Set Analyses:
Advanced Search

Advanced Search

 
Search By
Section (entire)
for


 
or upload a file of gene symbols


Category   Symbol Source: HGNC EntrezGene Ensembl GeneCards RNA genes CroW21
GIFtS

MCF2L Gene

protein-coding   GIFtS: 62
GCID: GC13P113548

MCF.2 cell line derived transforming sequence-like

 Explore 7 diseases affiliated with
MCF2L via our new
 Human Malady Compendium 
Biological research products
for MCF2L
    

(According to 1HGNC, 2Entrez Gene,
3UniProtKB/Swiss-Prot, 4UniProtKB/TrEMBL, 5OMIM, 6GeneLoc, 7Ensembl, 8DME, 9miRBase, and/or 10fRNAdb)
About This Section

Aliases
MCF.2 Cell Line Derived Transforming Sequence-Like1 2     DBL'S Big Sister2 3
ARHGEF141 2     Guanine Nucleotide Exchange Factor DBS2
DBS1 2     MCF2 Transforming Sequence-Like Protein2
OST1 2     MCF2-Transforming Sequence-Like Protein3
KIAA03621 3     

External Ids:    HGNC: 145761   Entrez Gene: 232632   Ensembl: ENSG000001262177   OMIM: 6094995   UniProtKB: O150683   

Export aliases for MCF2L gene to outside databases

Previous GC identifers: GC13P112232 GC13U900016 GC13P112709 GC13P111570 GC13P112670 GC13P094063


(According to Entrez Gene, Tocris Bioscience, Wikipedia's Gene Wiki, PharmGKB,
UniProtKB/Swiss-Prot, and/or UniProtKB/TrEMBL)
About This Section

UniProtKB/Swiss-Prot: MCF2L_HUMAN, O15068
Function: Guanine nucleotide exchange factor that potentially links pathways that signal through RAC1, RHOA and CDC42.
Catalyzes guanine nucleotide exchange on RHOA and CDC42 and interacts specifically with the GTP-bound form of RAC1,
suggesting that it functions as an effector of RAC1. May also participate in axonal transport in the brain. Becomes
activated and highly tumorigenic by truncation of the N-terminus (By similarity). Isoform 5 activates CDC42

Gene Wiki entry for MCF2L


(According to GeneLoc and/or HGNC, and/or
Entrez Gene (NCBI build 37),
and/or miRBase,
Genomic Views according to UCSC (hg19) and Ensembl (release 69), Regulatory elements and Epigenetics data according to QIAGEN, SABiosciences, and/or SwitchGear Genomics)
About This Section
RefSeq DNA sequence:
NC_000013.10  NC_018924.1  NT_027140.6  
Regulatory elements:
   SABiosciences Regulatory transcription factor binding sites in the MCF2L gene promoter:
         Bach1   GATA-3   FOXD1   HNF-1A   GATA-1   GATA-2   CREB   c-Rel   
         Other transcription factors

SwitchGear Promoter luciferase reporter plasmids (see all 4): MCF2L promoter sequence
   Search SABiosciences Chromatin IP Primers for MCF2L

Epigenetics:
QIAGEN PyroMark CpG Assay predesigned Pyrosequencing DNA Methylation assays in human, mouse, rat MCF2L


Genomic Location:
Genomic View: UCSC Golden Path with GeneCards custom track

Entrez Gene cytogenetic band: 13q34   Ensembl cytogenetic band:  13q34   HGNC cytogenetic band: 13q34

MCF2L Gene in genomic location: bands according to Ensembl, locations according to (and/or Entrez Gene and/or Ensembl if different)
MCF2L gene location

GeneLoc information about chromosome 13         GeneLoc Exon Structure

GeneLoc location for GC13P113548:  view genomic region     (about GC identifiers)

Start:
113,548,692 bp from pter      End:
113,754,053 bp from pter
Size:
205,362 bases      Orientation:
plus strand

(According to 1UniProtKB, HORDE, neXtProt, Ensembl, and/or Reactome, Modification sites according to 2PhosphoSitePlus, Specific Peptides from DME, Protein expression images according to data from SPIRE MOPED and PaxDb, RefSeq according to NCBI, PDB rendering according to OCA and/or Proteopedia, Recombinant Proteins from EMD Millipore, R&D Systems, GenScript, Enzo Life Sciences, OriGene, Novus Biologicals, Sino Biological, ProSpec, and/or Uscn,
Biochemical Assays by EMD Millipore, R&D Systems, OriGene, GenScript, Cell Signaling Technology, Enzo Life Sciences, and/or Uscn, Ontologies according to Gene Ontology Consortium 01 Mar 2013 and Entrez Gene, Antibodies by EMD Millipore, R&D Systems, GenScript, Cell Signaling Technology, OriGene, Novus Biologicals, Thermo Fisher Scientific, Abcam, and/or Uscn)
About This Section

UniProtKB/Swiss-Prot: MCF2L_HUMAN, O15068 (See protein sequence)
Recommended Name: Guanine nucleotide exchange factor DBS  
Size: 1137 amino acids; 128109 Da
Subunit: Interacts with CCPG1, which results in specific inhibition of its exchange activity toward RHOA (By
similarity). Interacts with an array of inositol phospholipids such as phosphatidylinositol 3-phosphate (PI3P),
phosphatidylinositol 4-phosphate (PI4P) and phosphatidylinositol 5-phosphate (PI5P)
Subcellular location: Cytoplasm (By similarity). Cell membrane; Peripheral membrane protein; Cytoplasmic side (By
similarity)
Sequence caution: Sequence=BAA20817.1; Type=Erroneous initiation; Note=Translation N-terminally shortened;
Sequence=CAM24069.3; Type=Erroneous gene model prediction; Sequence=CAM24070.1; Type=Erroneous gene model prediction;
Secondary accessions: A2A2X1 A2A2X2 A2A3G6 A2A3G8 B4DHD6 B4DIL6 E9PDN8 Q5JU56 Q5VXT1 Q6ZWD4 Q765G8
Q765G9 Q8N679
Alternative splicing: 9 isoforms:  O15068-1   O15068-2   O15068-3   O15068-4   O15068-5   O15068-6   O15068-9   O15068-8   
O15068-10   (No experimental confirmation available)

Explore the universe of human proteins at neXtProt for MCF2L: NX_O15068

Post-translational modifications:

  • View modification sites using PhosphoSitePlus2
  • View neXtProt modification sites for NX_O15068

  • MCF2L Protein expression data from MOPED and PaxDb:    About this image 
    MCF2L Protein Expression
    REFSEQ proteins (2 alternative transcripts): 
    NP_001106203.2  NP_079255.4  

    ENSEMBL proteins: 
     ENSP00000364758   ENSP00000380230   ENSP00000398383   ENSP00000380225   ENSP00000440374  
     ENSP00000397285   ENSP00000395707   ENSP00000386551   ENSP00000364747   ENSP00000380219  
     ENSP00000380216   ENSP00000405996   ENSP00000380212   ENSP00000407392   ENSP00000261963  
     ENSP00000392953   ENSP00000411315   ENSP00000404422   ENSP00000395978   ENSP00000401422  
     ENSP00000364754   ENSP00000364751   ENSP00000407722   ENSP00000405639  
    Reactome Protein details: O15068
    Human Recombinant Protein Products for MCF2L: 
    Browse Purified and Recombinant Proteins at EMD Millipore
    Browse R&D Systems for human recombinant proteins
    Browse recombinant and purified proteins available from Enzo Life Sciences
    Browse OriGene full length recombinant human proteins expressed in human HEK293 cells
    OriGene Protein Over-expression Lysate: MCF2L
    OriGene Custom Protein Services for MCF2L 
    GenScript Custom Purified and Recombinant Proteins Services for MCF2L
    Novus Biologicals MCF2L Protein
    Novus Biologicals MCF2L Lysate
    Browse Sino Biological Recombinant Proteins
    Browse ProSpec Recombinant Proteins
    Uscn Proteins for MCF2L

    Gene Ontology (GO): 5 cellular component terms (GO ID links to tree view):    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0005622intracellular ----
    GO:0005829cytosol TAS--
    GO:0005886plasma membrane IEA--
    GO:0016020membrane ----
    GO:0030027lamellipodium IEA--

    MCF2L for ontologies           About GeneDecksing



    MCF2L Antibody Products: 
    Browse EMD Millipore's Extensive Line of Mono- and Polyclonal Antibodies
    Browse R&D Systems for Antibodies
    OriGene Antibodies: MCF2L
    OriGene Custom Antibody Services for MCF2L 
    GenScript Custom Superior Antibodies Services for MCF2L
    Novus Biologicals MCF2L Antibodies
    Abcam antibodies for MCF2L 
    Uscn Antibodies for MCF2L
    ThermoFisher Antibodies for MCF2L

    Assay Products for MCF2L: 
    Browse Kits and Assays available from EMD Millipore
    OriGene Custom Immunoassay Development
    Browse OriGene Fluorogenic Cell Assay Kits
    Browse R&D Systems for biochemical assays
    GenScript Custom Assay Services for MCF2L
    Browse Enzo Life Sciences for kits & assays
    Uscn ELISAs and CLIAs for MCF2L


    (According to InterPro, ProtoNet, UniProtKB, and/or BLOCKS, Sets of similar genes according to GeneDecks)
    About This Section

    MCF2L for domains           About GeneDecksing

    5/9 InterPro domains/families (see all 9):
     IPR002017 Spectrin_repeat
     IPR000219 DH-domain
     IPR001849 Pleckstrin_homology
     IPR001251 CRAL-TRIO_dom
     IPR001452 SH3_domain

    Graphical View of Domain Structure for InterPro Entry O15068

    ProtoNet protein and cluster: O15068

    3 Blocks protein families:
    IPB000219 DH domain
    IPB001849 Pleckstrin-like
    IPB002017 Spectrin repeat


    UniProtKB/Swiss-Prot: MCF2L_HUMAN, O15068
    Domain: The CRAL-TRIO domain is involved in interaction with inositol phospholipids
    Domain: The DH domain is involved in interaction with CCPG1 (By similarity)
    Similarity: Belongs to the MCF2 family
    Similarity: Contains 1 CRAL-TRIO domain
    Similarity: Contains 1 DH (DBL-homology) domain
    Similarity: Contains 1 PH domain
    Similarity: Contains 1 SH3 domain
    Similarity: Contains 1 spectrin repeat


    (According to 1UniProtKB, Genatlas, LifeMap Discovery™, IUBMB, and/or 2DME, Human phenotypes from GenomeRNAi, Animal models from MGI Mar 06 2013, inGenious Targeting Laboratory,
    bound targets from SABiosciences, miRNA Gene Targets from miRTarBase, shRNA from OriGene, Sirion Biotech, RNAi from EMD Millipore, siRNAs from OriGene, QIAGEN, microRNA from QIAGEN, Gene Editing from DNA2.0, Sirion Biotech, Clones from EMD Millipore, OriGene, SwitchGear Genomics, GenScript, Sino Biological, DNA2.0, and Vector BioLabs, Cell Lines from GenScript, LifeMap BioReagents, Sirion Biotech, In Situ Hybridization Assays from Advanced Cell Diagnostics, Ontologies according to Gene Ontology Consortium 01 Mar 2013 via Entrez Gene.)
    About This Section

    Molecular Function:

         UniProtKB/Swiss-Prot Summary: MCF2L_HUMAN, O15068
    Function: Guanine nucleotide exchange factor that potentially links pathways that signal through RAC1, RHOA and CDC42.
    Catalyzes guanine nucleotide exchange on RHOA and CDC42 and interacts specifically with the GTP-bound form of RAC1,
    suggesting that it functions as an effector of RAC1. May also participate in axonal transport in the brain. Becomes
    activated and highly tumorigenic by truncation of the N-terminus (By similarity). Isoform 5 activates CDC42

         Gene Ontology (GO): 4 molecular function terms (GO ID links to tree view):    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0005089Rho guanyl-nucleotide exchange factor activity IEA--
    GO:0005515protein binding ----
    GO:0005543phospholipid binding ----
    GO:00055451-phosphatidylinositol binding IEA--
         
    MCF2L for ontologies           About GeneDecksing


    Phenotypes:
         1 GenomeRNAi human phenotype for MCF2L:
     Increased gamma-H2AX phosphory 

         4 MGI mutant phenotypes (inferred from 1 allele(MGI details for Mcf2l):
     behavior/neurological  hematopoietic system  homeostasis/metabolism  immune system 

    MCF2L for phenotypes           About GeneDecksing

    Animal Models:
       inGenious Targeting Laboratory - Customizable classic, inducible, and humanized mouse model solutions for MCF2L 

    miRNA
    Products:
        
    OriGene 3'-UTR Clone (see all 2): MCF2L
    Browse MicroRNA Expression Plasmids
    QIAGEN Custom miScript Target Protector blocks miRNA-binding site of human, mouse, rat MCF2L
    8/45 QIAGEN miScript miRNA Assays for microRNAs that regulate MCF2L (see all 45):
    hsa-miR-106a hsa-miR-15a hsa-miR-128 hsa-miR-624* hsa-miR-30d hsa-miR-424 hsa-miR-30a hsa-miR-93
    SwitchGear 3'UTR luciferase reporter plasmidMCF2L 3' UTR sequence
    Inhib. RNA
    Products:
        
    Browse for Gene Knock-down Tools from EMD Millipore
    OriGene 29mer shRNA kits in GFP-retroviral vector in human, mouse, rat for MCF2L (see all 7)
    OriGene shRNA RFP: MCF2L
    OriGene siRNA: MCF2L
    QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat MCF2L
    Sirion Biotech Custom design and validation of potent shRNA sequences against MCF2L 

    Gene Editing
    Products:
    DNA2.0 Custom Protein Engineering Service for MCF2L
    Sirion Biotech Customized adenovirus for overexpression of MCF2L 
    Sirion Biotech Customized adenovirus for potent knockdown of MCF2L

    Clone
    Products:
         
    Browse Clones for the Expression of Recombinant Proteins Available from EMD Millipore
    OriGene Myc/DDK tagged cDNA clones in CMV expression vector in human, mouse, rat for MCF2L (see all 6)
    OriGene untagged cDNA clones in CMV expression vector in human, mouse, rat for MCF2L (see all 3)
    OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling 
    GenScript: all cDNA clones in your preferred vector: MCF2L (NM_015078)
    Browse Sino Biological Human cDNA Clones
    DNA2.0 Custom Codon Optimized Gene Synthesis Service for MCF2L
    Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat MCF2L 

    Cell Line
    Products:
         
    GenScript Custom overexpressing Cell Line Services for MCF2L
    Search LifeMap BioReagents cell lines for MCF2L
    Sirion Biotech Customized stable knockdown cell line services for MCF2L 
    Sirion Biotech Customized inducible knockdown cell line services for MCF2L
    Sirion Biotech Customized stable overexpressing cell line services for MCF2L
    Sirion Biotech Customized inducible overexpressing cell line services for MCF2L

    In Situ Assay
    Products:
       

     
    Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for MCF2L


    (Pathways according to EMD Millipore, R&D Systems, Cell Signaling Technology, KEGG, PharmGKB, BioSystems, Reactome, Tocris Bioscience, GeneGo (Thomson Reuters), QIAGEN, and/or UniProtKB, Sets of similar genes according to GeneDecks, Interaction Networks according to SABiosciences, and/or STRING, Interactions according to 1UniProtKB, 2MINT, 3I2D, and/or 4STRING, with links to IntAct and Ensembl, Ontologies according to Gene Ontology Consortium 01 Mar 2013 via Entrez Gene).
    About This Section

    Unified GeneCards pathways - 5/23 super-pathways (see all 23About this table 
    See pathways by source

    Super-pathwaycontained gene-specific pathways
    1Cell death signalling via NRAGE, NRIF and NADE
    Cell death signalling via NRAGE, NRIF and NADE1.00
    G alpha (12/13) signalling events0.39
    NRAGE signals death through JNK0.74
    Rho GTPase cycle0.25
    p75 NTR receptor-mediated signalling0.73
    Signaling by Rho GTPases0.25
    2GPCR Pathway
    GPCR Pathway1.00
    Breast Cancer Regulation by Stathmin10.58
    Ras Pathway0.62
    Pancreatic Adenocarcinoma0.55
    3Signaling by GPCR
    Signaling by GPCR1.00
    Signal Transduction0.56
    GPCR downstream signaling0.89
    4G-protein signaling_RhoA regulation pathway
    G-protein signaling_RhoA regulation pathway1.00
    G-protein signaling RhoA regulation pathway1.00
    5G-protein signaling_RAC1 in cellular process
    G-protein signaling RAC1 in cellular process1.00
    G-protein signaling_RAC1 in cellular process1.00

    Pathway sources
    See GeneCards unified pathways
    Show all pathways

    4 EMD Millipore Pathways for MCF2L
        G-protein signaling RAC1 in cellular process
    G-protein signaling Regulation of CDC42 activity
    G-protein signaling Cross-talk between Ras-family GTPases
    G-protein signaling RhoA regulation pathway

    5/20 Downloadable PowerPoint Slides of QIAGEN Pathway Central Maps for MCF2L (see all 20)
        RhoA Pathway
    Guidance Cues and Growth Cone Motility
    Molecular Mechanisms of Cancer
    Interferon Pathway
    G-AlphaI Signaling

    4 GeneGo (Thomson Reuters) Pathways for MCF2L
        G-protein signaling Cross-talk between Ras-family GTPases
    G-protein signaling RAC1 in cellular process
    G-protein signaling Regulation of CDC42 activity
    G-protein signaling RhoA regulation pathway

    3 BioSystems Pathways for MCF2L 
        Regulation of CDC42 activity
    Regulation of RhoA activity
    Neurotrophic factor-mediated Trk receptor signaling

    5/10        Reactome Pathways for MCF2L (see all 10)
        GPCR downstream signaling
    Signaling by Rho GTPases
    G alpha (12/13) signalling events
    Cell death signalling via NRAGE, NRIF and NADE
    Signaling by GPCR



    MCF2L for pathways           About GeneDecksing

    Interactions:

        SABiosciences Gene Network CentralTM Interacting Genes and Proteins Network for MCF2L

    STRING Interaction Network Preview (showing 5 interactants - click image to see 25)

    5/168 Interacting proteins for MCF2L (O150682, 3 ENSP000003647544) via UniProtKB, MINT, STRING, and/or I2D (see all 168)
    InteractantInteraction Details
    GeneCardExternal ID(s)
    YAE1D1Q9NRH12, 3, ENSP000002232734MINT-8250209 I2D: score=2 STRING: ENSP00000223273
    AIMP2Q131552, 3MINT-8258984 I2D: score=2 
    RABAC1Q9UI142, 3, ENSP000002220084MINT-8267775 I2D: score=2 STRING: ENSP00000222008
    RHOAP615863, ENSP000004001754I2D: score=3 STRING: ENSP00000400175
    RHOGP840953, ENSP000003394674I2D: score=1 STRING: ENSP00000339467
    About this table

    Gene Ontology (GO): 5/8 biological process terms (GO ID links to tree view) (see all 8):    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0006915apoptotic process TAS--
    GO:0007264small GTPase mediated signal transduction TAS--
    GO:0007266Rho protein signal transduction IEA--
    GO:0035023regulation of Rho protein signal transduction IEA--
    GO:0035556intracellular signal transduction ----

    MCF2L for ontologies           About GeneDecksing



    (Chemical Compounds according to UniProtKB, Enzo Life Sciences, EMD Millipore, Tocris Bioscience HMDB, BitterDB, and/or Novoseek, and Drugs according to DrugBank, Enzo Life Sciences, and/or PharmGKB, with drugs/clinical trials/news search links to CenterWatch)
    About This Section

    MCF2L for compounds           About GeneDecksing

    Browse Small Molecules at EMD Millipore
    Browse drugs & compounds from Enzo Life Sciences

    Browse Tocris compounds for MCF2L

    3 HMDB Compounds for MCF2L    About this table
    CompoundSynonyms CAS #PubMed Ids
    Guanosine diphosphate5'-GDP (see all 10)146-91-8--
    Guanosine monophosphate5'-GMP (see all 14)85-32-5--
    Guanosine triphosphate5'-GTP (see all 10)86-01-1--
    2 Novoseek chemical compound relationships for MCF2L gene    About this table
    Compound   -log (P-Val)   Hits   PubMed IDs for Articles with Shared Sentences (# sentences)
    phosphoinositide 48.2 5 12637530 (2), 15274927 (1), 11577097 (1)
    guanine 37.3 1 9444953 (1)

    Search CenterWatch for drugs/clinical trials and news about MCF2L 

    (Secondary structures according to fRNAdb,
    GenBank/EMBL/DDBJ Accessions according to
    Unigene (Build 235 Homo sapiens; Mar 10 2013) or GenBank,
    RefSeq according to Entrez Gene,
    DOTS (version 10), and/or AceView, transcript ids from Ensembl with links to UCSC,
    exon structure from GeneLoc, alternative splicing isoforms according to ASD and/or ECgene,
    RNAi Products from EMD Millipore,
    siRNAs from OriGene, QIAGEN, shRNA from OriGene, Sirion Biotech, microRNA from QIAGEN,
    Tagged/untagged cDNA clones from OriGene, SwitchGear Genomics, GenScript, DNA2.0, Vector BioLabs, Primers from OriGene, SABiosciences, and/or QIAGEN )
    About This Section

    REFSEQ mRNAs for MCF2L gene (2 alternative transcripts): 
    NM_001112732.2  NM_024979.4  

    Unigene Cluster for MCF2L:

    MCF.2 cell line derived transforming sequence-like
    Hs.170422  [show with all ESTs]
    Unigene Representative Sequence: NM_024979
    18/36 Ensembl transcripts including schematic representations, and UCSC links where relevant (see all 36):
    ENST00000375608 ENST00000397036 ENST00000442625(uc001vso.3) ENST00000397030(uc001vsq.3 uc001vsu.3 uc010tjr.2 uc001vsr.3 uc010tjs.2)
    ENST00000535094 ENST00000421756 ENST00000433807 ENST00000409954 ENST00000375597(uc001vss.4 uc001vst.1)
    ENST00000486210 ENST00000397024 ENST00000486806 ENST00000473345 ENST00000480321
    ENST00000469558 ENST00000397021 ENST00000494043 ENST00000423251

    miRNA
    Products:
         
    OriGene 3'-UTR Clone (see all 2): MCF2L
    Browse OriGene MicroRNA Expression Plasmids
    QIAGEN Custom miScript Target Protector blocks miRNA-binding site of human, mouse, rat MCF2L
    8/45 QIAGEN miScript miRNA Assays for microRNAs that regulate MCF2L (see all 45):
    hsa-miR-106a hsa-miR-15a hsa-miR-128 hsa-miR-624* hsa-miR-30d hsa-miR-424 hsa-miR-30a hsa-miR-93
    SwitchGear 3'UTR luciferase reporter plasmidMCF2L 3' UTR sequence
    Inhib. RNA
    Products:
         
    Browse for Gene Knock-down Tools from EMD Millipore
    OriGene 29mer shRNA kits in GFP-retroviral vector in human, mouse, rat for MCF2L (see all 7)
    OriGene shRNA RFP: MCF2L
    OriGene siRNA: MCF2L
    QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat MCF2L
    Sirion Biotech Custom design and validation of potent shRNA sequences against MCF2L 
    Clone
    Products:
         
    OriGene Myc/DDK tagged cDNA clones in CMV expression vector in human, mouse, rat for MCF2L (see all 6)
    OriGene untagged cDNA clones in CMV expression vector in human, mouse, rat for MCF2L (see all 3)
    OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling 
    GenScript: all cDNA clones in your preferred vector: MCF2L (NM_015078)
    DNA2.0 Custom Codon Optimized Gene Synthesis Service for MCF2L
    Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat MCF2L 
    Primer
    Products:
        
    OriGene genome-wide validated SYBR primer pairs in human, mouse, rat for MCF2L
    Browse OriGene validated miRNA SYBR primer pairs
    SABiosciences RT2 qPCR Primer Assay in human, mouse, rat MCF2L
      QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat MCF2L
      QIAGEN QuantiFast Probe-based Assays in human, mouse, rat MCF2L

    Additional cDNA sequence: 

    AB116074.1 AB116075.1 AF086413.1 AK094768.1 AK295047.1 AK295670.1 AK307867.1 AK315969.1 
    BC011853.2 BC020208.1 BC107066.1 BC107067.1 

    20 DOTS entries:

    DT.115772  DT.92033375  DT.99957854  DT.95245817  DT.95295746  DT.75197239  DT.40110297  DT.120791719 
    DT.120791725  DT.120791768  DT.91895987  DT.95285986  DT.120791696  DT.120791740  DT.75195528  DT.92015548 
    DT.97818395  DT.120791686  DT.87006741  DT.91746518 

    24/137 AceView cDNA sequences (see all 137):

    AA339653 AA365066 BM699259 BU681158 BQ684167 AW080046 NM_024979 BC011853 
    BC020208 CA432698 BM669475 AB116074 BF870252 BF589605 BF870256 BM794518 
    BU736498 CD671904 BM697869 AB116075 CB154960 BU180155 BF944982 BE327507 

    GeneLoc Exon Structure


    (RNA expression data according to H-InvDB, NONCODE, miRBase, and RNAdb, Expression images according to data from BioGPS, Illumina Human BodyMap, and CGAP SAGE, Sets of similar genes according to GeneDecks, in vivo and in vitro expression data from LifeMap Discovery™, plus additional links to Genevestigator, and/or SOURCE, and/or BioGPS, and/or UniProtKB,
    PCR Arrays from SABiosciences, Primers from OriGene, SABiosciences, and/or QIAGEN, In Situ Hybridization Assays from Advanced Cell Diagnostics)
    About This Section

    MCF2L expression in normal human tissues (normalized intensities)
    See probesets specificity/sensitivity at GeneAnnot
    About this imageBioGPS
    CGAP TAG: TTTCATCCAC
    MCF2L Expression
    About this image
    See MCF2L Protein Expression from SPIRE MOPED and PaxDB
    Genevestigator expression for MCF2L

    SOURCE GeneReport for Unigene cluster: Hs.170422
        SABiosciences Custom PCR Arrays for MCF2L

    Primer
    Products:
    OriGene genome-wide validated SYBR primer pairs in human, mouse, rat for MCF2L
    Browse OriGene validated miRNA SYBR primer pairs
    SABiosciences RT2 qPCR Primer Assay in human, mouse, rat MCF2L
    QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat MCF2L
    QIAGEN QuantiFast Probe-based Assays in human, mouse, rat MCF2L
    In Situ
    Assay Products:
     

     
    Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for MCF2L

    (Orthologs according to 1,2HomoloGene (2older version, for species not in 1newer version), 3euGenes, 4SGD , 5MGI Mar 06 2013, with possible further links to Flybase and/or WormBase, and/or 6Ensembl pan taxonomic compara , Gene Trees according to Ensembl and TreeFam)
    About This Section

    This gene was present in the common ancestor of animals.

    Orthologs for MCF2L gene from 5/20 species (see all 20)    About this table
    Organism Taxonomic
    classification
    Gene Description Human
    Similarity
    Orthology
    Type
    Details
    chicken
    (Gallus gallus)
    Aves MCF2L1 MCF.2 cell line derived transforming sequence-like 70.6(n)
    75.77(a)
      418748  NM_001252063.1  NP_001238992.1 
    lizard
    (Anolis carolinensis)
    Reptilia MCF2L6
    --
    64(a)
    1 ↔ 1
    3(105857215-105920008)
    zebrafish
    (Danio rerio)
    Actinopterygii mcf2l1 mcf.2 cell line derived transforming sequence-like 66.7(n)
    66.45(a)
      100148439  XM_001922148.3  XP_001922183.3 
    fruit fly
    (Drosophila melanogaster)
    Insecta CG304403 guanyl-nucleotide exchange factor 40(a)   41F4   --
    worm
    (Caenorhabditis elegans)
    Secernentea cgef-16
    CDC-42 Guanine nucleotide Exchange Factor family m...
    19(a)
    1 → many
    X(2785593-2799235)


    ENSEMBL Gene Tree for MCF2L (if available)
    TreeFam Gene Tree for MCF2L (if available) 

    (Paralogs according to 1HomoloGene,
    2Ensembl, and 3SIMAP, Pseudogenes according to 4Pseudogene.org Build 68)
    About This Section
    Paralogs for MCF2L gene
    KALRN2  ARHGEF252  PLEKHG4B2  MCF2L22  TRIO2  KIAA17552  PLEKHG42  MCF22  
    ARHGEF402  
    7 SIMAP similar genes for MCF2L using alignment to 21 protein entries:     MCF2L_HUMAN (see all proteins):
    MCF2L2    MCF2    KALRN    tgat    TRIO    SESTD1
    PREX2

    MCF2L for paralogs           About GeneDecksing



    (SNPs/Variants according to the 1NCBI SNP Database, 2Ensembl, 3PupaSUITE, UniProtKB, and DNA2.0, Linkage Disequilibrium by HapMap, Structural Variations(CNVs/InDels/Inversions) from the Database of Genomic Variants, Mutations from the Human Gene Mutation Database (HGMD) and the Locus Specific Mutation Databases (LSDB), Blood group antigen gene mutations by BGMUT, Resequencing Primers from QIAGEN, Cancer Mutation PCR Arrays and Assays and Copy Number PCR Arrays from SABiosciences)
    About This Section

    10/3236 NCBI SNPs in MCF2L are shown (see all 3236    About this table
    Genomic DataTranscription Related DataAllele Frequencies
    SNP IDValidClinical
    significance
    Chr 13 posSequence#AA
    Chg
    TypeMore#Allele
    freq
    PopTotal
    sample
    More
    ----------
    rs38310301,2
    C--94168529(-) AGCAC-/CCCAAGGGGACACAG
    TGCTGGACAAGGCCAAT
    CCCAA
    1 -- int11Minor allele frequency- CCCAAGGGGACACAGTGCTGGACAAGGCCAAT:0.00NA 2
    rs1135777841,2
    C--94178702(+) AGGTGC/TGAGGG 1 -- int11Minor allele frequency- T:0.50NA 2
    rs95774571,2
    C,A,H--94178710(+) GGGGTC/TTGCAC 1 -- int11Minor allele frequency- T:0.00NA 2
    rs1925801601,2
    --113621618(+) GTGCCA/GCCGTA 2 -- us2k1 int10--------
    rs1836947111,2
    --113621729(+) ATTCTA/GTAGAA 2 -- int1 us2k10--------
    rs1445093231,2
    --113621778(+) TAAACA/GAAAAC 2 -- us2k1 int10--------
    rs29932711,2
    C,F,A,H--113621815(+) ATTTAC/TTCAAT 2 -- us2k1 nc-transcript-variant13Minor allele frequency- T:0.11NA WA CSA EA 376
    rs1884074821,2
    --113622031(+) CCGGGA/TTGTTG 2 -- us2k1 nc-transcript-variant0--------
    rs1812295131,2
    --113622069(+) CTGGTG/TCATTG 2 -- us2k1 nc-transcript-variant0--------
    rs1121827171,2
    C--113622102(+) ACGCAC/TGCTCT 2 -- nc-transcript-variantus2k11Minor allele frequency- T:0.50NA 2

    HapMap Linkage Disequilibrium report for MCF2L (113548692 - 113754053 bp)
    Structural Variations (Copy Number Variations, Insertions/Deletions, Inversions)
    Database of Genomic Variants (DGV): 13 variations for MCF2L
         8 CNVs: 3927 4819 66564 49179 31951 9723 23301 71806
         5 Indels: 11702 25164 101876 58613 45131

    SABiosciences Cancer Mutation PCR Assays
    QIAGEN SeqTarget long-range PCR primers in human, mouse, rat for resequencing MCF2L
    DNA2.0 Custom Variant and Variant Library Synthesis for MCF2L

    (in which this Gene is Involved, According to MalaCards, OMIM, UniProtKB, the University of Copenhagen DISEASES database, Genatlas, GeneTests, GAD, HuGE Navigator, and/or TGDB.)
    About This Section

    MCF2L for disorders           About GeneDecksing

    OMIM gene information: 609499    OMIM disorders: --

    7 diseases for MCF2L:    About MalaCards
    hypoparathyroidism    spasticity    osteoarthritis    breast cancer
    carcinoma    adenocarcinoma    pancreatitis

    Human Genome Epidemiology (HuGE) Navigator: MCF2L (3 documents)

    Export disorders for MCF2L gene to outside databases

    (in PubMed. Associations of this gene to articles via 1Entrez Gene, 2UniProtKB/Swiss-Prot, 3HGNC, 4GAD, 5PharmGKB, 6HMDB, 7DrugBank, 8UniProtKB/TrEMBL, 9 Novoseek, and/or 10fRNAdb)
    About This Section

    PubMed articles for MCF2L gene, integrated from 9 sources (see all 44):
    (articles sorted by number of sources associating them with MCF2L)
        Utopia: connect your pdf to the dynamic
    world of online information

    1. Prediction of the coding sequences of unidentified human genes. VII. The complete sequences of 100 new cDNA clones from brain which can code for large proteins in vitro. (PubMed id 9205841)1, 2, 3 Nagase T.... Ohara O. (1997)
    2. Role of the Sec14-like domain of Dbl family exchange factors in the regulation of Rho family GTPases in different subcellular sites. (PubMed id 15157669)1, 2, 9 Ueda S.... Satoh T. (2004)
    3. Complete sequencing and characterization of 21,243 full-length human cDNAs. (PubMed id 14702039)1, 2 Ota T.... Sugano S. (2004)
    4. A crystallographic view of interactions between Dbs and Cdc42: PH domain-assisted guanine nucleotide exchange. (PubMed id 11889037)1, 9 Rossman K.L....Sondek J. (2002)
    5. Genetic contribution to radiographic severity in osteo arthritis of the knee. (PubMed id 22615457)1 Valdes A.M....Doherty M. (2012)
    6. A variant in MCF2L is associated with osteoarthritis. (PubMed id 21871595)1 Day-Williams A.G....Zeggini E. (2011)
    7. A proteome-wide, quantitative survey of in vivo ubiqui tylation sites reveals widespread regulatory roles. (PubMed id 21890473)1 Wagner S.A....Choudhary C. (2011)
    8. A directed protein interaction network for investigat ing intracellular signal transduction. (PubMed id 21900206)1 Vinayagam A....Wanker E.E. (2011)
    9. Personalized smoking cessation: interactions between nicotine dose, dependence and quit-success genotype score. (PubMed id 20379614)1 Rose J.E....Uhl G.R. (2010)
    10. Mutation of ARHGAP9 in patients with coronary spastic angina. (PubMed id 19911011)1 Takefuji M....Kaibuchi K. (2010)

    (in PubMed, OMIM, and NCBI Bookshelf)
    About This Section
     ANDOR
    Aliases
    Free Text  

      Query String
    PubMed
    OMIM
    NCBI Bookshelf
      (Note: In FireFox, select the above section and copy using Ctrl-C)

    (According to Entrez Gene, HGNC, AceView, euGenes, Ensembl, miRBase, ECgene, Kegg, and/or H-InvDB)
    About This Section
    Entrez Gene: 23263 HGNC: 14576 AceView: MCF2L Ensembl:ENSG00000126217 euGenes: HUgn23263
    ECgene: MCF2L H-InvDB: MCF2L

    (According to HUGE)
    About This Section
    HUGE: KIAA0362

    (According to PharmGKB, ATLAS, HORDE, IMGT, LEIDEN, UniProtKB/Swiss-Prot, and/or UniProtKB/TrEMBL,
    Wikipedia and/or GeneReviews via UniProtKB/Swiss-Prot)
    About This Section
    NameDescription
    PharmGKB entry for MCF2L Pharmacogenomics, SNPs, Pathways
    ATLAS Chromosomes in Cancer entry for MCF2L Genetics and Cytogenetics in Oncology and Haematology

    (Patent information from GeneIP,
    Licensable technologies from WIS Yeda, Salk, Tufts,
    IP news from LifeMap Sciences, Inc.)
    About This Section
    Patent Information for MCF2L gene:
    Search GeneIP for patents involving MCF2L

    GeneCards and IP:
    Japan Patent Office Licenses GeneCards     European Patent Office Licenses GeneCards     Improving the IP Search



    (Antibodies, recombinant proteins, and assays from EMD Millipore, R&D Systems, OriGene, QIAGEN, GenScript, Cell Signaling Technology, SABiosciences, Novus Biologicals, Sino Biological, Enzo Life Sciences, Abcam, ProSpec, Uscn, Thermo Fisher Scientific, Gene Editing from DNA2.0 and Sirion Biotech, Clones from EMD Millipore, OriGene, GenScript, Sino Biological, DNA2.0, SwitchGear Genomics, Vector BioLabs, Cell lines from GenScript, LifeMap BioReagents, and Sirion Biotech, PCR Arrays from SABiosciences, Drugs and/or compounds from EMD Millipore, Tocris Bioscience, and/or Enzo Life Sciences, In Situ Hybridization Assays from
    Advanced Cell Diagnostics, Animal models from inGenious Targeting Laboratory)
    About This Section

     
     EMD Millipore Custom Antibody & Bulk Services
     EMD Millipore Preclinical / Clinical Development Services
     EMD Millipore Immunoassay Services
     EMD Millipore Target Screening & Profiling Services

      
     Browse Antibodies   Browse Cell Culture Products  
     Browse ELISAs   Browse Flow Cytometry Kits  
     Browse Primer Pairs   Browse Kinase Activity Assays/Reagents  
     Browse ELISpot Kits/Development Modules   Browse TFB/Immunoprecipitation Assays  
     Browse Apoptosis Detection Kits/Reagents   Browse Ubiquitin Proteasome Pathway (UPP) Assay Kits/Reagents  
     Browse DNA Damage/Repair Kits/Reagents   Browse Multiplex/Array Assay Kits/Reagents  
     Browse Cell Selection/Detection Kits/Reagents   Browse Secondary Antibodies/Controls/Staining Reagents  
     Browse Phosphatase Activity Assays/Reagents   Browse Recombinant/Natural Proteins  
     OriGene Antibodies for MCF2L   OriGene shRNA RFP for MCF2L  
     OriGene 29mer shRNA kits in GFP-retroviral vector in human, mouse, rat for MCF2L   OriGene genome-wide validated SYBR primer pairs in human, mouse, rat for MCF2L  
     OriGene Protein Over-expression Lysate for MCF2L   Browse OriGene Fluorogenic Cell Assay Kits  
     OriGene siRNA for MCF2L   OriGene 3'-UTR Clone for MCF2L  
     OriGene untagged cDNA clones in CMV expression vector in human, mouse, rat for MCF2L   OriGene Myc/DDK tagged cDNA clones in CMV expression vector in human, mouse, rat for MCF2L  
     Browse OriGene GFP tagged cDNA clones in CMV expression vector   Browse OriGene MicroRNA Expression Plasmids  
     Browse OriGene basic RS shRNAs   Browse OriGene validated miRNA SYBR primer pairs  
     Browse OriGene full length recombinant human proteins expressed in human HEK293 cells   OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling  
     OriGene Custom Antibody Services for MCF2L   OriGene Custom Protein Services for MCF2L  
     OriGene Custom Immunoassay Development  

     
     
     QIAGEN Custom miScript Target Protector blocks miRNA-binding site of in human, mouse, rat MCF2L
     QIAGEN SeqTarget long-range PCR primers in human, mouse, rat for resequencing MCF2L
     QIAGEN PyroMark CpG Assay predesigned Pyrosequencing DNA Methylation assays in human, mouse, rat MCF2L
     QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat MCF2L
     QIAGEN QuantiFast Probe-based Assays in human, mouse, rat MCF2L
     QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat MCF2L
     GenScript Custom Purified and Recombinant Proteins Services for MCF2L GenScript cDNA clones with any tag delivered in your preferred vector for MCF2L
     GenScript Custom Assay Services for MCF2L GenScript Custom Superior Antibodies Services for MCF2L
     GenScript Custom overexpressing Cell Line Services for MCF2L CloneReady with Over 120,000 Genes
     Gene Synthesis: Any Gene in Any Vector Vector-based siRNA and miRNA, Ready for Transfection
     Gene Mutant Library, Variants up to 10^11 Plasmid Preparation
     Custom Peptide Services
     Search for Antibodies & Assays

     Regulatory tfbs in MCF2L promoter
     Search Chromatin IP Primers for MCF2L
     RT2 qPCR Primer Assay in human, mouse, rat MCF2L
     GNC Network for MCF2L
     SABiosciences PCR Arrays including human, mouse, rat MCF2L
     Search Tocris compounds for MCF2L
     Browse Sino Biological Proteins and Antibodies
     Browse Sino Biological cDNA Clones
     Antibodies/Proteins Production Services
     Rabbit Monoclonal Antibody Platform
     Bulk Purchasing
     Search www.enzolifesciences.com for proteins, assays, substrates, inhibitors & antibodies
     Novus Tissue Slides
     MCF2L antibodies
     MCF2L proteins
     MCF2L lysates
     Antibodies for MCF2L
     See all of Abcam's Antibodies, Kits and Proteins for MCF2L
     Custom Antibody / Protein Production Service
     Bulk Purchasing
     Advantages of Rabbit Monoclonal antibodies
     Abcam protocols and scientific support
     Browse ProSpec Recombinant Proteins




     MCF2L Proteins, Antibodies, CLIAs, and ELISAs
     Search LifeMap BioReagents cell lines for MCF2L
     Gene Synthesis
     Protein Engineering
     Variant Library Synthesis
     Codon Optimization
     Protein Production and Purification
     Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for MCF2L
     SwitchGear 3'UTR luciferase reporter plasmids for MCF2L
     SwitchGear Promoter luciferase reporter plasmids for MCF2L
     ThermoFisher Antibodies for MCF2L
     Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat MCF2L
     inGenious Targeting Laboratory - Customizable classic, inducible, and humanized mouse model solutions for MCF2L
    Sirion Biotech Customized:
     stable knockdown cell line services for MCF2L
     inducible knockdown cell line services for MCF2L
     design and validation of potent shRNA sequences against MCF2L
     adenovirus for potent knockdown of MCF2L
     adenovirus for overexpression of MCF2L
     stable overexpressing cell line services for MCF2L
     inducible overexpressing cell line services for MCF2L
           
    GeneCards Homepage - Last full update: 19 Mar 2013 - Incrementals: 21 Mar 2013 , 15 Apr 2013 , 26 Apr 2013 , 14 May 2013

    View Random Gene

    Category
    VWF
    (GIFTS: 73)
    von Willebrand factor
    GIFtS Group
    The GeneCards human gene database gene index: 1 3 5 6 A B C D E F G H I J K L M N O P Q R S T U V W X Y Z 


    Developed at the Crown Human Genome Center, Department of Molecular Genetics, the Weizmann Institute of Science

    Hot genes      Disease genes      MCF2L gene at Home site.
    hostname: 356980-web2.xennexinc.com index build: 106 solr: 1.4