frequency of splice variants lacking p53 binding domain sequences was found in late-stage and high-grade
    ovarian and bladder carcinomas. Four of the splice variants show loss of p53 binding

  • 20/198 diseases for MDM2 (see all 198):    About MalaCards
    soft tissue sarcoma    malignant fibrous histiocytoma of bone    anal squamous cell carcinoma    perinephritis
    dedifferentiated liposarcoma    uterine sarcoma    adult medulloblastoma    retroperitoneal sarcoma
    hodgkin lymphoma, childhood    non-hodgkin lymphoma, childhood    spindle cell liposarcoma    retroperitoneal fibrosis
    giant cell glioblastoma    adult astrocytic tumour    mixed-type liposarcoma    undifferentiated embryonal sarcoma of the liver
    chromosome 5q deletion    orbit rhabdomyosarcoma    sapho syndrome    liposarcoma

    4 diseases from the University of Copenhagen DISEASES database for MDM2:
    Cancer     Lipoma     Li-Fraumeni syndrome     Eye disease

    MDM2 for disorders           About GeneDecksing


    Congresses - knowledge worth sharing:  
    Alzheimer's & Parkinson's Diseases Congress (ADPD) 18 - 22 March 2015

    10/96 Novoseek inferred disease relationships for MDM2 gene (see all 96)    About this table

    Disease   -log (P-Val)   Hits   PubMed IDs for Articles with Shared Sentences (# sentences)
    liposarcoma dedifferentiated 84.6 30 15221942 (4), 18500263 (3), 9071997 (2), 18214854 (2) (see all 20)
    tumors 80.8 1210 9671804 (7), 10815906 (5), 10072445 (5), 10918230 (5) (see all 99)
    liposarcoma 78.5 80 18836421 (7), 14694526 (4), 18820664 (3), 19820690 (3) (see all 37)
    retinoblastoma 71.4 60 18644346 (5), 19524506 (3), 18045074 (3), 16966622 (2) (see all 37)
    cancer 70.8 340 16243710 (5), 12149568 (4), 15720187 (4), 17931661 (4) (see all 99)
    sarcoma 70.6 144 18521197 (4), 16160477 (4), 8064888 (4), 14614050 (3) (see all 84)
    glioblastoma 63.4 60 9034372 (6), 9810172 (3), 11212898 (3), 12635658 (3) (see all 30)
    osteosarcoma 62.8 79 8416741 (5), 8781571 (4), 10374529 (3), 15310147 (3) (see all 40)
    li-fraumeni syndrome 61.3 5 16478747 (1), 7923211 (1), 16983111 (1), 16203772 (1) (see all 5)
    anaplastic astrocytoma 56.9 7 12700122 (2), 12241107 (1), 7815080 (1), 9266437 (1) (see all 6)

    Genetic Association Database (GAD): MDM2
    Human Genome Epidemiology (HuGE) Navigator: MDM2 (192 documents)
    Tumor Gene Database (TGDB): MDM2

    Export disorders for MDM2 gene to outside databases

    (in PubMed. Associations of this gene to articles via 1Entrez Gene, 2UniProtKB/Swiss-Prot, 3HGNC, 4GAD, 5PharmGKB, 6HMDB, 7DrugBank, 8UniProtKB/TrEMBL, 9 Novoseek, and/or 10fRNAdb)
    About This Section

    PubMed articles for MDM2 gene, integrated from 9 sources (see all 2267):
    (articles sorted by number of sources associating them with MDM2)
        Utopia: connect your pdf to the dynamic
    world of online information

    1. Amplification of a gene encoding a p53-associated protein in human sarcomas. (PubMed id 1614537)1, 2, 3 Oliner J.D.... Vogelstein B. (1992)
    2. The deubiquitinating enzyme USP2a regulates the p53 pathway by targeting Mdm2. (PubMed id 17290220)1, 2, 9 Stevenson L.F....Saville M.K. (2007)
    3. Combined effects of p73 and MDM2 polymorphisms on the risk of lung cancer. (PubMed id 17013834)1, 4, 9 Jun H.J....Park J.Y. (2007)
    4. Structure of the MDM2 oncoprotein bound to the p53 tumor suppressor transactivation domain. (PubMed id 8875929)1, 2, 9 Kussie P.H.... Pavletich N.P. (1996)
    5. Iron-dependent regulation of MDM2 influences p53 acti vity and hepatic carcinogenesis. (PubMed id 20019189)1, 4, 9 Dongiovanni P....Valenti L. (2010)
    6. MDM2 promotes proteasome-dependent ubiquitin-independent degradation of retinoblastoma protein. (PubMed id 16337594)1, 2, 9 Sdek P.... Xiao Z.X. (2005)
    7. A novel functional polymorphism C1797G in the MDM2 promoter is associated with risk of bladder cancer in a Chinese population. (PubMed id 18519798)1, 4, 9 Wang M....Zhang Z. (2008)
    8. Genetic polymorphisms in cell cycle regulatory genes MDM2 and TP53 are associated with susceptibility to lung cancer. (PubMed id 16287156)1, 4, 9 Zhang X....Lin D. (2006)
    9. Genetic variants in the MDM2 promoter and lung cancer risk in a Chinese population. (PubMed id 16152608)1, 4, 9 Hu Z....Shen H. (2006)
    10. Polymorphisms in the MDM2 promoter and risk of breast cancer: a case-control analysis in a Chinese population. (PubMed id 16288830)1, 4, 9 Ma H....Shen H. (2006)

    (in PubMed, OMIM, and NCBI Bookshelf)
    About This Section
     ANDOR
    Aliases
    Disorders
    Free Text  

      Query String
    PubMed
    OMIM
    NCBI Bookshelf
      (Note: In FireFox, select the above section and copy using Ctrl-C)

    (According to Entrez Gene, HGNC, AceView, euGenes, Ensembl, miRBase, ECgene, Kegg, and/or H-InvDB)
    About This Section
    Entrez Gene: 4193 HGNC: 6973 AceView: MDM2 Ensembl:ENSG00000135679 euGenes: HUgn4193
    ECgene: MDM2 Kegg: 4193 H-InvDB: MDM2

    (According to HUGE)
    About This Section
      --

    (According to PharmGKB, ATLAS, HORDE, IMGT, LEIDEN, UniProtKB/Swiss-Prot, and/or UniProtKB/TrEMBL,
    Wikipedia and/or GeneReviews via UniProtKB/Swiss-Prot)
    About This Section
    NameDescription
    PharmGKB entry for MDM2 Pharmacogenomics, SNPs, Pathways
    ATLAS Chromosomes in Cancer entry for MDM2 Genetics and Cytogenetics in Oncology and Haematology
    NIEHS-SNPshttp://egp.gs.washington.edu/data/mdm2/
    Wikipedia http://en.wikipedia.org/wiki/Mdm2

    (Patent information from GeneIP,
    Licensable technologies from WIS Yeda, Salk, Tufts,
    IP news from LifeMap Sciences, Inc.)
    About This Section
    Patent Information for MDM2 gene:
    Search GeneIP for patents involving MDM2

    GeneCards and IP:
    Japan Patent Office Licenses GeneCards     European Patent Office Licenses GeneCards     Improving the IP Search



    (Antibodies, recombinant proteins, and assays from EMD Millipore, R&D Systems, OriGene, QIAGEN, GenScript, Cell Signaling Technology, SABiosciences, Novus Biologicals, Sino Biological, Enzo Life Sciences, Abcam, ProSpec, Cloud-Clone Corp., Thermo Fisher Scientific, LSBio, Gene Editing from DNA2.0 and Sirion Biotech, Clones from EMD Millipore, OriGene, GenScript, Sino Biological, DNA2.0, SwitchGear Genomics, Vector BioLabs, Sirion Biotech, Cell lines from GenScript, and LifeMap BioReagents, PCR Arrays from SABiosciences, Drugs and/or compounds from EMD Millipore, Tocris Bioscience, and/or Enzo Life Sciences, In Situ Hybridization Assays from
    Advanced Cell Diagnostics, Animal models from inGenious Targeting Laboratory, genOway)
    About This Section

     Browse for Gene Knock-down Tools from EMD Millipore
     Browse Purified and Recombinant Proteins at EMD Millipore
     Browse Clones for the Expression of Recombinant Proteins Available from EMD Millipore
     EMD Millipore small molecules (inhibitor) for MDM2
     Browse Kits and Assays available from EMD Millipore
     EMD Millipore Mono- and Polyclonal Antibodies for the study of MDM2
     
     EMD Millipore Custom Antibody & Bulk Services
     EMD Millipore Preclinical / Clinical Development Services
     EMD Millipore Immunoassay Services
     EMD Millipore Target Screening & Profiling Services

      
     Antibodies for MDM2 (MDM2/HDM2)   Browse Cell Culture Products  
     ELISAs for MDM2 (MDM2/HDM2)   Browse Flow Cytometry Kits  
     Browse Primer Pairs   Browse Kinase Activity Assays/Reagents  
     Browse ELISpot Kits/Development Modules   Browse TFB/Immunoprecipitation Assays  
     Browse Apoptosis Detection Kits/Reagents   Ubiquitin Proteasome Pathway (UPP) Assay Kits/Reagents for MDM2 (MDM2/HDM2)  
     Browse DNA Damage/Repair Kits/Reagents   Browse Multiplex/Array Assay Kits/Reagents  
     Browse Cell Selection/Detection Kits/Reagents   Browse Secondary Antibodies/Controls/Staining Reagents  
     Browse Protease Activity Assays and Reagents   Recombinant/Natural Proteins for MDM2 (MDM2/HDM2)  
     Browse Stem Cell Products   Browse Tocris Biochemicals & Compounds  
     Browse cDNA Clones   Browse Proteome Profiler Antibody Arrays  
     OriGene Antibodies for MDM2   OriGene RNAi products in human, mouse, rat for MDM2  
     OriGene qPCR primer pairs and template standards for MDM2   OriGene Protein Over-expression Lysate for MDM2  
     OriGene Custom Mass Spec   OriGene clones in human, mouse for MDM2  
     OriGene qSTAR qPCR primer pairs in human, mouse for MDM2   Browse OriGene full length recombinant human proteins expressed in human HEK293 cells  
     OriGene ORF clones in mouse, rat for MDM2   OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling  
     OriGene Custom Antibody Services for MDM2   OriGene Custom Protein Services for MDM2  

     
     
     QIAGEN Custom miScript Target Protector blocks miRNA-binding site of in human, mouse, rat MDM2
     QIAGEN SeqTarget long-range PCR primers for resequencing MDM2
     QIAGEN PyroMark CpG Assay predesigned Pyrosequencing DNA Methylation assays in human, mouse, rat MDM2
     QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat MDM2
     QIAGEN QuantiFast Probe-based Assays in human, mouse, rat MDM2
     QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat MDM2
     GenScript Custom Purified and Recombinant Proteins Services for MDM2 GenScript cDNA clones with any tag delivered in your preferred vector for MDM2
     GenScript Custom Assay Services for MDM2 GenScript Custom Superior Antibodies Services for MDM2
     GenScript Custom overexpressing Cell Line Services for MDM2 CloneReady with Over 120,000 Genes
     Gene Synthesis: Any Gene in Any Vector Vector-based siRNA and miRNA, Ready for Transfection
     Gene Mutant Library, Variants up to 10^11 Plasmid Preparation
     Custom Peptide Services
     Antibodies & Assays for MDM2 

     Regulatory tfbs in MDM2 promoter
     Search Chromatin IP Primers for MDM2
     RT2 qPCR Primer Assay in human, mouse, rat MDM2
     GNC Network for MDM2
     SABiosciences PCR Arrays including human, mouse, rat MDM2
     Tocris compounds for MDM2
     Browse Sino Biological Proteins and Antibodies
     Browse Sino Biological Cell Lysates
     cDNA Clones for MDM2
     4000+ Proteins
     Search Sino Biological for antibodies, proteins & pathways
     Protein Production Services
     Transfection Reagents
     Protein A/G/L resins
     Isotyping reagents
     Assays/Proteins for MDM2
     Search www.enzolifesciences.com for proteins, assays, substrates, inhibitors & antibodies
     Novus Tissue Slides
     MDM2 antibodies
     MDM2 proteins
     MDM2 lysates
     Antibodies for MDM2
     See all of Abcam's Antibodies, Kits and Proteins for MDM2
     Custom Antibody / Protein Production Service
     Bulk Purchasing
     Advantages of Rabbit Monoclonal antibodies
     Abcam protocols and scientific support
     Browse ProSpec Recombinant Proteins




     Proteins for MDM2
     Antibodies for MDM2
     ELISAs for MDM2
     CLIAs for MDM2
     Search LifeMap BioReagents cell lines for MDM2
     Gene Synthesis
     Protein Engineering
     Variant Library Synthesis
     Codon Optimization
     Protein Production and Purification
     Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for MDM2
     SwitchGear 3'UTR luciferase reporter plasmids for MDM2
     SwitchGear Promoter luciferase reporter plasmids for MDM2
     ThermoFisher Antibody for MDM2
     Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat MDM2
     inGenious Targeting Laboratory - Custom generated mouse model solutions for MDM2
     inGenious Targeting Laboratory - Custom generated inducible mouse model solutions for MDM2
    Customized:
     lentivirus for stable overexpression of MDM2
     lentivirus expression plasmids for stable overexpression of MDM2
     adenovirus for overexpression of MDM2
     LSBio Antibodies in human, mouse, rat for MDM2
    Customized transgenic rodents for:
     Humanization
     Biomarker expression
     Off-target effect monitoring
     Translational medicine
     Tissue-specific gene expresssion
     Time-controlled gene expresssion
           
    GeneCards Homepage - Last full update: 23 Oct 2013 - Incrementals: 4 Nov 2013 , 7 Nov 2013 , 23 Jan 2014

    View Random Gene

    Category
    (GIFtS: 73)
    transforming growth factor, beta 1
    GIFtS Group
    The GeneCards human gene database gene index: 1 3 5 6 A B C D E F G H I J K L M N O P Q R S T U V W X Y Z 


    Developed at the Crown Human Genome Center, Department of Molecular Genetics, the Weizmann Institute of Science

    Hot genes      Disease genes      MDM2 gene at Home site.
    hostname: 356977-web1.xennexinc.com index build: 106 solr: 1.4