Free for academic non-profit institutions. Other users need a Commercial license

Aliases for MAP3K15 Gene

Aliases for MAP3K15 Gene

  • Mitogen-Activated Protein Kinase Kinase Kinase 15 2 3 5
  • Apoptosis Signal-Regulating Kinase 3 3 4
  • MAPK/ERK Kinase Kinase 15 3 4
  • MEK Kinase 15 3 4
  • EC 2.7.11.25 4 56
  • MEKK 15 3 4
  • ASK3 3 4
  • BA723P2.3 3
  • EC 2.7.11 56

External Ids for MAP3K15 Gene

Previous GeneCards Identifiers for MAP3K15 Gene

  • GC0XM019138
  • GC0XM017127

Summaries for MAP3K15 Gene

Entrez Gene Summary for MAP3K15 Gene

  • The protein encoded by this gene is a member of the mitogen-activated protein kinase (MAPK) family. These family members function in a protein kinase signal transduction cascade, where an activated MAPK kinase kinase (MAP3K) phosphorylates and activates a specific MAPK kinase (MAP2K), which then activates a specific MAPK. This MAP3K protein plays an essential role in apoptotic cell death triggered by cellular stresses. [provided by RefSeq, Jul 2010]

GeneCards Summary for MAP3K15 Gene

MAP3K15 (Mitogen-Activated Protein Kinase Kinase Kinase 15) is a Protein Coding gene. Gene Ontology (GO) annotations related to this gene include transferase activity, transferring phosphorus-containing groups and protein tyrosine kinase activity. An important paralog of this gene is MAP3K5.

UniProtKB/Swiss-Prot for MAP3K15 Gene

  • May function in a signal transduction pathway that is activated by various cell stresses and leads to apoptosis.

Additional gene information for MAP3K15 Gene

No data available for CIViC summary , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for MAP3K15 Gene

Genomics for MAP3K15 Gene

GeneHancer (GH) Regulatory Elements for MAP3K15 Gene

Promoters and enhancers for MAP3K15 Gene
GeneHancer (GH) Identifier GH Type GH
Score
GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites
Gene Targets
GH0XI019514 Promoter 1.5 EPDnew Ensembl 550.8 -0.1 -139 1.2 CTCF ZNF777 MAX SIN3A DMAP1 ZIC2 E2F1 ZNF335 POLR2A PATZ1 MAP3K15 BCLAF3 GC0XP019714
GH0XI019566 Enhancer 1 Ensembl ENCODE 0.2 -51.5 -51466 1.3 HDAC1 SOX13 FOXA2 ZNF449 ETV1 CEBPG IRF9 CTBP1 TRIM24 NR2F6 SH3KBP1 BCLAF3 MAP3K15 GC0XP019714
GH0XI019544 Enhancer 0.6 ENCODE 0.3 -29.6 -29627 0.1 CTCF ZNF654 REST RAD21 SMC3 ZNF143 ZNF444 RUNX3 MAP3K15 GC0XP019714 SH3KBP1
GH0XI019603 Enhancer 0.8 Ensembl ENCODE 0.2 -88.1 -88116 0.4 NCOA3 MAFG BACH1 CEBPG FOSL1 MAFF JUND ZNF316 NFE2 FOS MAP3K15 GC0XP019714 SH3KBP1
GH0XI019554 Enhancer 0.5 ENCODE 0.3 -39.9 -39856 1.3 IKZF1 JUNB BATF IKZF2 RUNX3 RELA MAP3K15 GC0XP019714 SH3KBP1
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data dump

GeneHancers around MAP3K15 on UCSC Golden Path with GeneCards custom track

Top Transcription factor binding sites by QIAGEN in the MAP3K15 gene promoter:

Genomic Locations for MAP3K15 Gene

Genomic Locations for MAP3K15 Gene
chrX:19,360,056-19,515,261
(GRCh38/hg38)
Size:
155,206 bases
Orientation:
Minus strand
chrX:19,378,174-19,533,379
(GRCh37/hg19)

Genomic View for MAP3K15 Gene

Genes around MAP3K15 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
MAP3K15 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for MAP3K15 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for MAP3K15 Gene

Proteins for MAP3K15 Gene

  • Protein details for MAP3K15 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Q6ZN16-M3K15_HUMAN
    Recommended name:
    Mitogen-activated protein kinase kinase kinase 15
    Protein Accession:
    Q6ZN16
    Secondary Accessions:
    • A2AI49
    • A2AI50
    • A6NJ61
    • Q5JPR4
    • Q6ZMV3

    Protein attributes for MAP3K15 Gene

    Size:
    1313 amino acids
    Molecular mass:
    147437 Da
    Cofactor:
    Name=Mg(2+); Xref=ChEBI:CHEBI:18420;
    Quaternary structure:
    No Data Available

    Alternative splice isoforms for MAP3K15 Gene

    UniProtKB/Swiss-Prot:

neXtProt entry for MAP3K15 Gene

Selected DME Specific Peptides for MAP3K15 Gene

Q6ZN16:
  • LFGFQDAVN
  • YGIVYAGRDLSNQVRIAIKEIPERD
  • KISDFGTSK
  • VPGGSLS
  • NLLLSYRD

Post-translational modifications for MAP3K15 Gene

No Post-translational modifications

Other Protein References for MAP3K15 Gene

Domains & Families for MAP3K15 Gene

Gene Families for MAP3K15 Gene

Suggested Antigen Peptide Sequences for MAP3K15 Gene

GenScript: Design optimal peptide antigens:

Graphical View of Domain Structure for InterPro Entry

Q6ZN16

UniProtKB/Swiss-Prot:

M3K15_HUMAN :
  • Belongs to the protein kinase superfamily. STE Ser/Thr protein kinase family. MAP kinase kinase kinase subfamily.
Family:
  • Belongs to the protein kinase superfamily. STE Ser/Thr protein kinase family. MAP kinase kinase kinase subfamily.
genes like me logo Genes that share domains with MAP3K15: view

Function for MAP3K15 Gene

Molecular function for MAP3K15 Gene

UniProtKB/Swiss-Prot CatalyticActivity:
ATP + a protein = ADP + a phosphoprotein.
UniProtKB/Swiss-Prot EnzymeRegulation:
Contains an N-terminal autoinhibitory domain. Activated by phosphorylation at Thr-812, inhibited by phosphorylation at Ser-924 and Ser-994 (By similarity).
UniProtKB/Swiss-Prot Function:
May function in a signal transduction pathway that is activated by various cell stresses and leads to apoptosis.

Enzyme Numbers (IUBMB) for MAP3K15 Gene

Phenotypes From GWAS Catalog for MAP3K15 Gene

Gene Ontology (GO) - Molecular Function for MAP3K15 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0000166 nucleotide binding IEA --
GO:0004672 protein kinase activity IEA --
GO:0004674 protein serine/threonine kinase activity IEA --
GO:0004709 MAP kinase kinase kinase activity IBA --
GO:0005524 ATP binding IEA --
genes like me logo Genes that share ontologies with MAP3K15: view
genes like me logo Genes that share phenotypes with MAP3K15: view

Animal Models for MAP3K15 Gene

MGI Knock Outs for MAP3K15:

Clone Products

No data available for Human Phenotype Ontology , miRNA , Transcription Factor Targets and HOMER Transcription for MAP3K15 Gene

Localization for MAP3K15 Gene

Subcellular locations from

COMPARTMENTS
Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for MAP3K15 gene
Compartment Confidence
nucleus 2
cytosol 2

Subcellular locations from the

Human Protein Atlas (HPA)

Gene Ontology (GO) - Cellular Components for MAP3K15 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005622 intracellular IEA --
genes like me logo Genes that share ontologies with MAP3K15: view

No data available for Subcellular locations from UniProtKB/Swiss-Prot for MAP3K15 Gene

Pathways & Interactions for MAP3K15 Gene

SuperPathways for MAP3K15 Gene

No Data Available

Gene Ontology (GO) - Biological Process for MAP3K15 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0000165 MAPK cascade IEA --
GO:0000186 activation of MAPKK activity IBA --
GO:0006468 protein phosphorylation IEA --
GO:0016310 phosphorylation IEA --
genes like me logo Genes that share ontologies with MAP3K15: view

No data available for Pathways by source and SIGNOR curated interactions for MAP3K15 Gene

Drugs & Compounds for MAP3K15 Gene

(1) Drugs for MAP3K15 Gene - From: HMDB

Name Status Disease Links Group Role Mechanism of Action Clinical Trials
Magnesium Approved Nutra 0
genes like me logo Genes that share compounds with MAP3K15: view

Transcripts for MAP3K15 Gene

Unigene Clusters for MAP3K15 Gene

Mitogen-activated protein kinase kinase kinase 15:
Representative Sequences:

Clone Products

Alternative Splicing Database (ASD) splice patterns (SP) for MAP3K15 Gene

No ASD Table

Relevant External Links for MAP3K15 Gene

GeneLoc Exon Structure for
MAP3K15
ECgene alternative splicing isoforms for
MAP3K15

Expression for MAP3K15 Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for MAP3K15 Gene

mRNA expression in embryonic tissues and stem cells from LifeMap Discovery

mRNA differential expression in normal tissues according to GTEx for MAP3K15 Gene

This gene is overexpressed in Adrenal Gland (x35.0).

Protein differential expression in normal tissues from HIPED for MAP3K15 Gene

This gene is overexpressed in Serum (35.8), Adrenal (23.9), and Peripheral blood mononuclear cells (7.7).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, PaxDb, and MOPED for MAP3K15 Gene



Protein tissue co-expression partners for MAP3K15 Gene

NURSA nuclear receptor signaling pathways regulating expression of MAP3K15 Gene:

MAP3K15

SOURCE GeneReport for Unigene cluster for MAP3K15 Gene:

Hs.713701

mRNA Expression by UniProt/SwissProt for MAP3K15 Gene:

Q6ZN16-M3K15_HUMAN
Tissue specificity: Isoform 2 and isoform 3 are widely expressed. Isoform 2 highest levels are observed in fetal brain, and isoform 3 highest levels in pancreas, peripheral blood leukocytes, fetal brain and spleen.
genes like me logo Genes that share expression patterns with MAP3K15: view

No data available for Evidence on tissue expression from TISSUES and Phenotype-based relationships between genes and organs from Gene ORGANizer for MAP3K15 Gene

Orthologs for MAP3K15 Gene

This gene was present in the common ancestor of animals and fungi.

Orthologs for MAP3K15 Gene

Organism Taxonomy Gene Similarity Type Details
chimpanzee
(Pan troglodytes)
Mammalia MAP3K15 34
  • 99 (a)
OneToOne
dog
(Canis familiaris)
Mammalia MAP3K15 33 34
  • 87.86 (n)
cow
(Bos Taurus)
Mammalia MAP3K15 33 34
  • 87.14 (n)
rat
(Rattus norvegicus)
Mammalia Map3k15 33
  • 86.57 (n)
mouse
(Mus musculus)
Mammalia Map3k15 33 16 34
  • 86.11 (n)
oppossum
(Monodelphis domestica)
Mammalia MAP3K15 34
  • 78 (a)
OneToOne
platypus
(Ornithorhynchus anatinus)
Mammalia MAP3K15 34
  • 77 (a)
OneToOne
chicken
(Gallus gallus)
Aves MAP3K15 33 34
  • 74.81 (n)
lizard
(Anolis carolinensis)
Reptilia MAP3K15 34
  • 80 (a)
OneToOne
zebrafish
(Danio rerio)
Actinopterygii MAP3K15 34
  • 72 (a)
OneToOne
map3k15 33
  • 70.85 (n)
African malaria mosquito
(Anopheles gambiae)
Insecta AgaP_AGAP000747 33
  • 54.17 (n)
fruit fly
(Drosophila melanogaster)
Insecta Pk92B 33 34
  • 53.28 (n)
worm
(Caenorhabditis elegans)
Secernentea nsy-1 34
  • 34 (a)
OneToMany
baker's yeast
(Saccharomyces cerevisiae)
Saccharomycetes STE11 34
  • 22 (a)
OneToMany
Species where no ortholog for MAP3K15 was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea squirt (Ciona intestinalis)
  • sea squirt (Ciona savignyi)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • tropical clawed frog (Silurana tropicalis)
  • wheat (Triticum aestivum)

Evolution for MAP3K15 Gene

ENSEMBL:
Gene Tree for MAP3K15 (if available)
TreeFam:
Gene Tree for MAP3K15 (if available)

Paralogs for MAP3K15 Gene

Paralogs for MAP3K15 Gene

genes like me logo Genes that share paralogs with MAP3K15: view

Variants for MAP3K15 Gene

Sequence variations from dbSNP and Humsavar for MAP3K15 Gene

SNP ID Clin Chr 0X pos Variation AA Info Type
rs137853250 pathogenic, uncertain-significance, Pyruvate dehydrogenase E1-alpha deficiency, not specified 19,359,613(-) G/A/T downstream_transcript_variant
rs606231184 pathogenic, Pyruvate dehydrogenase E1-alpha deficiency 19,359,640(-) AGTCAGTCAGT/AGTCAGT downstream_transcript_variant
rs606231186 pathogenic, Pyruvate dehydrogenase E1-alpha deficiency 19,359,639(-) AA/ downstream_transcript_variant
rs606231187 pathogenic, Pyruvate dehydrogenase E1-alpha deficiency 19,359,550(-) CTGAGCCACCTTTGGAAGAGCTG/CTG downstream_transcript_variant
rs606231189 pathogenic, Pyruvate dehydrogenase E1-alpha deficiency, not provided 19,359,620(-) CAATCA/CAATCAATCA downstream_transcript_variant

Structural Variations from Database of Genomic Variants (DGV) for MAP3K15 Gene

Variant ID Type Subtype PubMed ID
dgv1395e199 CNV deletion 23128226
esv23814 CNV loss 19812545
esv2740000 CNV deletion 23290073
esv2740001 CNV deletion 23290073
esv3558663 CNV deletion 23714750
esv3558664 CNV deletion 23714750
esv3558667 CNV deletion 23714750
esv3573627 CNV loss 25503493
esv3573628 CNV loss 25503493
esv3573629 CNV loss 25503493
esv3573630 CNV loss 25503493
nsv1076247 CNV deletion 25765185
nsv1077221 CNV deletion 25765185
nsv1126943 CNV deletion 24896259
nsv1132237 CNV deletion 24896259
nsv1145286 CNV deletion 24896259
nsv425077 CNV insertion 16902084
nsv528469 CNV gain 19592680
nsv957810 CNV deletion 24416366

Variation tolerance for MAP3K15 Gene

Gene Damage Index Score: 3.96; 59.78% of all genes are more intolerant (likely to be disease-causing)

Additional Variant Information for MAP3K15 Gene

Human Gene Mutation Database (HGMD)
MAP3K15
SNPedia medical, phenotypic, and genealogical associations of SNPs for
MAP3K15

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for MAP3K15 Gene

Disorders for MAP3K15 Gene

Additional Disease Information for MAP3K15

No disorders were found for MAP3K15 Gene.

No data available for MalaCards , UniProtKB/Swiss-Prot and Genatlas for MAP3K15 Gene

Publications for MAP3K15 Gene

  1. ASK3, a novel member of the apoptosis signal-regulating kinase family, is essential for stress-induced cell death in HeLa cells. (PMID: 20362554) Kaji T … Kishimoto T (Biochemical and biophysical research communications 2010) 2 3 4 58
  2. ASK3 responds to osmotic stress and regulates blood pressure by suppressing WNK1-SPAK/OSR1 signaling in the kidney. (PMID: 23250415) Naguro I … Ichijo H (Nature communications 2012) 2 3 58
  3. The DNA sequence of the human X chromosome. (PMID: 15772651) Ross MT … Bentley DR (Nature 2005) 3 4 58
  4. Complete sequencing and characterization of 21,243 full-length human cDNAs. (PMID: 14702039) Ota T … Sugano S (Nature genetics 2004) 3 4 58
  5. Architecture of the human interactome defines protein communities and disease networks. (PMID: 28514442) Huttlin EL … Harper JW (Nature 2017) 3 58

Products for MAP3K15 Gene

Sources for MAP3K15 Gene

Content
Loading form....