Set Analyses:
Advanced Search

Advanced Search

 
Search By
Section (entire)
for


 
or upload a file of gene symbols


Category   Symbol Source: HGNC EntrezGene Ensembl GeneCards RNA genes CroW21
GIFtS

MAN1B1 Gene

protein-coding   GIFtS: 67
GCID: GC09P139981

Mannosidase, Alpha, Class 1B, Member 1

  See related diseases
at  

(According to 1HGNC, 2Entrez Gene,
3UniProtKB/Swiss-Prot, 4UniProtKB/TrEMBL, 5OMIM, 6GeneLoc, 7Ensembl, 8DME, 9miRBase, 10fRNAdb, 12H-InvDB, 13NCBI, 14NONCODE, and/or 15RNAdb)
About This Section

Aliases
Mannosidase, Alpha, Class 1B, Member 11 2     MRT152
Man9GlcNAc2-Specific Processing Alpha-Mannosidase1 2     Endoplasmic Reticulum Mannosyl-Oligosaccharide 1,2-Alpha-Mannosidase2
2-Alpha-Mannosidase 11     Endoplasmic Reticulum Mannosyl-Oligosaccharide 1,2-Alpha-Mannosidase 12
2-mannosidase1     ER Alpha 1,2-Mannosidase2
Alpha 11     EC 3.2.1.1133
Endoplasmic Reticulum Alpha-Mannosidase 11     ERMan13
Endoplasmic Reticulum Mannosyl-Oligosaccharide 11     ER Alpha-1,2-Mannosidase3
ER Alpha 11     ER Mannosidase 13
ERMAN12     Man9GlcNAc2-Specific-Processing Alpha-Mannosidase3
MANA-ER2     Mannosidase Alpha Class 1B Member 13

External Ids:    HGNC: 68231   Entrez Gene: 112532   Ensembl: ENSG000001772397   OMIM: 6043465   UniProtKB: Q9UKM73   

Export aliases for MAN1B1 gene to outside databases

Previous GC identifers: GC09U990101 GC09P131671 GC09P133422 GC09P135338 GC09P137257 GC09P139101 GC09P109441


(According to Entrez Gene, Tocris Bioscience, Wikipedia's Gene Wiki, PharmGKB,
UniProtKB/Swiss-Prot, and/or UniProtKB/TrEMBL)
About This Section

Entrez Gene summary for MAN1B1 Gene:
This gene encodes an enzyme belonging to the glycosyl hydrolase 47 family. This enzyme functions in N-glycan
biosynthesis, and is a class I alpha-1,2-mannosidase that specifically converts Man9GlcNAc to Man8GlcNAc isomer
B. It is required for N-glycan trimming to Man5-6GlcNAc2 in the endoplasmic-reticulum-associated degradation
pathway. Mutations in this gene cause autosomal-recessive intellectual disability. Alternative splicing results
in multiple transcript variants. A related pseudogene has been identified on chromosome 11. (provided by RefSeq,
Dec 2011)

GeneCards Summary for MAN1B1 Gene: 
MAN1B1 (mannosidase, alpha, class 1B, member 1) is a protein-coding gene. Diseases associated with MAN1B1 include pelvic inflammatory disease, and intellectual disability, and among its related super-pathways are WNT ligand biogenesis and trafficking and Calnexin/calreticulin cycle. GO annotations related to this gene include mannosyl-oligosaccharide 1,2-alpha-mannosidase activity and calcium ion binding. An important paralog of this gene is MAN1A1.

UniProtKB/Swiss-Prot: MA1B1_HUMAN, Q9UKM7
Function: Involved in glycoprotein quality control targeting of misfolded glycoproteins for degradation. It
primarily trims a single alpha-1,2-linked mannose residue from Man(9)GlcNAc(2) to produce Man(8)GlcNAc(2), but at
high enzyme concentrations, as found in the ER quality control compartment (ERQC), it further trims the
carbohydrates to Man(5-6)GlcNAc(2)

summary for MAN1B1 Gene:
Mannosidases are divided into two subtypes; I and II, (EC numbers 3.2.1.113 and 3.2.1.114 respectively)
which display a wide expression pattern. Mannosidase I hydrolyzes (1,2)-linked alpha-D-mannose residues in
the oligo-mannose oligosaccharide Man9(GlcNAc)2 and mannosidase II hydrolyzes (1,3)- and (1,6)-linked
alpha-D-mannose residues in Man5(GlcNAc)3. Both subtypes require a divalent cation cofactor. Mutations in
mannosidases can cause mannosidosis (mannosidase I deficiency).

Gene Wiki entry for MAN1B1 Gene


(According to GeneLoc and/or HGNC, and/or
Entrez Gene (NCBI build 37),
and/or miRBase,
Genomic Views according to UCSC (hg19) and Ensembl (release 73), Regulatory elements and Epigenetics data according to QIAGEN, SABiosciences, and/or SwitchGear Genomics)
About This Section
RefSeq DNA sequence:
NC_000009.11  NC_018920.2  NT_024000.16  
Regulatory elements:
   SABiosciences Regulatory transcription factor binding sites in the MAN1B1 gene promoter:
         HOXA9B   HOXA9   AhR   Pax-5   Meis-1b   Arnt   HSF2   Meis-1   
         Other transcription factors

SwitchGear Promoter luciferase reporter plasmidMAN1B1 promoter sequence
   Search SABiosciences Chromatin IP Primers for MAN1B1

Epigenetics:
QIAGEN PyroMark CpG Assay predesigned Pyrosequencing DNA Methylation assays in human, mouse, rat MAN1B1


Genomic Location:
Genomic View: UCSC Golden Path with GeneCards custom track

Entrez Gene cytogenetic band: 9q34   Ensembl cytogenetic band:  9q34.3   HGNC cytogenetic band: 9q34.3

MAN1B1 Gene in genomic location: bands according to Ensembl, locations according to (and/or Entrez Gene and/or Ensembl if different)
MAN1B1 gene location

GeneLoc information about chromosome 9         GeneLoc Exon Structure

GeneLoc location for GC09P139981:  view genomic region     (about GC identifiers)

Start:
139,981,379 bp from pter      End:
140,003,639 bp from pter
Size:
22,261 bases      Orientation:
plus strand

(According to UniProtKB, HORDE, neXtProt, Ensembl, and/or Reactome, Modification sites according to PhosphoSitePlus, Specific Peptides from DME, Protein expression images according to data from SPIRE 1MOPED, 2PaxDb, and 3MAXQB RefSeq according to NCBI, PDB rendering according to OCA and/or Proteopedia, Recombinant Proteins from EMD Millipore, R&D Systems, GenScript, Enzo Life Sciences, OriGene, Novus Biologicals, Sino Biological, ProSpec, and/or Cloud-Clone Corp.,
Biochemical Assays by EMD Millipore, R&D Systems, OriGene, GenScript, Cell Signaling Technology, Enzo Life Sciences, and/or Cloud-Clone Corp., Ontologies according to Gene Ontology Consortium 01 Oct 2013 and Entrez Gene, Antibodies by EMD Millipore, R&D Systems, GenScript, Cell Signaling Technology, OriGene, Novus Biologicals, Thermo Fisher Scientific, LSBio, Abcam, and/or Cloud-Clone Corp.)
About This Section

UniProtKB/Swiss-Prot: MA1B1_HUMAN, Q9UKM7 (See protein sequence)
Recommended Name: Endoplasmic reticulum mannosyl-oligosaccharide 1,2-alpha-mannosidase  
Size: 699 amino acids; 79580 Da
Cofactor: Calcium
Subcellular location: Endoplasmic reticulum membrane; Single-pass type II membrane protein
Caution: It is uncertain whether Met-1 or Met-37 is the initiator
4 PDB 3D structures from and Proteopedia for MAN1B1:
1FMI (3D)        1FO2 (3D)        1FO3 (3D)        1X9D (3D)    
Secondary accessions: Q5VSG3 Q9BRS9 Q9Y5K7

Explore the universe of human proteins at neXtProt for MAN1B1: NX_Q9UKM7

Explore proteomics data for MAN1B1 at MOPED 

Post-translational modifications:

  • View modification sites using PhosphoSitePlus
  • View neXtProt modification sites for NX_Q9UKM7

  • MAN1B1 Protein expression data from MOPED1, PaxDb2 and MAXQB3 :    About this image 

    MAN1B1 Protein Expression
    REFSEQ proteins: NP_057303.2  
    ENSEMBL proteins: 
     ENSP00000360645   ENSP00000444966   ENSP00000441398   ENSP00000440314   ENSP00000444189  
     ENSP00000440616   ENSP00000447256   ENSP00000448658   ENSP00000450147  
    Reactome Protein details: Q9UKM7
    Human Recombinant Protein Products for MAN1B1: 
    Browse Purified and Recombinant Proteins at EMD Millipore
    Browse R&D Systems for human recombinant proteins
    Browse recombinant and purified proteins available from Enzo Life Sciences
    Browse OriGene full length recombinant human proteins expressed in human HEK293 cells
    OriGene Protein Over-expression Lysate for MAN1B1
    OriGene Custom MassSpec 
    OriGene Custom Protein Services for MAN1B1
    GenScript Custom Purified and Recombinant Proteins Services for MAN1B1
    Novus Biologicals MAN1B1 Protein
    Novus Biologicals MAN1B1 Lysate
    Browse Sino Biological Recombinant Proteins
    Browse Sino Biological Cell Lysates 
    Browse ProSpec Recombinant Proteins
    Cloud-Clone Corp. Proteins for MAN1B1 

    Gene Ontology (GO): 5 cellular component terms (GO ID links to tree view):    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0005783endoplasmic reticulum IDA18003979
    GO:0005789endoplasmic reticulum membrane IEA--
    GO:0016020membrane IDA18003979
    GO:0016021integral to membrane TAS10521544
    GO:0044322endoplasmic reticulum quality control compartment TAS--

    MAN1B1 for ontologies           About GeneDecksing



    MAN1B1 Antibody Products: 
    Browse EMD Millipore's Extensive Line of Mono- and Polyclonal Antibodies
    Browse R&D Systems for Antibodies
    OriGene Antibodies for MAN1B1
    OriGene Custom Antibody Services for MAN1B1
    GenScript Custom Superior Antibodies Services for MAN1B1
    Novus Biologicals MAN1B1 Antibodies
    Abcam antibodies for MAN1B1
    Cloud-Clone Corp. Antibodies for MAN1B1 
    ThermoFisher Antibodies for MAN1B1
    LSBio Antibodies in human, mouse, rat for MAN1B1 

    Assay Products for MAN1B1: 
    Browse Kits and Assays available from EMD Millipore
    OriGene Custom Assay Services for MAN1B1
    Browse R&D Systems for biochemical assays
    GenScript Custom Assay Services for MAN1B1
    Browse Enzo Life Sciences for kits & assays
    Cloud-Clone Corp. ELISAs for MAN1B1 
    Cloud-Clone Corp. CLIAs for MAN1B1


    (According to HGNC, IUPHAR, InterPro, ProtoNet, UniProtKB, and/or BLOCKS, Sets of similar genes according to GeneDecks)
    About This Section
    1 InterPro protein domain:
     IPR001382 Glyco_hydro_47

    Graphical View of Domain Structure for InterPro Entry Q9UKM7

    ProtoNet protein and cluster: Q9UKM7

    1 Blocks protein domain: IPB001382 Glycosyl hydrolase family 47 signature

    UniProtKB/Swiss-Prot: MA1B1_HUMAN, Q9UKM7
    Similarity: Belongs to the glycosyl hydrolase 47 family


    MAN1B1 for domains           About GeneDecksing


    (According to 1UniProtKB, Genatlas, LifeMap Discovery™, IUBMB, and/or 2DME, Human phenotypes from GenomeRNAi, Animal models from MGI Mar 06 2013, inGenious Targeting Laboratory, genOway,
    bound targets from SABiosciences, miRNA Gene Targets from miRTarBase, shRNA from OriGene, RNAi from EMD Millipore, siRNAs from OriGene, QIAGEN, microRNA from QIAGEN, Gene Editing from DNA2.0, Sirion Biotech, Clones from EMD Millipore, OriGene, SwitchGear Genomics, GenScript, Sino Biological, DNA2.0, Vector BioLabs, and Sirion Biotech, Cell Lines from GenScript, LifeMap BioReagents, In Situ Hybridization Assays from Advanced Cell Diagnostics, Ontologies according to Gene Ontology Consortium 01 Oct 2013 via Entrez Gene.)
    About This Section

    Molecular Function:

         UniProtKB/Swiss-Prot Summary: MA1B1_HUMAN, Q9UKM7
    Function: Involved in glycoprotein quality control targeting of misfolded glycoproteins for degradation. It
    primarily trims a single alpha-1,2-linked mannose residue from Man(9)GlcNAc(2) to produce Man(8)GlcNAc(2), but at
    high enzyme concentrations, as found in the ER quality control compartment (ERQC), it further trims the
    carbohydrates to Man(5-6)GlcNAc(2)
    Catalytic activity: Hydrolysis of the terminal (1->2)-linked alpha-D-mannose residues in the oligo-mannose
    oligosaccharide Man(9)(GlcNAc)(2)
    Enzyme regulation: Inhibited by both 1-deoxymannojirimycin (dMNJ) and kifunensine
    Biophysicochemical properties: Kinetic parameters: KM=0.4 mM for Man9GlcNAc2; pH dependence: Optimum pH is between
    6.5 and 6.9;

         Enzyme Number (IUBMB): EC 3.2.1.1131

         Gene Ontology (GO): 2 molecular function terms (GO ID links to tree view):    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0004571mannosyl-oligosaccharide 1,2-alpha-mannosidase activity TAS10521544
    GO:0005509calcium ion binding TAS10521544
         
    MAN1B1 for ontologies           About GeneDecksing


    Phenotypes:
         1 GenomeRNAi human phenotype for MAN1B1:
     Increased gamma-H2AX phosphory 

    Animal Models:
       inGenious Targeting Laboratory - Custom generated mouse model solutions for MAN1B1 
       inGenious Targeting Laboratory - Custom generated inducible mouse model solutions for MAN1B1

       genOway customized KO model: permanent, tissue-specific or time-controlled inactivation for MAN1B1 
       genOway customized Knockin model: humanization, point mutation, expression monitoring, etc. for MAN1B1 

    miRNA
    Products:
        
    QIAGEN Custom miScript Target Protector blocks miRNA-binding site of human, mouse, rat MAN1B1
    8/9 QIAGEN miScript miRNA Assays for microRNAs that regulate MAN1B1 (see all 9):
    hsa-miR-30c hsa-miR-125a-5p hsa-miR-30d hsa-miR-30a hsa-miR-670 hsa-miR-125b hsa-miR-30b hsa-miR-30e
    SwitchGear 3'UTR luciferase reporter plasmidMAN1B1 3' UTR sequence
    Inhib. RNA
    Products:
        
    Browse for Gene Knock-down Tools from EMD Millipore
    OriGene RNAi products in human, mouse, rat for MAN1B1
    QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat MAN1B1

    Gene Editing
    Products:
    DNA2.0 Custom Protein Engineering Service for MAN1B1
    Sirion Biotech Customized adenovirus for overexpression of MAN1B1

    Clone
    Products:
         
    Browse Clones for the Expression of Recombinant Proteins Available from EMD Millipore
    OriGene clones in human, mouse for MAN1B1 (see all 7)
    OriGene ORF clones in mouse, rat for MAN1B1
    OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
    GenScript: all cDNA clones in your preferred vector: MAN1B1 (NM_016219)
    Sino Biological Human cDNA Clone for MAN1B1
    DNA2.0 Custom Codon Optimized Gene Synthesis Service for MAN1B1
    Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat MAN1B1
    Sirion Biotech Customized lentivirus for stable overexpression of MAN1B1 
                         Customized lentivirus expression plasmids for stable overexpression of MAN1B1 

    Cell Line
    Products:
         
    GenScript Custom overexpressing Cell Line Services for MAN1B1
    Search LifeMap BioReagents cell lines for MAN1B1
    In Situ Assay
    Products:
       

     
    Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for MAN1B1


    (Pathways according to EMD Millipore, R&D Systems, Cell Signaling Technology, KEGG, PharmGKB, BioSystems, Sino Biological, Reactome, Tocris Bioscience, GeneGo (Thomson Reuters), QIAGEN, and/or UniProtKB, Sets of similar genes according to GeneDecks, Interaction Networks according to SABiosciences, and/or STRING, Interactions according to 1UniProtKB, 2MINT, 3I2D, and/or 4STRING, with links to IntAct and Ensembl, Ontologies according to Gene Ontology Consortium 01 Oct 2013 via Entrez Gene).
    About This Section

    SuperPaths for MAN1B1 About   (see all 6)                                                                                              See pathways by source

    SuperPathContained pathways About
    1Asparagine N-linked glycosylation
    Asparagine N-linked glycosylation0.77
    N-Glycan biosynthesis0.52
    WNT ligand biogenesis and trafficking0.77
    Post-translational protein modification0.44
    Signaling by Wnt0.62
    Metabolism of proteins0.35
    2Calnexin/calreticulin cycle
    Calnexin/calreticulin cycle0.85
    ER Quality Control Compartment (ERQC)0.55
    N-glycan trimming in the ER and Calnexin/Calreticulin cycle0.85
    3Signaling by GPCR
    Signal Transduction0.55
    4Metabolism
    Metabolic pathways0.40
    5CFTR folding and maturation (norm and CF)
    CFTR folding and maturation (norm and CF)0.37

    Pathways by source                                                                                                                                                                 See SuperPaths
    Show all pathways


    1 GeneGo (Thomson Reuters) Pathway for MAN1B1
        CFTR folding and maturation (norm and CF)


    5/9        Reactome Pathways for MAN1B1 (see all 9)
        Signaling by Wnt
    Asparagine N-linked glycosylation
    N-glycan trimming in the ER and Calnexin/Calreticulin cycle
    Signal Transduction
    Calnexin/calreticulin cycle


    3         Kegg Pathways  (Kegg details for MAN1B1):
        N-Glycan biosynthesis
    Metabolic pathways
    Protein processing in endoplasmic reticulum

    UniProtKB/Swiss-Prot: MA1B1_HUMAN, Q9UKM7
    Pathway: Protein modification; protein glycosylation


    MAN1B1 for pathways           About GeneDecksing

    Interactions:

        Search SABiosciences Gene Network CentralTM Interacting Genes and Proteins Networks for MAN1B1

    STRING Interaction Network Preview (showing 5 interactants - click image to see 8)

    5/19 Interacting proteins for MAN1B1 (Q9UKM72, 3 ENSP000003606454) via UniProtKB, MINT, STRING, and/or I2D (see all 19)

    InteractantInteraction Details
    GeneCardExternal ID(s)
    DNM2P505702, 3, ENSP000003527214MINT-8254454 I2D: score=2 STRING: ENSP00000352721
    RER1O152583, ENSP000003020884I2D: score=1 STRING: ENSP00000302088
    UBCP0CG483, ENSP000003448184I2D: score=1 STRING: ENSP00000344818
    HACL1Q9UJ833I2D: score=1 
    HSPA5P110213I2D: score=1 
    About this table

    Gene Ontology (GO): 5/7 biological process terms (GO ID links to tree view) (see all 7):    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0006457protein folding TAS--
    GO:0006487protein N-linked glycosylation NAS10521544
    GO:0009311oligosaccharide metabolic process TAS10409699
    GO:0018279protein N-linked glycosylation via asparagine TAS--
    GO:0030433ER-associated protein catabolic process IMP18003979

    MAN1B1 for ontologies           About GeneDecksing



    (Chemical Compounds according to UniProtKB, Enzo Life Sciences, EMD Millipore, Tocris Bioscience HMDB, BitterDB, and/or Novoseek, Ligands according to IUPHAR, and Drugs according to DrugBank, Enzo Life Sciences, and/or PharmGKB, with drugs/clinical trials/news search links to CenterWatch)
    About This Section
    Browse Small Molecules at EMD Millipore
    Browse drugs & compounds from Enzo Life Sciences

    Compounds for MAN1B1 available from Tocris Bioscience    About this table
    CompoundAction CAS #
    KifunensineInhibitor of class I alpha-mannosidases[109944-15-2]
    1-DeoxynojirimycinGlucosidase I and II inhibitor[19130-96-2]
    1-Deoxymannojirimycin hydrochloridealpha-Mannosidase I inhibitor[73465-43-7]
    Miglitolalpha-glucosidase inhibitor[72432-03-2]
    OGT 2115Antiangiogenic. Heparanase inhibitor[853929-59-6]

    3 HMDB Compounds for MAN1B1    About this table
    CompoundSynonyms CAS #PubMed Ids
    CalciumCa (see all 2)7440-70-2--
    D-MannoseDL-mannose (see all 13)3458-28-4--
    WaterDihydrogen oxide (see all 2)7732-18-5--

    5 DrugBank Compounds for MAN1B1    About this table
    CompoundSynonyms CAS #TypeActionsPubMed Ids
    Alpha-D-Mannose-- 3458-28-4target--17139284 17016423 10592235
    1,4-Butanediol-- 110-63-4target--17139284 17016423
    Kifunensine-- 109944-15-2target--17139284 17016423
    Methyl-2-S-(Alpha-D-Mannopyranosyl)-2-Thio-Alpha-D-Mannopyranoside-- --target--17139284 17016423
    1-Deoxynojirimycin1-Deoxy-Nojirimycin (see all 7)19130-96-2target--10592235

    Search CenterWatch for drugs/clinical trials and news about MAN1B1 / MA1B1

    (Secondary structures according to fRNAdb,
    GenBank/EMBL/DDBJ Accessions according to
    Unigene (Build 236 Homo sapiens; Apr 25 2013) or GenBank,
    RefSeq according to Entrez Gene,
    DOTS (version 10), and/or AceView, transcript ids from Ensembl with links to UCSC,
    Conferences by KenesGroup, exon structure from GeneLoc, alternative splicing isoforms according to ASD and/or ECgene,
    RNAi Products from EMD Millipore,
    siRNAs from OriGene, QIAGEN, shRNA from OriGene, microRNA from QIAGEN,
    Tagged/untagged cDNA clones from OriGene, SwitchGear Genomics, GenScript, DNA2.0, Vector BioLabs, Sirion Biotech, Primers from OriGene, SABiosciences, and/or QIAGEN )
    About This Section

    REFSEQ mRNAs for MAN1B1 gene: 
    NM_016219.4  

    Unigene Cluster for MAN1B1:

    Mannosidase, alpha, class 1B, member 1
    Hs.279881  [show with all ESTs]
    Unigene Representative Sequence: NR_045721
    16 Ensembl transcripts including schematic representations, and UCSC links where relevant:
    ENST00000371589(uc011meo.1 uc011mep.2 uc004cld.2 uc010ncc.2)
    ENST00000544448 ENST00000535144 ENST00000545539 ENST00000371587(uc004clc.2)
    ENST00000542372 ENST00000545096 ENST00000540346 ENST00000474902 ENST00000536349
    ENST00000540391(uc004clf.1) ENST00000535028 ENST00000480100 ENST00000536268
    ENST00000475449 ENST00000550113
    miRNA
    Products:
         
    QIAGEN Custom miScript Target Protector blocks miRNA-binding site of human, mouse, rat MAN1B1
    8/9 QIAGEN miScript miRNA Assays for microRNAs that regulate MAN1B1 (see all 9):
    hsa-miR-30c hsa-miR-125a-5p hsa-miR-30d hsa-miR-30a hsa-miR-670 hsa-miR-125b hsa-miR-30b hsa-miR-30e
    SwitchGear 3'UTR luciferase reporter plasmidMAN1B1 3' UTR sequence
    Inhib. RNA
    Products:
         
    Browse for Gene Knock-down Tools from EMD Millipore
    OriGene RNAi products in human, mouse, rat for MAN1B1
    QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat MAN1B1
    Clone
    Products:
         
    OriGene clones in human, mouse for MAN1B1 (see all 7)
    OriGene ORF clones in mouse, rat for MAN1B1
    OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
    GenScript: all cDNA clones in your preferred vector: MAN1B1 (NM_016219)
    DNA2.0 Custom Codon Optimized Gene Synthesis Service for MAN1B1
    Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat MAN1B1
    Sirion Biotech Customized lentivirus for stable overexpression of MAN1B1 
                         Customized lentivirus expression plasmids for stable overexpression of MAN1B1 
    Primer
    Products:
        
    OriGene qPCR primer pairs and template standards for MAN1B1
    OriGene qSTAR qPCR primer pairs in human, mouse for MAN1B1
    SABiosciences RT2 qPCR Primer Assay in human, mouse, rat MAN1B1
      QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat MAN1B1
      QIAGEN QuantiFast Probe-based Assays in human, mouse, rat MAN1B1

    Additional mRNA sequence: 

    AF145732.1 AF148509.1 AK074559.1 AK074699.1 AK130143.1 AK298480.1 AK309808.1 AK315797.1 
    AY358465.1 BC002953.1 BC006079.1 NR_045720.1 NR_045721.1 

    21 DOTS entries:

    DT.114957  DT.91698922  DT.91965231  DT.100790680  DT.101985319  DT.75157921  DT.101985320  DT.40217466 
    DT.100790683  DT.100790686  DT.92000822  DT.92038235  DT.95279716  DT.95279724  DT.100790687  DT.95151625 
    DT.95279714  DT.95279725  DT.95279730  DT.97864225  DT.99944052 

    24/317 AceView cDNA sequences (see all 317):

    BF054944 BC002953 AA508844 BE709955 CD627628 AA603464 BI256754 BE389207 
    AI811801 CA943877 BE048253 T12605 CA454578 BE272776 BU182640 AK128257 
    AL134391 AI745062 AW166519 BX094536 BQ706831 BU727816 AW590093 CA454425 

    GeneLoc Exon Structure

    5/11 Alternative Splicing Database (ASD) splice patterns (SP) for MAN1B1 (see all 11)    About this scheme

    ExUns: 1 ^ 2a · 2b ^ 3a · 3b ^ 4 ^ 5 ^ 6a · 6b · 6c ^ 7 ^ 8 ^ 9a · 9b ^ 10a · 10b · 10c ^ 11 ^ 12a · 12b ^ 13a · 13b ^ 14a · 14b · 14c ^ 15a ·
    SP1:        -     -           -           -                                                                 -     -           -                                 
    SP2:                                                                                                        -     -           -                                 
    SP3:        -     -           -           -                                                                                                                     
    SP4:                                                                                                                          -                                 
    SP5:                                                                                                        -     -           -                                 

    ExUns: 15b ^ 16a · 16b · 16c
    SP1:  -                     
    SP2:  -                     
    SP3:                        
    SP4:  -                     
    SP5:                        


    ECgene alternative splicing isoforms for MAN1B1

    (RNA expression data according to H-InvDB, NONCODE, miRBase, and RNAdb, Expression images according to data from BioGPS, Illumina Human BodyMap, and CGAP SAGE, Sets of similar genes according to GeneDecks, in vivo and in vitro expression data from LifeMap Discovery™, plus additional links to Genevestigator, and/or SOURCE, and/or BioGPS, and/or UniProtKB,
    PCR Arrays from SABiosciences, Primers from OriGene, SABiosciences, and/or QIAGEN, In Situ Hybridization Assays from Advanced Cell Diagnostics)
    About This Section

    MAN1B1 expression in normal human tissues (normalized intensities)
    See probesets specificity/sensitivity at GeneAnnot
    About this imageBioGPS <intensity>2/3
    CGAP TAG: ACTCACGATT
    MAN1B1 Expression
    About this image


    See MAN1B1 Protein Expression from SPIRE MOPED and PaxDB
    Genevestigator expression for MAN1B1

    SOURCE GeneReport for Unigene cluster: Hs.279881

    UniProtKB/Swiss-Prot: MA1B1_HUMAN, Q9UKM7
    Tissue specificity: Widely expressed

        SABiosciences Expression via Pathway-Focused PCR Array including MAN1B1: 
              Glycosylation in human mouse rat

    Primer
    Products:
    OriGene qPCR primer pairs and template standards for MAN1B1
    OriGene qSTAR qPCR primer pairs in human, mouse for MAN1B1
    SABiosciences RT2 qPCR Primer Assay in human, mouse, rat MAN1B1
    QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat MAN1B1
    QIAGEN QuantiFast Probe-based Assays in human, mouse, rat MAN1B1
    In Situ
    Assay Products:
     

     
    Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for MAN1B1

    (Orthologs according to 1,2HomoloGene (2older version, for species not in 1newer version), 3euGenes, 4SGD , 5MGI Mar 06 2013, with possible further links to Flybase and/or WormBase, and/or 6Ensembl pan taxonomic compara , Gene Trees according to Ensembl and TreeFam)
    About This Section

    This gene was present in the common ancestor of eukaryotes.

    Orthologs for MAN1B1 gene from 9/19 species (see all 19)    About this table
    Organism Taxonomic
    classification
    Gene Description Human
    Similarity
    Orthology
    Type
    Details
    mouse
    (Mus musculus)
    Mammalia Man1b11 , 5 mannosidase, alpha, class 1B, member 11, 5 79.67(n)1
    78.51(a)1
      2 (17.17 cM)5
    2276191  NM_001029983.21  NP_001025154.11 
     253323385 
    chicken
    (Gallus gallus)
    Aves MAN1B11 mannosidase, alpha, class 1B, member 1 69.39(n)
    71.41(a)
      417296  XM_415569.3  XP_415569.3 
    lizard
    (Anolis carolinensis)
    Reptilia MAN1B16
    Uncharacterized protein
    75(a)
    1 ↔ 1
    GL344151.1(2892-20016)
    zebrafish
    (Danio rerio)
    Actinopterygii BM103988.12   -- 79.72(n)    BM103988.1 
    fruit fly
    (Drosophila melanogaster)
    Insecta CG118741 , 3 mannosyl-oligosaccharide
    1,2-alpha-mannosidase3
    CG118741
    43(a)3
    53.45(n)1
    46.76(a)1
      98F103
    434361  NM_143410.31  NP_651667.11 
    worm
    (Caenorhabditis elegans)
    Secernentea T03G11.41 , 3 man(9)-alpha-mannosidase3
    Protein T03G11.41
    52(a)
    (best of 2)3
    55.01(n)1
    53.14(a)1
      X(5200690-5203793)3
    1807871  NM_076476.31  NP_508877.11 
    baker's yeast
    (Saccharomyces cerevisiae)
    Saccharomycetes MNS1(YJR131W)4
    MNS11
    Alpha-1,2-mannosidase involved in ER quality control; more4
    Mns1p1
    50.08(n)1
    44.21(a)1
      10(667644-669293)4
    8535951, 4  NP_012665.31  NP_012665.14 
    thale cress
    (Arabidopsis thaliana)
    eudicotyledons MNS31 mannosyl-oligosaccharide 1,2-alpha-mannosidase MNS3 53.39(n)
    53.62(a)
      839879  NM_102740.2  NP_564345.1 
    rice
    (Oryza sativa)
    Liliopsida Os.213432 Oryza sativa (japonica cultivar-group) cDNA cloneJ more 74.71(n)    AK069043.1 


    ENSEMBL Gene Tree for MAN1B1 (if available)
    TreeFam Gene Tree for MAN1B1 (if available)

    (Paralogs according to 1HomoloGene,
    2Ensembl, and 3SIMAP, Pseudogenes according to 4Pseudogene.org Build 68)
    About This Section
    Paralogs for MAN1B1 gene
    MAN1A12  MAN1C12  MAN1A22  
    8 SIMAP similar genes for MAN1B1 using alignment to 9 protein entries:     MA1B1_HUMAN (see all proteins):
    DKFZp686C04126    DKFZp434I213    pp6318    MAN1C1    MAN1A2    MAN1A1
    EDEM3    EDEM1

    MAN1B1 for paralogs           About GeneDecksing


    2 Pseudogenes.org Pseudogenes for MAN1B1
    PGOHUM00000242215 PGOHUM00000260490


    (SNPs/Variants according to the 1NCBI SNP Database, 2Ensembl, 3PupaSUITE, 4UniProtKB, and DNA2.0, Linkage Disequilibrium by HapMap, Structural Variations(CNVs/InDels/Inversions) from the Database of Genomic Variants, Mutations from the Human Gene Mutation Database (HGMD) and the Locus Specific Mutation Databases (LSDB), Blood group antigen gene mutations by BGMUT, Resequencing Primers from QIAGEN, Cancer Mutation PCR Arrays and Assays and Copy Number PCR Arrays from SABiosciences)
    About This Section

    10/1065 SNPs in MAN1B1 are shown (see all 1065)    About this table     
    Genomic DataTranscription Related DataAllele Frequencies
    SNP IDValidClinical
    significance
    Chr 9 posSequence#AA
    Chg
    TypeMore#Allele
    freq
    PopTotal
    sample
    More
    ----------
    VAR_0665934
    Mental retardation, autosomal recessive 15 (MRT15)4--see VAR_0665932 E K mis40--------
    VAR_0665924
    Mental retardation, autosomal recessive 15 (MRT15)4--see VAR_0665922 R C mis40--------
    rs78533361,2
    C,F,A,H--109464973(+) ACCGCG/AATGTC 3 -- ut31 nc-transcript-variant21Minor allele frequency- A:0.43NS EA WA NA 2342
    rs1138084991,2
    C--139985997(+) TTTTTG/TAGACA 3 -- int11Minor allele frequency- T:0.50CSA 2
    rs1408399671,2
    C--139999788(+) CCACA-/CCATCCACGTG
    AGGCTCCCACACG
    CCATC
    3 -- int10--------
    rs568390391,2
    C--139999808(+) TCCCA-/CACGCCATCCA
    CGTGAGGCTCCCA
    TGCAG
    3 -- int11Minor allele frequency- CACGCCATCCACGTGAGGCTCCCA:0.00NA 2
    rs59011171,2
    C--140001341(+) AAAAGAAC/-AACGA 3 -- cds1 int11Minor allele frequency- -:0.00NA 2
    rs799760001,2
    C--140001341(+) AAAAAG/CAACGA 3 -- int11Minor allele frequency- C:0.50NA 2
    rs718037861,2
    C--140003529(+) CTGGC-/CCGCCC 3 -- ut31 nc-transcript-variant0--------
    rs48801981,2
    C,F,A,H--140016358(+) AATTGC/TAATGC 3 -- us2k19Minor allele frequency- T:0.21NS EA NA CSA WA 782

    HapMap Linkage Disequilibrium report for MAN1B1 (139981379 - 140003639 bp)

    Structural Variations
         Database of Genomic Variants (DGV) 10/38 variations for MAN1B1 (see all 38):    About this table     
    Variant IDTypeSubtypePubMed ID
    dgv1342e201CNV Deletion23290073
    esv2422220CNV Deletion17116639
    esv1403415CNV Insertion17803354
    nsv894591CNV Loss21882294
    dgv8445n71CNV Loss21882294
    dgv8441n71CNV Loss21882294
    nsv894521CNV Loss21882294
    nsv894503CNV Loss21882294
    nsv831761CNV Loss17160897
    nsv894570CNV Loss21882294


    Human Gene Mutation Database (HGMD): MAN1B1
    SABiosciences Cancer Mutation PCR Assays
    SeqTarget long-range PCR primers for resequencing MAN1B1
    DNA2.0 Custom Variant and Variant Library Synthesis for MAN1B1

    (in which this Gene is Involved, According to MalaCards, OMIM, UniProtKB, the University of Copenhagen DISEASES database, Conferences by KenesGroup, Genatlas, GeneTests, GAD, HuGE Navigator, and/or TGDB.)
    About This Section
    OMIM gene information: 604346    OMIM disorders: --

    UniProtKB/Swiss-Prot: MA1B1_HUMAN, Q9UKM7
  • Mental retardation, autosomal recessive 15 (MRT15) [MIM:614202]: A disorder characterized by
    significantly below average general intellectual functioning associated with impairments in adaptative behavior
    and manifested during the developmental period. Note=The disease is caused by mutations affecting the gene
    represented in this entry

  • 12 diseases for MAN1B1:    About MalaCards
    pelvic inflammatory disease    intellectual disability    metachromatic leukodystrophy    alpha 1-antitrypsin deficiency
    leukodystrophy    congenital dyserythropoietic anemia    congenital disorder of glycosylation    peritonitis
    anemia    liver disease    mental retardation    gastric cancer


    MAN1B1 for disorders           About GeneDecksing

    Genetic Association Database (GAD): MAN1B1
    Human Genome Epidemiology (HuGE) Navigator: MAN1B1 (2 documents)

    Export disorders for MAN1B1 gene to outside databases

    (in PubMed. Associations of this gene to articles via 1Entrez Gene, 2UniProtKB/Swiss-Prot, 3HGNC, 4GAD, 5PharmGKB, 6HMDB, 7DrugBank, 8UniProtKB/TrEMBL, 9 Novoseek, and/or 10fRNAdb)
    About This Section

    PubMed articles for MAN1B1 gene, integrated from 9 sources (see all 52):
    (articles sorted by number of sources associating them with MAN1B1)
        Utopia: connect your pdf to the dynamic
    world of online information

    1. Cloning and expression of a specific human alpha 1,2-mannosidase that trims Man9GlcNAc2 to Man8GlcNAc2 isomer B during N-glycan biosynthesis. (PubMed id 10521544)1, 2, 3 Tremblay L.O. and Herscovics A. (1999)
    2. Identification, expression, and characterization of a cDNA encoding human endoplasmic reticulum mannosidase I, the enzyme that catalyzes the first mannose trimming step in mammalian Asn-linked oligosaccharide biosynthesis. (PubMed id 10409699)1, 2, 3 Gonzalez D.S....Moremen K.W. (1999)
    3. Polymorphism in the endoplasmic reticulum mannosidase I (MAN1B1) gene is not associated with liver disease in individuals homozygous for the Z variant of the alpha1-antitrypsin protease inhibitor (PiZZ individua ls). (PubMed id 19739260)1, 4, 9 Chappell S....Kalsheker N. (2009)
    4. Mutations in the alpha 1,2-mannosidase gene, MAN1B1, cause autosomal- recessive intellectual disability. (PubMed id 21763484)1, 2 Rafiq M.A....Najmabadi H. (2011)
    5. Single nucleotide polymorphism-mediated translational suppression of endoplasmic reticulum mannosidase I modifies the onset of end-s tage liver disease in alpha1-antitrypsin deficiency. (PubMed id 19444872)1, 4 Pan S....Sifers R.N. (2009)
    6. Endoplasmic reticulum (ER) mannosidase I is compartmentalized and required for N-glycan trimming to Man5-6GlcNAc2 in glycoprotein ER-associated degradation. (PubMed id 18003979)1, 2 Avezov E....Lederkremer G.Z. (2008)
    7. Mechanism of class 1 (glycosylhydrolase family 47) {alpha}-mannosidases involved in N-glycan processing and endoplasmic reticulum quality control. (PubMed id 15713668)1, 2 Karaveg K....Moremen K.W. (2005)
    8. DNA sequence and analysis of human chromosome 9. (PubMed id 15164053)1, 2 Humphray S.J.... Dunham I. (2004)
    9. The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). (PubMed id 15489334)1, 2 Gerhard D.S....Malek J. (2004)
    10. The secreted protein discovery initiative (SPDI), a large-scale effort to identify novel human secreted and transmembrane proteins: a bioinformatics assessment. (PubMed id 12975309)1, 2 Clark H.F.... Gray A.M. (2003)

    (in PubMed, OMIM, and NCBI Bookshelf)
    About This Section
     ANDOR
    Aliases
    Free Text  

      Query String
    PubMed
    OMIM
    NCBI Bookshelf
      (Note: In FireFox, select the above section and copy using Ctrl-C)

    (According to Entrez Gene, HGNC, AceView, euGenes, Ensembl, miRBase, ECgene, Kegg, and/or H-InvDB)
    About This Section
    Entrez Gene: 11253 HGNC: 6823 AceView: MAN1B1 Ensembl:ENSG00000177239 euGenes: HUgn11253
    ECgene: MAN1B1 Kegg: 11253 H-InvDB: MAN1B1

    (According to HUGE)
    About This Section
      --

    (According to PharmGKB, ATLAS, HORDE, IMGT, LEIDEN, UniProtKB/Swiss-Prot, and/or UniProtKB/TrEMBL,
    Wikipedia and/or GeneReviews via UniProtKB/Swiss-Prot)
    About This Section
    NameDescription
    PharmGKB entry for MAN1B1 Pharmacogenomics, SNPs, Pathways

    (Patent information from GeneIP,
    Licensable technologies from WIS Yeda, Salk, Tufts,
    IP news from LifeMap Sciences, Inc.)
    About This Section
    Patent Information for MAN1B1 gene:
    Search GeneIP for patents involving MAN1B1

    GeneCards and IP:
    Japan Patent Office Licenses GeneCards     European Patent Office Licenses GeneCards     Improving the IP Search



    (Antibodies, recombinant proteins, and assays from EMD Millipore, R&D Systems, OriGene, QIAGEN, GenScript, Cell Signaling Technology, SABiosciences, Novus Biologicals, Sino Biological, Enzo Life Sciences, Abcam, ProSpec, Cloud-Clone Corp., Thermo Fisher Scientific, LSBio, Gene Editing from DNA2.0 and Sirion Biotech, Clones from EMD Millipore, OriGene, GenScript, Sino Biological, DNA2.0, SwitchGear Genomics, Vector BioLabs, Sirion Biotech, Cell lines from GenScript, and LifeMap BioReagents, PCR Arrays from SABiosciences, Drugs and/or compounds from EMD Millipore, Tocris Bioscience, and/or Enzo Life Sciences, In Situ Hybridization Assays from
    Advanced Cell Diagnostics, Animal models from inGenious Targeting Laboratory, genOway)
    About This Section

     
     EMD Millipore Custom Antibody & Bulk Services
     EMD Millipore Preclinical / Clinical Development Services
     EMD Millipore Immunoassay Services
     EMD Millipore Target Screening & Profiling Services

      
     Browse Antibodies   Browse Cell Culture Products  
     Browse ELISAs   Browse Flow Cytometry Kits  
     Browse Primer Pairs   Browse Kinase Activity Assays/Reagents  
     Browse ELISpot Kits/Development Modules   Browse TFB/Immunoprecipitation Assays  
     Browse Apoptosis Detection Kits/Reagents   Browse Ubiquitin Proteasome Pathway (UPP) Assay Kits/Reagents  
     Browse DNA Damage/Repair Kits/Reagents   Browse Multiplex/Array Assay Kits/Reagents  
     Browse Cell Selection/Detection Kits/Reagents   Browse Secondary Antibodies/Controls/Staining Reagents  
     Browse Protease Activity Assays and Reagents   Browse Recombinant/Natural Proteins  
     Browse Stem Cell Products   Browse Tocris Biochemicals & Compounds  
     Browse cDNA Clones   Browse Proteome Profiler Antibody Arrays  
     OriGene Antibodies for MAN1B1   OriGene RNAi products in human, mouse, rat for MAN1B1  
     OriGene qPCR primer pairs and template standards for MAN1B1   OriGene Protein Over-expression Lysate for MAN1B1  
     OriGene Custom Mass Spec   OriGene clones in human, mouse for MAN1B1  
     OriGene qSTAR qPCR primer pairs in human, mouse for MAN1B1   Browse OriGene full length recombinant human proteins expressed in human HEK293 cells  
     OriGene ORF clones in mouse, rat for MAN1B1   OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling  
     OriGene Custom Antibody Services for MAN1B1   OriGene Custom Protein Services for MAN1B1  

     
     
     QIAGEN Custom miScript Target Protector blocks miRNA-binding site of in human, mouse, rat MAN1B1
     QIAGEN SeqTarget long-range PCR primers for resequencing MAN1B1
     QIAGEN PyroMark CpG Assay predesigned Pyrosequencing DNA Methylation assays in human, mouse, rat MAN1B1
     QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat MAN1B1
     QIAGEN QuantiFast Probe-based Assays in human, mouse, rat MAN1B1
     QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat MAN1B1
     GenScript Custom Purified and Recombinant Proteins Services for MAN1B1 GenScript cDNA clones with any tag delivered in your preferred vector for MAN1B1
     GenScript Custom Assay Services for MAN1B1 GenScript Custom Superior Antibodies Services for MAN1B1
     GenScript Custom overexpressing Cell Line Services for MAN1B1 CloneReady with Over 120,000 Genes
     Gene Synthesis: Any Gene in Any Vector Vector-based siRNA and miRNA, Ready for Transfection
     Gene Mutant Library, Variants up to 10^11 Plasmid Preparation
     Custom Peptide Services
     Search for Antibodies & Assays

     Regulatory tfbs in MAN1B1 promoter
     Search Chromatin IP Primers for MAN1B1
     RT2 qPCR Primer Assay in human, mouse, rat MAN1B1
     Search GNC Networks for MAN1B1
     SABiosciences PCR Arrays including human, mouse, rat MAN1B1
     Tocris compounds for MAN1B1
     Browse Sino Biological Proteins and Antibodies
     Browse Sino Biological Cell Lysates
     cDNA Clones for MAN1B1
     4000+ Proteins
     Search Sino Biological for antibodies, proteins & pathways
     Protein Production Services
     Transfection Reagents
     Protein A/G/L resins
     Isotyping reagents
     Search www.enzolifesciences.com for proteins, assays, substrates, inhibitors & antibodies
     Novus Tissue Slides
     MAN1B1 antibodies
     MAN1B1 proteins
     MAN1B1 lysates
     Antibodies for MAN1B1
     See all of Abcam's Antibodies, Kits and Proteins for MAN1B1
     Custom Antibody / Protein Production Service
     Bulk Purchasing
     Advantages of Rabbit Monoclonal antibodies
     Abcam protocols and scientific support
     Browse ProSpec Recombinant Proteins




     Proteins for MAN1B1
     Antibodies for MAN1B1
     ELISAs for MAN1B1
     CLIAs for MAN1B1
     Search LifeMap BioReagents cell lines for MAN1B1
     Gene Synthesis
     Protein Engineering
     Variant Library Synthesis
     Codon Optimization
     Protein Production and Purification
     Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for MAN1B1
     SwitchGear 3'UTR luciferase reporter plasmids for MAN1B1
     SwitchGear Promoter luciferase reporter plasmids for MAN1B1
     ThermoFisher Antibodies for MAN1B1
     Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat MAN1B1
     inGenious Targeting Laboratory - Custom generated mouse model solutions for MAN1B1
     inGenious Targeting Laboratory - Custom generated inducible mouse model solutions for MAN1B1
    Customized:
     lentivirus for stable overexpression of MAN1B1
     lentivirus expression plasmids for stable overexpression of MAN1B1
     adenovirus for overexpression of MAN1B1
     LSBio Antibodies in human, mouse, rat for MAN1B1
    Customized transgenic rodents for:
     Humanization
     Biomarker expression
     Off-target effect monitoring
     Translational medicine
     Tissue-specific gene expresssion
     Time-controlled gene expresssion
           
    GeneCards Homepage - Last full update: 23 Oct 2013 - Incrementals: 4 Nov 2013 , 7 Nov 2013 , 23 Jan 2014

    View Random Gene

    Category
    (GIFtS: 73)
    transforming growth factor, beta 1
    GIFtS Group
    The GeneCards human gene database gene index: 1 3 5 6 A B C D E F G H I J K L M N O P Q R S T U V W X Y Z 


    Developed at the Crown Human Genome Center, Department of Molecular Genetics, the Weizmann Institute of Science

    Hot genes      Disease genes      MAN1B1 gene at Home site.
    hostname: 356980-web2.xennexinc.com index build: 106 solr: 1.4