Set Analyses:
Advanced Search

Advanced Search

 
Search By
Section (entire)
for


 



MAP3K9 Gene

protein-coding   GIFtS: 62
GCID: GC14M071189

Mitogen-Activated Protein Kinase Kinase Kinase 9


(Previous symbol: MLK1)
  Search for MAP3K9
at  

(According to 1HGNC, 2Entrez Gene,
3UniProtKB/Swiss-Prot, 4UniProtKB/TrEMBL, 5OMIM, 6GeneLoc, 7Ensembl, 8DME, 9miRBase, 10fRNAdb, 12H-InvDB, 13NCBI, 14NONCODE, and/or 15RNAdb)
About This Section

TryGeneCards Plus

Aliases
Mitogen-Activated Protein Kinase Kinase Kinase 91 2     MEKK92
MLK11 2 3 5     Mixed Lineage Kinase 1 (Tyr And Ser/Thr Specificity)2
PRKE12 3     Mixed Lineage Kinase 13
EC 2.7.11.253 8     EC 2.7.118

External Ids:    HGNC: 68611   Entrez Gene: 42932   Ensembl: ENSG000000064327   OMIM: 6001365   UniProtKB: P801923   

Export aliases for MAP3K9 gene to outside databases

Previous GC identifers: GC14M068701 GC14M064991 GC14M069184 GC14M070264 GC14M071194 GC14M051363


(According to Entrez Gene, GeneCards, Tocris Bioscience, Wikipedia's Gene Wiki, PharmGKB,
UniProtKB/Swiss-Prot, and/or UniProtKB/TrEMBL)
About This Section

TryGeneCards Plus

GeneCards Summary for MAP3K9 Gene:
MAP3K9 (mitogen-activated protein kinase kinase kinase 9) is a protein-coding gene. GO annotations related to this gene include protein tyrosine kinase activity and protein homodimerization activity. An important paralog of this gene is FPGT-TNNI3K.

UniProtKB/Swiss-Prot: M3K9_HUMAN, P80192
Function: Serine/threonine kinase which acts as an essential component of the MAP kinase signal transduction
pathway. Plays an important role in the cascades of cellular responses evoked by changes in the environment. Once
activated, acts as an upstream activator of the MKK/JNK signal transduction cascade through the phosphorylation
of MAP2K4/MKK4 and MAP2K7/MKK7 which in turn activate the JNKs. The MKK/JNK signaling pathway regulates stress
response via activator protein-1 (JUN) and GATA4 transcription factors. Plays also a role in mitochondrial death
signaling pathway, including the release cytochrome c, leading to apoptosis

Gene Wiki entry for MAP3K9 Gene


(According to GeneLoc and/or HGNC, and/or
Entrez Gene (NCBI build 37),
and/or miRBase,
Genomic Views according to UCSC (hg19) and Ensembl (release 75), Regulatory elements and Epigenetics data according to QIAGEN, and/or SwitchGear Genomics)
About This Section

TryGeneCards Plus
RefSeq DNA sequence at NCBI GenBank:
NC_000014.8  NT_026437.13  NC_018925.2  
Regulatory elements:
   Regulatory transcription factor binding sites in the MAP3K9 gene promoter:
         SRF   c-Fos   AP-1   SRF (504 AA)   ATF-2   c-Jun   Arnt   
         Other transcription factors

SwitchGear Promoter luciferase reporter plasmidMAP3K9 promoter sequence
   Search Chromatin IP Primers for MAP3K9

Epigenetics:
DNA Methylation CpG Assay Predesigned for Pyrosequencing in human, mouse, rat MAP3K9


Genomic Location:
Genomic View: UCSC Golden Path with GeneCards custom track

Entrez Gene cytogenetic band: 14q24.2   Ensembl cytogenetic band:  14q24.2   HGNC cytogenetic band: 14q24.2

MAP3K9 Gene in genomic location: bands according to Ensembl, locations according to (and/or Entrez Gene and/or Ensembl if different)
MAP3K9 gene location

GeneLoc information about chromosome 14         GeneLoc Exon Structure

GeneLoc location for GC14M071189:  view genomic region     (about GC identifiers)

Start:
71,189,243 bp from pter      End:
71,276,251 bp from pter
Size:
87,009 bases      Orientation:
minus strand

(According to 1UniProtKB, HORDE, 2neXtProt, Ensembl, and/or Reactome, Modification sites according to PhosphoSitePlus, Specific Peptides from DME, RefSeq according to NCBI, PDB rendering according to OCA and/or Proteopedia, Recombinant Proteins from EMD Millipore, R&D Systems, GenScript, Enzo Life Sciences, OriGene, Novus Biologicals, Sino Biological, ProSpec, Cloud-Clone Corp., and/or eBioscience,
Biochemical Assays by EMD Millipore, R&D Systems, OriGene, GenScript, Cell Signaling Technology, Enzo Life Sciences, Cloud-Clone Corp., and/or eBioscience, Antibodies by EMD Millipore, R&D Systems, Cell Signaling Technology, OriGene, Novus Biologicals, Thermo Fisher Scientific, LSBio, Abcam, Cloud-Clone Corp, and/or others.)
About This Section

TryGeneCards Plus

UniProtKB/Swiss-Prot: M3K9_HUMAN, P80192 (See protein sequence)
Recommended Name: Mitogen-activated protein kinase kinase kinase 9  
Size: 1104 amino acids; 121895 Da
Cofactor: Magnesium
Subunit: Homodimer (By similarity)
Sequence caution: Sequence=AAI11408.1; Type=Erroneous initiation; Note=Translation N-terminally extended;
1 PDB 3D structure from and Proteopedia for MAP3K9:
3DTC (3D)    
Secondary accessions: A3KN85 Q0D2G7 Q6EH31 Q9H2N5
Alternative splicing: 2 isoforms:  P80192-1   P80192-4   

Explore the universe of human proteins at neXtProt for MAP3K9: NX_P80192

Explore proteomics data for MAP3K9 at MOPED

Post-translational modifications: 

  • Autophosphorylation on serine and threonine residues within the activation loop plays a role in enzyme activation.
    Thr-312 is likely to be the main autophosphorylation site. Autophosphorylation also occurs on Thr-304 and Ser-3081
  • Modification sites at neXtProt
  • Modification sites at PhosphoSitePlus
  • Selected DME Specific Peptides for MAP3K9 (P80192) (see all 11)
     FPRLPDP  SGDEGWW  WMAPEVI  LRAKEKEL 


    See MAP3K9 Protein Expression from SPIRE MOPED, PaxDB, and MaxQB

    REFSEQ proteins (4 alternative transcripts): 
    NP_001271159.1  NP_001271160.1  NP_001271161.1  NP_149132.2  

    ENSEMBL proteins: 
     ENSP00000451612   ENSP00000451263   ENSP00000451038   ENSP00000370649   ENSP00000451921  

    MAP3K9 Human Recombinant Protein Products:

    EMD Millipore Purified and/or Recombinant MAP3K9 Protein
    Browse R&D Systems for human recombinant proteins
    Browse recombinant and purified proteins available from Enzo Life Sciences
    Browse OriGene full length recombinant human proteins expressed in human HEK293 cells
    OriGene Protein Over-expression Lysate for MAP3K9
    OriGene Custom MassSpec
    OriGene Custom Protein Services for MAP3K9
    GenScript Custom Purified and Recombinant Proteins Services for MAP3K9
    Novus Biologicals MAP3K9 Protein
    Novus Biologicals MAP3K9 Lysate
    Browse Sino Biological Recombinant Proteins
    Browse Sino Biological Cell Lysates
    Browse ProSpec Recombinant Proteins
    Cloud-Clone Corp. Proteins for MAP3K9

     
    Search eBioscience for Proteins for MAP3K9 

    MAP3K9 Antibody Products:

    EMD Millipore Mono- and Polyclonal Antibodies for the study of MAP3K9
    Browse R&D Systems for Antibodies
    Cell Signaling Technology (CST) Antibodies for MAP3K9  (MLK1)
    OriGene Antibodies for MAP3K9
    OriGene Custom Antibody Services for MAP3K9
    Novus Biologicals MAP3K9 Antibodies
    Abcam antibodies for MAP3K9 (Q02779, P80192)
    Cloud-Clone Corp. Antibodies for MAP3K9
    ThermoFisher Antibodies for MAP3K9
    LSBio Antibodies in human, mouse, rat for MAP3K9

    MAP3K9 Assay Products:

    Browse Kits and Assays available from EMD Millipore
    OriGene Custom Assay Services for MAP3K9
    Browse R&D Systems for biochemical assays
    GenScript Custom Assay Services for MAP3K9
    Browse Enzo Life Sciences for kits & assays
    Cloud-Clone Corp. ELISAs for MAP3K9
    Cloud-Clone Corp. CLIAs for MAP3K9
    Search eBioscience for ELISAs for MAP3K9 


    (According to HGNC, IUPHAR, InterPro, ProtoNet, UniProtKB, and/or BLOCKS, Sets of similar genes according to GeneDecks)
    About This Section

    TryGeneCards Plus
    HGNC Gene Families:
    MAP3K: Mitogen-activated protein kinase cascade / Kinase kinase kinases

    IUPHAR Guide to PHARMACOLOGY protein family classification: mitogen-activated protein kinase kinase kinase 9
    MLK subfamily

    Selected InterPro protein domains (see all 9):
     IPR017441 Protein_kinase_ATP_BS
     IPR016231 MAPKKK9/10/11
     IPR011009 Kinase-like_dom
     IPR008271 Ser/Thr_kinase_AS
     IPR001452 SH3_domain

    Graphical View of Domain Structure for InterPro Entry P80192

    ProtoNet protein and cluster: P80192

    UniProtKB/Swiss-Prot: M3K9_HUMAN, P80192
    Similarity: Belongs to the protein kinase superfamily. STE Ser/Thr protein kinase family. MAP kinase kinase kinase
    subfamily
    Similarity: Contains 1 protein kinase domain
    Similarity: Contains 1 SH3 domain


    Find genes that share domains with MAP3K9           About GenesLikeMe


    (According to 1UniProtKB, Genatlas, LifeMap Discovery™, IUBMB, and/or 2DME, Human phenotypes from GenomeRNAi, Animal models from MGI Mar 06 2013, inGenious Targeting Laboratory, genOway,
    transcription factor targeting from QIAGEN and/or HOMER, miRNA Gene Targets from miRTarBase, shRNA from OriGene, siRNAs from OriGene, QIAGEN, microRNA from QIAGEN, SwitchGear Genomics, Gene Editing from DNA2.0, Clones from OriGene, GenScript, Sino Biological, DNA2.0, Vector BioLabs and/or Addgene, Cell Lines from GenScript, ESI BIO, In Situ Hybridization Assays from Advanced Cell Diagnostics, Flow cytometry from eBioscience, Ontologies according to Gene Ontology Consortium 01 Apr 2014 via Entrez Gene.)
    About This Section

    TryGeneCards Plus

    Molecular Function:

         UniProtKB/Swiss-Prot Summary: M3K9_HUMAN, P80192
    Function: Serine/threonine kinase which acts as an essential component of the MAP kinase signal transduction
    pathway. Plays an important role in the cascades of cellular responses evoked by changes in the environment. Once
    activated, acts as an upstream activator of the MKK/JNK signal transduction cascade through the phosphorylation
    of MAP2K4/MKK4 and MAP2K7/MKK7 which in turn activate the JNKs. The MKK/JNK signaling pathway regulates stress
    response via activator protein-1 (JUN) and GATA4 transcription factors. Plays also a role in mitochondrial death
    signaling pathway, including the release cytochrome c, leading to apoptosis
    Catalytic activity: ATP + a protein = ADP + a phosphoprotein
    Enzyme regulation: Homodimerization via the leucine zipper domains is required for autophosphorylation of multiple
    sites in the activation loop and subsequent activation. Autophosphorylation at Thr-312 is the key step in
    activation of MAP3K9/MLK1 and is required for full phosphorylation. Autophosphorylation at Thr-304 and Ser-308
    have been shown to be of secondary importance in the activation of MAP3K9/MLK1. CEP-1347 and many indolocarbazole
    analogs have been shown to act as inhibitors of MAP3K9/MLK1 activity
    Biophysicochemical properties: Kinetic parameters: KM=62 uM for ATP; KM=7 uM for myelin basic protein (MBP) as
    substrate;

         Genatlas biochemistry entry for MAP3K9:
    mitogen activated protein (MAP/ERK) kinase kinase kinase 9

         Enzyme Numbers (IUBMB): EC 2.7.11.251 2 EC 2.7.112

         Gene Ontology (GO): Selected molecular function terms (see all 10):    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0004672protein kinase activity ----
    GO:0004674protein serine/threonine kinase activity IDA15610029
    GO:0004706JUN kinase kinase kinase activity ISS--
    GO:0004708MAP kinase kinase activity NAS8477742
    GO:0004709MAP kinase kinase kinase activity ----
         
    Find genes that share ontologies with MAP3K9           About GenesLikeMe


    Phenotypes:
         3 GenomeRNAi human phenotypes for MAP3K9:
     Decreased focal adhesion (FA)   Decreased substrate adherent c  Increased colony dispersion (i 

         8 MGI mutant phenotypes (inferred from 1 allele(MGI details for Map3k9):
     digestive/alimentary  embryogenesis  mortality/aging  muscle  nervous system 
     normal  renal/urinary system  reproductive system 

    Find genes that share phenotypes with MAP3K9           About GenesLikeMe

    Animal Models:
       inGenious Targeting Laboratory: Let us create your new Knockout/Knockin mouse model for MAP3K9
       inGenious Targeting Laboratory: Contact us about creating complex and humanized mouse models for MAP3K9

       genOway customized KO model: permanent, tissue-specific or time-controlled inactivation for MAP3K9
       genOway customized Knockin model: humanization, point mutation, expression monitoring, etc. for MAP3K9

    miRNA
    Products:
        
    miRTarBase miRNAs that target MAP3K9:
    hsa-mir-17-5p (MIRT051042), hsa-mir-34a-5p (MIRT005606), hsa-mir-339-5p (MIRT042797)

    Block miRNA regulation of human, mouse, rat MAP3K9 using miScript Target Protectors
    Selected qRT-PCR Assays for microRNAs that regulate MAP3K9 (see all 62):
    hsa-miR-328 hsa-miR-361-5p hsa-miR-1197 hsa-miR-188-5p hsa-miR-15a hsa-miR-106a hsa-miR-301a hsa-miR-519a
    SwitchGear 3'UTR luciferase reporter plasmidMAP3K9 3' UTR sequence
    Inhib. RNA
    Products:
        
    OriGene RNAi products in human, mouse, rat for MAP3K9
    Predesigned siRNA for gene silencing in human, mouse, rat MAP3K9

    Gene Editing
    Products:
    DNA2.0 Custom Protein Engineering Service for MAP3K9

    Clone
    Products:
         
    OriGene clones in human, mouse for MAP3K9 (see all 7)
    OriGene ORF clones in mouse, rat for MAP3K9
    OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
    GenScript: all cDNA clones in your preferred vector: MAP3K9 (NM_033141)
    Browse Sino Biological Human cDNA Clones
    DNA2.0 Custom Codon Optimized Gene Synthesis Service for MAP3K9
    Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat MAP3K9

    Cell Line
    Products:
         
    GenScript Custom overexpressing Cell Line Services for MAP3K9
    Browse ESI BIO Cell Lines and PureStem Progenitors for MAP3K9 
    In Situ Assay
    Products:
       

     
    Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for MAP3K9


    (According to UniProtKB, COMPARTMENTS Subcellular localization database, Ontologies according to Gene Ontology Consortium 01 Apr 2014 via Entrez Gene.)
    About This Section

    TryGeneCards Plus

    Subcellular locations from COMPARTMENTS: 

    CompartmentConfidence
    cytosol3
    endoplasmic reticulum1
    extracellular1
    golgi apparatus1
    peroxisome1
    plasma membrane1

    Gene Ontology (GO): 1 cellular component term:    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0005575cellular_component ND--

    Find genes that share ontologies with MAP3K9           About GenesLikeMe


    (SuperPaths according to PathCards, Pathways according to R&D Systems, Cell Signaling Technology, KEGG, PharmGKB, BioSystems, Sino Biological, Reactome, Tocris Bioscience, GeneGo (Thomson Reuters), QIAGEN, and/or UniProtKB, Sets of similar genes according to GeneDecks, Interaction Networks according to QIAGEN, and/or STRING, Interactions according to 1UniProtKB, 2MINT, 3I2D, and/or 4STRING, with links to IntAct and Ensembl, Ontologies according to Gene Ontology Consortium 01 Apr 2014 via Entrez Gene).
    About This Section

    TryGeneCards Plus

    SuperPaths for MAP3K9 About   (see all 10)  
    See pathways by source

    SuperPathContained pathways About
    1TGF-Beta Pathway
    MAPK Family Pathway0.60
    JNK Pathway0.51
    2ERK Signaling
    Rho Family GTPases0.61
    3PEDF Induced Signaling
    STAT3 Pathway0.47
    4NFAT and Cardiac Hypertrophy
    NFAT and Cardiac Hypertrophy0.42
    5ErbB4 Pathway
    PACAP Signaling0.37


    Find genes that share SuperPaths with MAP3K9           About GenesLikeMe

    Pathways by source                                                                                                                                                                 See SuperPaths
    Show all pathways

    Selected Downloadable PowerPoint Slides of GeneGlobe Pathway Central Maps for MAP3K9 (see all 8)
        STAT3 Pathway
    JNK Pathway
    TNFR2 Pathway
    NFAT and Cardiac Hypertrophy
    MAPK Family Pathway

    1 Cell Signaling Technology (CST) Pathway for MAP3K9
        MAP Kinase Signaling

    2 BioSystems Pathways for MAP3K9
        Insulin Signaling
    p38 MAPK Signaling Pathway


        Custom Pathway & Disease-focused RT2 Profiler PCR Arrays for MAP3K9
    Interactions:

        GeneGlobe Interaction Network for MAP3K9

    2 Interacting proteins for MAP3K9 (P801921, 3) via UniProtKB, MINT, STRING, and/or I2D
    InteractantInteraction Details
    GeneCardExternal ID(s)
    SH3RF1Q7Z6J03I2D: score=1 
    HSP90AB1P082381EBI-3951604,EBI-352572
    About this table

    Gene Ontology (GO): Selected biological process terms (see all 10):    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0006351transcription, DNA-templated IEA--
    GO:0006355regulation of transcription, DNA-templated IEA--
    GO:0006468protein phosphorylation IDA15610029
    GO:0006915apoptotic process IEA--
    GO:0007256activation of JNKK activity ISS--

    Find genes that share ontologies with MAP3K9           About GenesLikeMe



    (Chemical Compounds according to UniProtKB, Enzo Life Sciences, EMD Millipore, Tocris Bioscience, ApexBio, HMDB, BitterDB, and/or Novoseek, Ligands according to IUPHAR, and Drugs according to DrugBank, Enzo Life Sciences, and/or PharmGKB)
    About This Section

    TryGeneCards Plus
    Browse Small Molecules at EMD Millipore
       Browse drugs & compounds from Enzo Life Sciences
      Browse compounds at ApexBio 

    Browse Tocris compounds for MAP3K9 (M3K9)

    3 HMDB Compounds for MAP3K9    About this table
    CompoundSynonyms CAS #PubMed Ids
    ADPadenosindiphosphorsaeure (see all 8)58-64-0--
    Adenosine triphosphate5'-(tetrahydrogen triphosphate) Adenosine (see all 24)56-65-5--
    MagnesiumMagnesium (see all 2)7439-95-4--

    1 DrugBank Compound for MAP3K9    About this table
    CompoundSynonyms CAS #TypeActionsPubMed Ids
    12-(2-hydroxyethyl)-2-(1-methylethoxy)-13,14-dihydronaphtho[2,1-a]pyrrolo[3,4-c]carbazol-5(12H)-one-- --target--10592235



    (Secondary structures according to fRNAdb,
    GenBank/EMBL/DDBJ Accessions according to
    Unigene (Build 236 Homo sapiens; Apr 25 2013) or GenBank,
    RefSeq according to Entrez Gene,
    DOTS (version 10), and/or AceView, transcript ids from Ensembl with links to UCSC,
    exon structure from GeneLoc, alternative splicing isoforms according to ASD and/or ECgene,
    siRNAs from OriGene, QIAGEN, shRNA from OriGene, microRNA from QIAGEN, SwitchGear Genomics,
    Tagged/untagged cDNA clones from OriGene, GenScript, DNA2.0, Vector BioLabs, and/or Addgene, Primers from OriGene, and/or QIAGEN, Flow cytometry from eBioscience )
    About This Section

    TryGeneCards Plus

    REFSEQ mRNAs for MAP3K9 gene (4 alternative transcripts): 
    NM_001284230.1  NM_001284231.1  NM_001284232.1  NM_033141.3  

    Unigene Clusters for MAP3K9:

    Mitogen-activated protein kinase kinase kinase 9
    Hs.445496  [show with all ESTs], Hs.593542  [show with all ESTs]
    Unigene Representative Sequences: AK123430, NM_033141
    6 Ensembl transcripts including schematic representations, and UCSC links where relevant:
    ENST00000554752(uc010ttk.2 uc001xmk.3 uc001xml.3 uc001xmm.3)
    ENST00000555993 ENST00000553414 ENST00000381250 ENST00000554146 ENST00000554024

    miRNA
    Products:
         
    Block miRNA regulation of human, mouse, rat MAP3K9 using miScript Target Protectors
    Selected qRT-PCR Assays for microRNAs that regulate MAP3K9 (see all 62):
    hsa-miR-328 hsa-miR-361-5p hsa-miR-1197 hsa-miR-188-5p hsa-miR-15a hsa-miR-106a hsa-miR-301a hsa-miR-519a
    SwitchGear 3'UTR luciferase reporter plasmidMAP3K9 3' UTR sequence
    Inhib. RNA
    Products:
         
    OriGene RNAi products in human, mouse, rat for MAP3K9
    Predesigned siRNA for gene silencing in human, mouse, rat MAP3K9
    Clone
    Products:
         
    OriGene clones in human, mouse for MAP3K9 (see all 7)
    OriGene ORF clones in mouse, rat for MAP3K9
    OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
    GenScript: all cDNA clones in your preferred vector: MAP3K9 (NM_033141)
    DNA2.0 Custom Codon Optimized Gene Synthesis Service for MAP3K9
    Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat MAP3K9
    Primer
    Products:
        
    OriGene qSTAR qPCR primer pairs in human, mouse for MAP3K9
    Pre-validated RT2 qPCR Primer Assay in human, mouse, rat MAP3K9
      QuantiTect SYBR Green Assays in human, mouse, rat MAP3K9
      QuantiFast Probe-based Assays in human, mouse, rat MAP3K9

    Additional mRNA sequence: 

    AF251442.1 AK091645.1 AK294571.1 AK299727.1 AK302849.1 AY327900.1 BC033197.1 BC040716.2 
    BC043010.2 BC111407.1 BC133706.1 BX648924.1 

    10 DOTS entries:

    DT.40191219  DT.97779811  DT.97794270  DT.40262434  DT.100745061  DT.40108218  DT.120766806  DT.120766813 
    DT.40124432  DT.75146403 

    Selected AceView cDNA sequences (see all 50):

    F09502 BQ058771 Z44356 BE046942 BM678330 BU621599 CA422985 BM713410 
    BU621199 BQ012515 F07968 F03086 F04217 AI825637 BG325485 AA994720 
    F07969 AI189167 CF529239 AA868268 BX118545 AK123430 BX952109 AV753204 

    GeneLoc Exon Structure

    Selected Alternative Splicing Database (ASD) splice patterns (SP) for MAP3K9 (see all 6)    About this scheme

    ExUns: 1 ^ 2a · 2b ^ 3a · 3b ^ 4 ^ 5 ^ 6a · 6b ^ 7 ^ 8 ^ 9 ^ 10
    SP1:                                                                              
    SP2:                    -     -     -                                             
    SP3:                                -                                             
    SP4:                                                                              
    SP5:                                                                              


    ECgene alternative splicing isoforms for MAP3K9

    (RNA expression data according to H-InvDB, NONCODE, miRBase, and RNAdb, Expression images according to data from BioGPS, Illumina Human BodyMap, and CGAP SAGE, Sets of similar genes according to GeneDecks, in vivo and in vitro expression data from LifeMap Discovery™, Protein expression images according to data from SPIRE 1MOPED, 2PaxDb, and 3MaxQB, plus additional links to SOURCE, and/or BioGPS, and/or UniProtKB,
    PCR Arrays from QIAGEN, Primers from OriGene, and/or QIAGEN, In Situ Hybridization Assays from Advanced Cell Diagnostics)
    About This Section

    TryGeneCards Plus

    MAP3K9 expression in normal human tissues (normalized intensities)
    See probesets specificity/sensitivity at GeneAnnot
    About this imageBioGPS <intensity>2/3
    CGAP TAG: CTAGCAGGAA
    MAP3K9 Expression
    About this image


    MAP3K9 expression in embryonic tissues and stem cells    About this table
    Data from LifeMap, the Embryonic Development and Stem Cells Database
     selected tissues (see all 2) fully expand
     
     Inner Cell Mass (Early Embryonic Tissues)    fully expand to see all 2 entries
             hIPS1
     
     Pancreas (Endocrine System)
    MAP3K9 Protein expression data from MOPED1, PaxDb2 and MaxQB3    About this image

    MAP3K9 Protein Expression

    SOURCE GeneReport for Unigene clusters: Hs.445496 Hs.593542

    UniProtKB/Swiss-Prot: M3K9_HUMAN, P80192
    Tissue specificity: Expressed in epithelial tumor cell lines of colonic, breast and esophageal origin

        Custom PCR Arrays for MAP3K9
    Primer
    Products:
    OriGene qSTAR qPCR primer pairs in human, mouse for MAP3K9
    Pre-validated RT2 qPCR Primer Assay in human, mouse, rat MAP3K9
    QuantiTect SYBR Green Assays in human, mouse, rat MAP3K9
    QuantiFast Probe-based Assays in human, mouse, rat MAP3K9
    In Situ
    Assay Products:
     

     
    Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for MAP3K9

    (Orthologs according to 1,2HomoloGene (2older version, for species not in 1newer version), 3euGenes, 4SGD , 5MGI Mar 06 2013, with possible further links to Flybase and/or WormBase, and/or 6Ensembl pan taxonomic compara , Gene Trees according to Ensembl and TreeFam)
    About This Section

    TryGeneCards Plus

    This gene was present in the common ancestor of animals.

    Orthologs for MAP3K9 gene from Selected species (see all 15)    About this table
    Organism Taxonomic
    classification
    Gene Description Human
    Similarity
    Orthology
    Type
    Details
    mouse
    (Mus musculus)
    Mammalia Map3k91 , 5 mitogen-activated protein kinase kinase kinase 91, 5 90.41(n)1
    96.04(a)1
      12 (37.91 cM)5
    3383721  NM_001174107.11  NP_001167578.11 
     817149505 
    chicken
    (Gallus gallus)
    Aves LOC4257921 mitogen-activated protein kinase kinase kinase 9-like 76.83(n)
    83.7(a)
      425792  XM_003641351.2  XP_003641399.2 
    lizard
    (Anolis carolinensis)
    Reptilia MAP3K96
    mitogen-activated protein kinase kinase kinase 9
    75(a)
    1 ↔ 1
    1(37516058-37564958)
    African clawed frog
    (Xenopus laevis)
    Amphibia Xl.317562 Xenopus laevis, clone IMAGE5542423, mRNA 74.86(n)    BC045104.1 
    zebrafish
    (Danio rerio)
    Actinopterygii LOC5606391 mitogen-activated protein kinase kinase kinase 9-like 64.49(n)
    66.56(a)
      560639  XM_684036.3  XP_689128.2 
    fruit fly
    (Drosophila melanogaster)
    Insecta slpr6
    slipper
    31(a)
    1 → many
    X(8064408-8071187)


    ENSEMBL Gene Tree for MAP3K9 (if available)
    TreeFam Gene Tree for MAP3K9 (if available)

    (Paralogs according to 1HomoloGene,
    2Ensembl, and 3SIMAP, Pseudogenes according to 4Pseudogene.org Build 68)
    About This Section

    TryGeneCards Plus
    Paralogs for MAP3K9 gene
    FPGT-TNNI3K2  MAP3K122  MAP3K112  KIAA18042  RAF12  KSR22  KSR12  MOS2  
    BRAF2  MAP3K102  ARAF2  MAP3K72  TNNI3K2  ZAK2  MAP3K132  ILK2  
    Selected SIMAP similar genes for MAP3K9 using alignment to 4 protein entries:     M3K9_HUMAN (see all proteins) (see all similar genes):
    BRAF    MAP3K11    MAP3K10    ZAK    ITSN2    PKN2
    MAP3K12    MLK4    ARHGEF7    MAP3K13    MARK4    pk
    DKFZp686M05208    DKFZp564L2416    PRKCH    TXK    ITSN1    RPS6KA2

    Find genes that share paralogs with MAP3K9           About GenesLikeMe



    (SNPs/Variants according to the 1NCBI SNP Database, 2Ensembl, 3PupaSUITE, 4UniProtKB, and DNA2.0, Linkage Disequilibrium by HapMap, Structural Variations(CNVs/InDels/Inversions) from the Database of Genomic Variants, Mutations from the Human Gene Mutation Database (HGMD), the Human Cytochrome P450 Allele Nomenclature Database, and the Locus Specific Mutation Databases (LSDB), Blood group antigen gene mutations by BGMUT, Resequencing Primers, Cancer Mutation PCR Arrays and Assays, and Copy Number PCR Arrays from QIAGEN)
    About This Section

    TryGeneCards Plus

    Selected SNPs for MAP3K9 (see all 1725)    About this table                                 

    Genomic DataTranscription Related DataAllele Frequencies
    SNP IDValidClinical
    significance
    Chr 14 posSequence#AA
    Chg
    TypeMore#Allele
    freq
    PopTotal
    sample
    More
    ----------
    VAR_0406994
    A gastric adenocarcinoma sample4--see VAR_0406992 R C mis40--------
    VAR_0406984
    A metastatic melanoma sample4--see VAR_0406982 A V mis40--------
    rs711057361,2
    C--52257565(-) TTGCT-/TAAGTGATGGGGTAAAAAGAAGCAGA
    T
    /TTAAGTGATGGGGTAAAAAGAAGCAGA
    TATAT
    2 -- cds11NA 2
    rs1395087691,2
    C--71194731(+) GAGGGC/TCACAA 1 -- ds50010--------
    rs128795691,2
    C,F,H--71194774(+) ATGTGT/CTCATG 1 -- ds500136Minor allele frequency- C:0.16NS EA NA WA CSA 3308
    rs1502007341,2
    C--71194822(+) GCCAC-/AGAACAG 1 -- ds50010--------
    rs1876131601,2
    --71194890(+) CTGGAA/GTGCAA 1 -- ut310--------
    rs1912235871,2
    --71194914(+) GCTCAC/TTGCAA 1 -- ut310--------
    rs1822712641,2
    --71195098(+) TGCCTC/TCCAAA 1 -- ut310--------
    rs557249211,2
    C,F--71195130(+) GCCACC/TGCGCC 1 -- ut312Minor allele frequency- T:0.04WA NA 238

    HapMap Linkage Disequilibrium report for MAP3K9 (71189243 - 71276251 bp)

    Structural Variations
         Database of Genomic Variants (DGV) 2 variations for MAP3K9:    About this table    
    Variant IDTypeSubtypePubMed ID
    esv2748848CNV Deletion23290073
    nsv525761CNV Loss19592680

    Site Specific Mutation Identification with PCR Assays
    SeqTarget long-range PCR primers for resequencing MAP3K9
    DNA2.0 Custom Variant and Variant Library Synthesis for MAP3K9

    (in which this Gene is Involved, According to MalaCards, OMIM, UniProtKB, the University of Copenhagen DISEASES database, Genatlas, GeneTests, GAD, HuGE Navigator, and/or TGDB.)
    About This Section

    TryGeneCards Plus
    OMIM gene information: 600136    OMIM disorders: --

    UniProtKB/Swiss-Prot: M3K9_HUMAN, P80192
  • Note=May play a role in esophageal cancer susceptibility and/or development


  • Find genes that share disorders with MAP3K9           About GenesLikeMe

    Genetic Association Database (GAD): MAP3K9
    Human Genome Epidemiology (HuGE) Navigator: MAP3K9 (1 document)

    Export disorders for MAP3K9 gene to outside databases

    (in PubMed. Associations of this gene to articles via 1Entrez Gene, 2UniProtKB/Swiss-Prot, 3HGNC, 4GAD, 5PharmGKB, 6HMDB, 7DrugBank, 8UniProtKB/TrEMBL, 9 Novoseek, and/or 10fRNAdb)
    About This Section

    TryGeneCards Plus

    PubMed articles for MAP3K9 gene, integrated from 10 sources (see all 25):
    (articles sorted by number of sources associating them with MAP3K9)
        Utopia: connect your pdf to the dynamic
    world of online information

    1. Phosphoregulation of mixed-lineage kinase 1 activity by multiple phosphorylation in the activation loop. (PubMed id 15610029)1, 2, 9 Durkin J.T.... Meyer S.L. (Biochemistry 2004)
    2. Genome-wide pharmacogenomic study of neurocognition as an indicator of antipsychotic treatment response in schizophrenia. (PubMed id 21107309)1, 4 McClay J.L....van den Oord E.J. (Neuropsychopharmacology 2011)
    3. Personalized smoking cessation: interactions between nicotine dose, dependence and quit-success genotype score. (PubMed id 20379614)1, 4 Rose J.E....Uhl G.R. (Mol. Med. 2010)
    4. The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). (PubMed id 15489334)1, 2 Gerhard D.S.... Malek J. (Genome Res. 2004)
    5. The MLK family mediates c-Jun N-terminal kinase activation in neuronal apoptosis. (PubMed id 11416147)1, 2 Xu Z.... Greene L.A. (Mol. Cell. Biol. 2001)
    6. Identification of a new family of human epithelial protein kinases containing two leucine/isoleucine-zipper domains. (PubMed id 8477742)1, 2 Dorow D.S.... de Kretser T. (Eur. J. Biochem. 1993)
    7. Targeted genetic dependency screen facilitates identification of actionable mutations in FGFR4, MAP3K9, and PAK5 in lung cancer. (PubMed id 23836671)1 Fawdar S....Brognard J. (Proc. Natl. Acad. Sci. U.S.A. 2013)
    8. Quantitative analysis of HSP90-client interactions reveals principles of substrate recognition. (PubMed id 22939624)1 Taipale M....Lindquist S. (Cell 2012)
    9. Frequent somatic mutations in MAP3K5 and MAP3K9 in metastatic melanoma identified by exome sequencing. (PubMed id 22197930)1 Stark M.S....Hayward N.K. (Nat. Genet. 2012)
    10. Genome-wide association study of alcohol dependence. (PubMed id 19581569)4 Treutlein J....Rietschel M. (Arch. Gen. Psychiatry 2009)

    (in PubMed, OMIM, and NCBI Bookshelf)
    About This Section

    TryGeneCards Plus
     ANDOR
    Aliases
    Free Text  

      Query String
    PubMed
    OMIM
    NCBI Bookshelf
      (Note: In FireFox, select the above section and copy using Ctrl-C)

    (According to Entrez Gene, HGNC, AceView, euGenes, Ensembl, miRBase, ECgene, Kegg, and/or H-InvDB)
    About This Section

    TryGeneCards Plus
    Entrez Gene: 4293 HGNC: 6861 AceView: MAP3K9.1 Ensembl:ENSG00000006432 euGenes: HUgn4293
    ECgene: MAP3K9 H-InvDB: MAP3K9

    (According to HUGE)
    About This Section

    TryGeneCards Plus
      --

    (According to PharmGKB, ATLAS, HORDE, IMGT, LEIDEN, UniProtKB/Swiss-Prot, UniProtKB/TrEMBL, and/or others, e.g. Wikipedia and GeneReviews, via UniProtKB/Swiss-Prot)
    About This Section

    TryGeneCards Plus
    NameDescription
    PharmGKB entry for MAP3K9 Pharmacogenomics, SNPs, Pathways
    ATLAS Chromosomes in Cancer entry for MAP3K9 Genetics and Cytogenetics in Oncology and Haematology

    (Patent information from GeneIP,
    Licensable technologies from WIS Yeda, Salk, Tufts,
    IP news from LifeMap Sciences, Inc.)
    About This Section

    TryGeneCards Plus
    Patent Information for MAP3K9 gene:
    Search GeneIP for patents involving MAP3K9

    GeneCards and IP:
    Japan Patent Office Licenses GeneCards     European Patent Office Licenses GeneCards     Improving the IP Search



    (Antibodies, recombinant proteins, and assays from EMD Millipore, R&D Systems, OriGene, QIAGEN, GenScript, Cell Signaling Technology, Novus Biologicals, Sino Biological, Enzo Life Sciences, Abcam, ProSpec, Cloud-Clone Corp., Thermo Fisher Scientific, LSBio, eBioscience, and/or others, Gene Editing from DNA2.0. Clones from OriGene, GenScript, Sino Biological, DNA2.0, SwitchGear Genomics, Vector BioLabs, Addgene, Cell lines from GenScript, and ESI BIO, Flow cytometery from eBioscience, PCR Arrays from QIAGEN, Drugs and/or compounds from EMD Millipore, Tocris Bioscience, Enzo Life Sciences, and/or ApexBio, In Situ Hybridization Assays from
    Advanced Cell Diagnostics, Animal models from inGenious Targeting Laboratory, genOway)
    About This Section

    TryGeneCards Plus

     Browse Small Molecules at EMD Millipore
     Browse Kits and Assays available from EMD Millipore
     EMD Millipore Purified and/or Recombinant MAP3K9 Protein
     EMD Millipore Mono- and Polyclonal Antibodies for the study of MAP3K9
     
     EMD Millipore genomic analysis products

      
     Browse Antibodies   Browse Cell Culture Products  
     Browse ELISAs   Browse Flow Cytometry Kits  
     Browse Primer Pairs   Browse Enzyme Activity Assays/Reagents  
     Browse ELISpot/FluoroSpot Kits/Development Modules   Browse TFB/Immunoprecipitation Assays  
     Browse Apoptosis Detection Kits/Reagents   Browse Ubiquitin Proteasome Pathway (UPP) Assay Kits/Reagents  
     Browse DNA Damage/Repair Kits/Reagents   Browse Luminex Assays  
     Browse Cell Selection/Detection Kits/Reagents   Browse Secondary Antibodies/Controls/Staining Reagents  
     Browse Recombinant/Natural Proteins   Browse Stem Cell Products  
     Browse cDNA Clones   Browse Proteome Profiler Antibody Arrays  
     OriGene Antibodies for MAP3K9   OriGene RNAi products in human, mouse, rat for MAP3K9  
     Browse OriGene qPCR primer pairs and template standards   OriGene Protein Over-expression Lysate for MAP3K9  
     OriGene Custom Mass Spec   OriGene clones in human, mouse for MAP3K9  
     OriGene qSTAR qPCR primer pairs in human, mouse for MAP3K9   Browse OriGene full length recombinant human proteins expressed in human HEK293 cells  
     OriGene ORF clones in mouse, rat for MAP3K9   OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling  
     OriGene Custom Antibody Services for MAP3K9   OriGene Custom Protein Services for MAP3K9  

     
     
     Block miRNA regulation of human, mouse, rat MAP3K9 using miScript Target Protectors SeqTarget long-range PCR primers for resequencing MAP3K9
     DNA Methylation CpG Assay Predesigned for Pyrosequencing in human, mouse, rat MAP3K9 Predesigned siRNA for gene silencing in human, mouse, rat MAP3K9
     QuantiFast Probe-based Assays in human, mouse, rat MAP3K9 QuantiTect SYBR Green Assays in human, mouse, rat MAP3K9
     Custom PCR Arrays for MAP3K9 Search Chromatin IP Primers for MAP3K9
     Pre-validated RT2 qPCR Primer Assay in human, mouse, rat MAP3K9  GeneGlobe Interaction Network for MAP3K9
     Regulatory tfbs in MAP3K9 promoter
     GenScript Custom Purified and Recombinant Proteins Services for MAP3K9 GenScript cDNA clones with any tag delivered in your preferred vector for MAP3K9
     GenScript Custom Assay Services for MAP3K9 GenScript Custom overexpressing Cell Line Services for MAP3K9
     CloneReady with Over 120,000 Genes  Gene Synthesis: Any Gene in Any Vector
     Vector-based siRNA and miRNA, Ready for Transfection Gene Mutant Library, Variants up to 10^11
     Plasmid Preparation Custom Peptide Services
     Antibodies & Assays for MAP3K9  (MLK1)

     Search Tocris compounds for MAP3K9 (M3K9)
     Browse Sino Biological Proteins
     Browse Sino Biological Cell Lysates
     Browse Sino Biological cDNA Clones
     4000+ Proteins
     Search Sino Biological for antibodies, proteins & pathways
     Protein Production Services
     Transfection Reagents
     Protein A/G/L resins
     Isotyping reagents
     Search www.enzolifesciences.com for proteins, assays, substrates, inhibitors & antibodies

     Novus Tissue Slides
     MAP3K9 antibodies
     MAP3K9 proteins
     MAP3K9 lysates
     Antibodies for MAP3K9
     See all of Abcam's Antibodies, Kits and Proteins for MAP3K9
     Custom Antibody / Protein Production Service
     Bulk Purchasing
     Advantages of Rabbit Monoclonal antibodies
     Abcam protocols and scientific support
     Browse ProSpec Recombinant Proteins
     Proteins for MAP3K9
     Antibodies for MAP3K9
     ELISAs for MAP3K9
     CLIAs for MAP3K9



     Browse ESI BIO Cell Lines and PureStem Progenitors for MAP3K9
     Gene Synthesis
     Protein Engineering
     Variant Library Synthesis
     Codon Optimization
     Protein Production and Purification
     Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for MAP3K9
     SwitchGear 3'UTR luciferase reporter plasmids for MAP3K9
     SwitchGear Promoter luciferase reporter plasmids for MAP3K9
     ThermoFisher Antibodies for MAP3K9
     Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat MAP3K9
     inGenious Targeting Laboratory: Let us create your new Knockout/Knockin mouse model for MAP3K9
     inGenious Targeting Laboratory: Contact us about creating complex and humanized mouse models for MAP3K9
     LSBio Antibodies in human, mouse, rat for MAP3K9
    Customized transgenic rodents for:
     Humanization
     Biomarker expression
     Off-target effect monitoring
     Translational medicine
     Tissue-specific gene expresssion
     Time-controlled gene expresssion
     Browse compounds at ApexBio
     Search Addgene for plasmids for MAP3K9
      Search eBioscience for proteins for MAP3K9
      Search eBioscience for elisas for MAP3K9
      eBioscience FlowRNA Probe Sets
           
    GeneCards Homepage - Last full update: 7 May 2014 - Incrementals: 9 May 2014 , 2 Jun 2014 , 26 Jun 2014 , 30 Jun 2014 , 21 Aug 2014 , 8 Sep 2014

    View Random Gene

    Category
    (GIFtS: )
    GIFtS Group
    The GeneCards human gene database gene index: 1 3 5 A B C D E F G H I J K L M N O P Q R S T U V W X Y Z 


    Developed at the Crown Human Genome Center, Department of Molecular Genetics, the Weizmann Institute of Science

    Hot genes      Disease genes      MAP3K9 gene at Home site.
    Version: 3.12.212 17 Sep 2014
    hostname: 356980-web2.xennexinc.com index build: 128 solr: 1.4