Free for academic non-profit institutions. Other users need a Commercial license

Aliases for MAP4K2 Gene

Aliases for MAP4K2 Gene

  • Mitogen-Activated Protein Kinase Kinase Kinase Kinase 2 2 3 5
  • MAPK/ERK Kinase Kinase Kinase 2 3 4
  • MEK Kinase Kinase 2 3 4
  • EC 4 56
  • MEKKK 2 3 4
  • RAB8IP 3 4
  • GCK 3 4
  • B Lymphocyte Serine/Threonine Protein Kinase 3
  • B Lymphocyte Serine/Threonine-Protein Kinase 4
  • Germinal Centre Kinase (GC Kinase) 3
  • Rab8 Interacting Protein 3
  • Rab8-Interacting Protein 4
  • Germinal Center Kinase 4
  • GC Kinase 4
  • EC 2.7.11 56
  • BL44 3

External Ids for MAP4K2 Gene

Previous HGNC Symbols for MAP4K2 Gene

  • RAB8IP

Previous GeneCards Identifiers for MAP4K2 Gene

  • GC11M067072
  • GC11M066238
  • GC11M064331
  • GC11M064313
  • GC11M064556
  • GC11M060883

Summaries for MAP4K2 Gene

Entrez Gene Summary for MAP4K2 Gene

  • The protein encoded by this gene is a member of the serine/threonine protein kinase family. Although this kinase is found in many tissues, its expression in lymphoid follicles is restricted to the cells of germinal centre, where it may participate in B-cell differentiation. This kinase can be activated by TNF-alpha, and has been shown to specifically activate MAP kinases. This kinase is also found to interact with TNF receptor-associated factor 2 (TRAF2), which is involved in the activation of MAP3K1/MEKK1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]

GeneCards Summary for MAP4K2 Gene

MAP4K2 (Mitogen-Activated Protein Kinase Kinase Kinase Kinase 2) is a Protein Coding gene. Diseases associated with MAP4K2 include Cerebral Cavernous Malformations 2. Among its related pathways are Angiopoietin Like Protein 8 Regulatory Pathway and MAPK signaling pathway. Gene Ontology (GO) annotations related to this gene include transferase activity, transferring phosphorus-containing groups and protein tyrosine kinase activity. An important paralog of this gene is MAP4K3.

UniProtKB/Swiss-Prot for MAP4K2 Gene

  • Serine/threonine-protein kinase which acts as an essential component of the MAP kinase signal transduction pathway. Acts as a MAPK kinase kinase kinase (MAP4K) and is an upstream activator of the stress-activated protein kinase/c-Jun N-terminal kinase (SAP/JNK) signaling pathway and to a lesser extent of the p38 MAPKs signaling pathway. Required for the efficient activation of JNKs by TRAF6-dependent stimuli, including pathogen-associated molecular patterns (PAMPs) such as polyinosine-polycytidine (poly(IC)), lipopolysaccharides (LPS), lipid A, peptidoglycan (PGN), or bacterial flagellin. To a lesser degree, IL-1 and engagement of CD40 also stimulate MAP4K2-mediated JNKs activation. The requirement for MAP4K2/GCK is most pronounced for LPS signaling, and extends to LPS stimulation of c-Jun phosphorylation and induction of IL-8. Enhances MAP3K1 oligomerization, which may relieve N-terminal mediated MAP3K1 autoinhibition and lead to activation following autophosphorylation. Mediates also the SAP/JNK signaling pathway and the p38 MAPKs signaling pathway through activation of the MAP3Ks MAP3K10/MLK2 and MAP3K11/MLK3. May play a role in the regulation of vesicle targeting or fusion. regulation of vesicle targeting or fusion.

Gene Wiki entry for MAP4K2 Gene

Additional gene information for MAP4K2 Gene

No data available for CIViC summary , Tocris Summary , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for MAP4K2 Gene

Genomics for MAP4K2 Gene

GeneHancer (GH) Regulatory Elements for MAP4K2 Gene

Promoters and enhancers for MAP4K2 Gene
GeneHancer (GH) Identifier GH Type GH
GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites
Gene Targets
GH11I064798 Promoter/Enhancer 2 EPDnew Ensembl ENCODE 550.8 +1.5 1484 6 HDGF PKNOX1 ATF1 SIN3A IRF4 POLR2B GLIS2 E2F8 ELK1 ZNF143 GC11P064802 MAP4K2 ENSG00000269038 RASGRP2 MEN1 GC11M064785
GH11I064841 Promoter/Enhancer 2.3 EPDnew Ensembl ENCODE dbSUPER 12 -40.4 -40447 4.3 HDGF PKNOX1 CLOCK FOXA2 ARNT ARID4B SIN3A ZNF2 ZBTB7B ZNF143 CDC42BPG SF1 POLA2 ZFPL1 PLCB3 PCNX3 ENSG00000257086 KAT5 EHD1 MEN1
GH11I064771 Enhancer 1 Ensembl ENCODE dbSUPER 5 +30.5 30528 2.6 SMARCA5 JUN JUNB ATF2 ATF4 POLR2A NBN ATF7 ETV6 RUNX3 GC11M064771 GC11M064772 GC11M064773 GC11M064774 GC11P064771 GC11P064772 NRXN2 MEN1 MAP4K2 SF1
GH11I064884 Enhancer 1.7 FANTOM5 Ensembl ENCODE dbSUPER 1.6 -82.6 -82552 1.7 FOXA2 MLX ARNT ARID4B DMAP1 POLR2B ZNF766 E2F8 FOS ZNF592 ATG2A EHD1 PCNX3 SF1 CDC42BPG TIGD3 RASGRP2 MAP4K2 PYGM RPS16P6
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data dump

GeneHancers around MAP4K2 on UCSC Golden Path with GeneCards custom track

Top Transcription factor binding sites by QIAGEN in the MAP4K2 gene promoter:

Genomic Locations for MAP4K2 Gene

Genomic Locations for MAP4K2 Gene
18,335 bases
Minus strand

Genomic View for MAP4K2 Gene

Genes around MAP4K2 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
MAP4K2 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for MAP4K2 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for MAP4K2 Gene

Proteins for MAP4K2 Gene

  • Protein details for MAP4K2 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Recommended name:
    Mitogen-activated protein kinase kinase kinase kinase 2
    Protein Accession:
    Secondary Accessions:
    • Q86VU3

    Protein attributes for MAP4K2 Gene

    820 amino acids
    Molecular mass:
    91556 Da
    Name=Mg(2+); Xref=ChEBI:CHEBI:18420;
    Quaternary structure:
    • Interacts with TRAF2, TRAF6, MAP3K1/MEKK1 and MAP3K11/MLK3. Interacts with RAB8A (By similarity).
    • Sequence=AAA20968.1; Type=Miscellaneous discrepancy; Note=Contaminating sequence. Sequence of unknown origin in the N-terminal part.; Evidence={ECO:0000305};

    Alternative splice isoforms for MAP4K2 Gene


neXtProt entry for MAP4K2 Gene

Selected DME Specific Peptides for MAP4K2 Gene


Post-translational modifications for MAP4K2 Gene

  • Autophosphorylated in response to tumor necrosis factor (TNF), endotoxins or proinflammatory stimuli. Autophosphorylation leads to activation.
  • Polyubiquitinated through Lys-48-polyubiquitin chains, allowing proteasomal turnover. Ubiquitination requires the kinase activity of MAP4K2/GCK.
  • Ubiquitination at posLast=3232

Domains & Families for MAP4K2 Gene

Gene Families for MAP4K2 Gene

Protein Domains for MAP4K2 Gene

Suggested Antigen Peptide Sequences for MAP4K2 Gene

GenScript: Design optimal peptide antigens:

Graphical View of Domain Structure for InterPro Entry



  • The PEST domains are Pro-, Glu-, Ser-, and Thr-rich domains. Proteins with PEST domains are frequently targets of degradation by the ubiquitin proteasome.
  • Belongs to the protein kinase superfamily. STE Ser/Thr protein kinase family. STE20 subfamily.
  • The PEST domains are Pro-, Glu-, Ser-, and Thr-rich domains. Proteins with PEST domains are frequently targets of degradation by the ubiquitin proteasome.
  • Belongs to the protein kinase superfamily. STE Ser/Thr protein kinase family. STE20 subfamily.
genes like me logo Genes that share domains with MAP4K2: view

Function for MAP4K2 Gene

Molecular function for MAP4K2 Gene

GENATLAS Biochemistry:
mitogen-activated kinase kinase kinase kinase 2,located in the MEN1 critical region
UniProtKB/Swiss-Prot CatalyticActivity:
ATP + a protein = ADP + a phosphoprotein.
UniProtKB/Swiss-Prot EnzymeRegulation:
The tumor necrosis factor (TNF), as well as endotoxins and proinflammatory stimuli such as polyinosine-polycytidine (poly(IC)), lipopolysaccharides (LPS), peptidoglycan (PGN), flagellin, or lipid A activate MAP4K2 by promoting its autophosphorylation.
UniProtKB/Swiss-Prot Function:
Serine/threonine-protein kinase which acts as an essential component of the MAP kinase signal transduction pathway. Acts as a MAPK kinase kinase kinase (MAP4K) and is an upstream activator of the stress-activated protein kinase/c-Jun N-terminal kinase (SAP/JNK) signaling pathway and to a lesser extent of the p38 MAPKs signaling pathway. Required for the efficient activation of JNKs by TRAF6-dependent stimuli, including pathogen-associated molecular patterns (PAMPs) such as polyinosine-polycytidine (poly(IC)), lipopolysaccharides (LPS), lipid A, peptidoglycan (PGN), or bacterial flagellin. To a lesser degree, IL-1 and engagement of CD40 also stimulate MAP4K2-mediated JNKs activation. The requirement for MAP4K2/GCK is most pronounced for LPS signaling, and extends to LPS stimulation of c-Jun phosphorylation and induction of IL-8. Enhances MAP3K1 oligomerization, which may relieve N-terminal mediated MAP3K1 autoinhibition and lead to activation following autophosphorylation. Mediates also the SAP/JNK signaling pathway and the p38 MAPKs signaling pathway through activation of the MAP3Ks MAP3K10/MLK2 and MAP3K11/MLK3. May play a role in the regulation of vesicle targeting or fusion. regulation of vesicle targeting or fusion.

Enzyme Numbers (IUBMB) for MAP4K2 Gene

Phenotypes From GWAS Catalog for MAP4K2 Gene

Gene Ontology (GO) - Molecular Function for MAP4K2 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0000166 nucleotide binding IEA --
GO:0004672 protein kinase activity IEA --
GO:0004674 protein serine/threonine kinase activity IDA,IEA 11784851
GO:0005515 protein binding IPI 11784851
GO:0005524 ATP binding IDA,IEA 11784851
genes like me logo Genes that share ontologies with MAP4K2: view
genes like me logo Genes that share phenotypes with MAP4K2: view

Animal Models for MAP4K2 Gene

MGI Knock Outs for MAP4K2:

Animal Model Products

Clone Products

No data available for Human Phenotype Ontology , Transcription Factor Targets and HOMER Transcription for MAP4K2 Gene

Localization for MAP4K2 Gene

Subcellular locations from UniProtKB/Swiss-Prot for MAP4K2 Gene

Cytoplasm. Basolateral cell membrane; Peripheral membrane protein. Golgi apparatus membrane; Peripheral membrane protein.

Subcellular locations from

Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for MAP4K2 gene
Compartment Confidence
golgi apparatus 5
plasma membrane 4
cytosol 3
cytoskeleton 1
peroxisome 1
nucleus 1

Subcellular locations from the

Human Protein Atlas (HPA)

Gene Ontology (GO) - Cellular Components for MAP4K2 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0000139 Golgi membrane IEA --
GO:0005622 intracellular IEA --
GO:0005623 cell IEA --
GO:0005737 cytoplasm IBA --
GO:0005794 Golgi apparatus IEA --
genes like me logo Genes that share ontologies with MAP4K2: view

Pathways & Interactions for MAP4K2 Gene

genes like me logo Genes that share pathways with MAP4K2: view

Pathways by source for MAP4K2 Gene

1 Cell Signaling Technology pathway for MAP4K2 Gene
1 KEGG pathway for MAP4K2 Gene
2 GeneGo (Thomson Reuters) pathways for MAP4K2 Gene
4 Qiagen pathways for MAP4K2 Gene

SIGNOR curated interactions for MAP4K2 Gene

Is activated by:
Is inactivated by:

Gene Ontology (GO) - Biological Process for MAP4K2 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0000165 MAPK cascade IEA --
GO:0000185 activation of MAPKKK activity IEA --
GO:0002376 immune system process IEA --
GO:0006468 protein phosphorylation IEA,IDA 11784851
GO:0006903 vesicle targeting IEA --
genes like me logo Genes that share ontologies with MAP4K2: view

Drugs & Compounds for MAP4K2 Gene

(8) Drugs for MAP4K2 Gene - From: HMDB and Novoseek

Name Status Disease Links Group Role Mechanism of Action Clinical Trials
Magnesium Approved Nutra 0
ATP Investigational Nutra Agonist 0

(5) Additional Compounds for MAP4K2 Gene - From: Novoseek and HMDB

Name Synonyms Role CAS Number PubChem IDs PubMed IDs
  • Adenosindiphosphorsaeure
  • Adenosine 5'-pyrophosphate
  • Adenosine diphosphate
  • Adenosine pyrophosphate
  • Adenosine-5'-diphosphate
Full agonist, Agonist 58-64-0
genes like me logo Genes that share compounds with MAP4K2: view

Transcripts for MAP4K2 Gene

Unigene Clusters for MAP4K2 Gene

Mitogen-activated protein kinase kinase kinase kinase 2:
Representative Sequences:

Clone Products

Alternative Splicing Database (ASD) splice patterns (SP) for MAP4K2 Gene

ExUns: 1 ^ 2 ^ 3 ^ 4 ^ 5 ^ 6 ^ 7 ^ 8 ^ 9 ^ 10 ^ 11 ^ 12 ^ 13a · 13b ^ 14 ^ 15 ^ 16 ^ 17 ^ 18 ^ 19a · 19b ^ 20 ^ 21 ^ 22 ^ 23 ^ 24 ^
SP1: -

ExUns: 25 ^ 26 ^ 27a · 27b ^ 28a · 28b ^ 29 ^ 30 ^ 31 ^ 32a · 32b
SP3: - -

Relevant External Links for MAP4K2 Gene

GeneLoc Exon Structure for
ECgene alternative splicing isoforms for

Expression for MAP4K2 Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for MAP4K2 Gene

mRNA expression in embryonic tissues and stem cells from LifeMap Discovery

mRNA differential expression in normal tissues according to GTEx for MAP4K2 Gene

This gene is overexpressed in Whole Blood (x4.7).

Protein differential expression in normal tissues from HIPED for MAP4K2 Gene

This gene is overexpressed in Peripheral blood mononuclear cells (31.4) and Lymph node (13.6).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, PaxDb, MaxQB, and MOPED for MAP4K2 Gene

Protein tissue co-expression partners for MAP4K2 Gene

NURSA nuclear receptor signaling pathways regulating expression of MAP4K2 Gene:


SOURCE GeneReport for Unigene cluster for MAP4K2 Gene:


mRNA Expression by UniProt/SwissProt for MAP4K2 Gene:

Tissue specificity: Highly expressed in germinal center but not mantle zone B-cells. Also expressed in lung, brain and placenta and at lower levels in other tissues examined.

Evidence on tissue expression from TISSUES for MAP4K2 Gene

  • Liver(4.1)
genes like me logo Genes that share expression patterns with MAP4K2: view

No data available for Phenotype-based relationships between genes and organs from Gene ORGANizer for MAP4K2 Gene

Orthologs for MAP4K2 Gene

This gene was present in the common ancestor of animals and fungi.

Orthologs for MAP4K2 Gene

Organism Taxonomy Gene Similarity Type Details
(Pan troglodytes)
Mammalia MAP4K2 33 34
  • 99.8 (n)
(Bos Taurus)
Mammalia MAP4K2 33 34
  • 91.79 (n)
(Canis familiaris)
Mammalia MAP4K2 33 34
  • 91.05 (n)
(Mus musculus)
Mammalia Map4k2 33 16 34
  • 87.6 (n)
(Rattus norvegicus)
Mammalia Map4k2 33
  • 86.02 (n)
(Ornithorhynchus anatinus)
Mammalia MAP4K2 34
  • 58 (a)
(Danio rerio)
Actinopterygii zgc:136354 33
  • 62.6 (n)
map4k2l 34 34
  • 55 (a)
MAP4K2 (2 of 3) 34
  • 54 (a)
fruit fly
(Drosophila melanogaster)
Insecta CG7097 35
  • 57 (a)
hppy 34
  • 32 (a)
(Caenorhabditis elegans)
Secernentea gck-2 34
  • 39 (a)
baker's yeast
(Saccharomyces cerevisiae)
Saccharomycetes KIC1 34
  • 18 (a)
sea squirt
(Ciona savignyi)
Ascidiacea -- 34
  • 43 (a)
Species where no ortholog for MAP4K2 was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • chicken (Gallus gallus)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • lizard (Anolis carolinensis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • oppossum (Monodelphis domestica)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • tropical clawed frog (Silurana tropicalis)
  • wheat (Triticum aestivum)

Evolution for MAP4K2 Gene

Gene Tree for MAP4K2 (if available)
Gene Tree for MAP4K2 (if available)

Paralogs for MAP4K2 Gene

Paralogs for MAP4K2 Gene

genes like me logo Genes that share paralogs with MAP4K2: view

Variants for MAP4K2 Gene

Sequence variations from dbSNP and Humsavar for MAP4K2 Gene

SNP ID Clin Chr 11 pos Variation AA Info Type
rs1033303123 uncertain-significance, Multiple endocrine neoplasia, type 1 64,804,746(-) TCCTCGCCCCACGGCTCCTCG/TCCTCG upstream_transcript_variant
rs104894259 pathogenic, Hereditary cancer-predisposing syndrome, Multiple endocrine neoplasia, type 1, not provided 64,805,078(-) A/G/T upstream_transcript_variant
rs104894260 pathogenic, Multiple endocrine neoplasia, type 1, not provided 64,805,077(-) C/T upstream_transcript_variant
rs104894261 pathogenic, likely-pathogenic, Multiple endocrine neoplasia, type 1, not provided, Hereditary cancer-predisposing syndrome, Metastatic pancreatic neuroendocrine tumours 64,804,588(-) G/A upstream_transcript_variant
rs104894264 pathogenic, Hereditary cancer-predisposing syndrome, not provided, Multiple endocrine neoplasia, type 1 64,805,132(-) C/A/G/T upstream_transcript_variant

Structural Variations from Database of Genomic Variants (DGV) for MAP4K2 Gene

Variant ID Type Subtype PubMed ID
dgv153n27 CNV loss 19166990
dgv1965n54 CNV loss 21841781
dgv1967n54 CNV loss 21841781
dgv1968n54 CNV loss 21841781
dgv72n21 CNV loss 19592680
nsv469962 CNV loss 18288195
nsv528506 CNV loss 19592680
nsv832189 CNV loss 17160897
nsv951013 CNV deletion 24416366

Variation tolerance for MAP4K2 Gene

Residual Variation Intolerance Score: 41.1% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 3.82; 58.53% of all genes are more intolerant (likely to be disease-causing)

Additional Variant Information for MAP4K2 Gene

SNPedia medical, phenotypic, and genealogical associations of SNPs for

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for MAP4K2 Gene

Disorders for MAP4K2 Gene

MalaCards: The human disease database

(1) MalaCards diseases for MAP4K2 Gene - From: DISEASES

Disorder Aliases PubMed IDs
cerebral cavernous malformations 2
  • cavernous angiomatous malformations
- elite association - COSMIC cancer census association via MalaCards

Additional Disease Information for MAP4K2

Genetic Association Database
Human Genome Epidemiology Navigator
ATLAS of Genetics and Cytogenetics in Oncology and Haematology
genes like me logo Genes that share disorders with MAP4K2: view

No data available for UniProtKB/Swiss-Prot and Genatlas for MAP4K2 Gene

Publications for MAP4K2 Gene

  1. Differential expression of a novel protein kinase in human B lymphocytes. Preferential localization in the germinal center. (PMID: 7515885) Katz P … Kehrl JH (The Journal of biological chemistry 1994) 2 3 4 22 58
  2. Dissection of a signaling pathway by which pathogen-associated molecular patterns recruit the JNK and p38 MAPKs and trigger cytokine release. (PMID: 17584736) Zhong J … Kyriakis JM (The Journal of biological chemistry 2007) 3 4 22 58
  3. Direct activation of mitogen-activated protein kinase kinase kinase MEKK1 by the Ste20p homologue GCK and the adapter protein TRAF2. (PMID: 11784851) Chadee DN … Kyriakis JM (Molecular and cellular biology 2002) 3 4 22 58
  4. Tumor necrosis factor signaling to stress-activated protein kinase (SAPK)/Jun NH2-terminal kinase (JNK) and p38. Germinal center kinase couples TRAF2 to mitogen-activated protein kinase/ERK kinase kinase 1 and SAPK while receptor interacting protein associates with a mitogen-activated protein kinase kinase kinase upstream of MKK6 and p38. (PMID: 9712898) Yuasa T … Kyriakis JM (The Journal of biological chemistry 1998) 3 4 22 58
  5. Activation of the SAPK pathway by the human STE20 homologue germinal centre kinase. (PMID: 7477268) Pombo CM … Kyriakis JM (Nature 1995) 3 4 22 58

Products for MAP4K2 Gene

Sources for MAP4K2 Gene

Loading form....