Set Analyses:
Advanced Search

Advanced Search

Search By
Section (entire)


MAN1B1 Gene

protein-coding   GIFtS: 68
GCID: GC09P139981

Mannosidase, Alpha, Class 1B, Member 1

  See MAN1B1-related diseases

(According to 1HGNC, 2Entrez Gene,
3UniProtKB/Swiss-Prot, 4UniProtKB/TrEMBL, 5OMIM, 6GeneLoc, 7Ensembl, 8DME, 9miRBase, 10fRNAdb, 12H-InvDB, 13NCBI, 14NONCODE, and/or 15RNAdb)
About This Section

TryGeneCards Plus

Mannosidase, Alpha, Class 1B, Member 11 2     MANA-ER2
Man9GlcNAc2-Specific Processing Alpha-Mannosidase1 2     Endoplasmic Reticulum Mannosyl-Oligosaccharide 1,2-Alpha-Mannosidase2
MRT152 5     Endoplasmic Reticulum Mannosyl-Oligosaccharide 1,2-Alpha-Mannosidase 12
2-Alpha-Mannosidase 11     ER Alpha 1,2-Mannosidase2
2-mannosidase1     EC
Alpha 11     ERMan13
Endoplasmic Reticulum Alpha-Mannosidase 11     ER Alpha-1,2-Mannosidase3
Endoplasmic Reticulum Mannosyl-Oligosaccharide 11     ER Mannosidase 13
ER Alpha 11     Man9GlcNAc2-Specific-Processing Alpha-Mannosidase3
ERMAN12     Mannosidase Alpha Class 1B Member 13

External Ids:    HGNC: 68231   Entrez Gene: 112532   Ensembl: ENSG000001772397   OMIM: 6043465   UniProtKB: Q9UKM73   

Export aliases for MAN1B1 gene to outside databases

Previous GC identifers: GC09U990101 GC09P131671 GC09P133422 GC09P135338 GC09P137257 GC09P139101 GC09P109441

(According to Entrez Gene, GeneCards, Tocris Bioscience, Wikipedia's Gene Wiki, PharmGKB,
UniProtKB/Swiss-Prot, and/or UniProtKB/TrEMBL)
About This Section

TryGeneCards Plus

Entrez Gene summary for MAN1B1 Gene:
This gene encodes an enzyme belonging to the glycosyl hydrolase 47 family. This enzyme functions in N-glycan
biosynthesis, and is a class I alpha-1,2-mannosidase that specifically converts Man9GlcNAc to Man8GlcNAc isomer
B. It is required for N-glycan trimming to Man5-6GlcNAc2 in the endoplasmic-reticulum-associated degradation
pathway. Mutations in this gene cause autosomal-recessive intellectual disability. Alternative splicing results
in multiple transcript variants. A related pseudogene has been identified on chromosome 11. (provided by RefSeq,
Dec 2011)

GeneCards Summary for MAN1B1 Gene:
MAN1B1 (mannosidase, alpha, class 1B, member 1) is a protein-coding gene. Diseases associated with MAN1B1 include man1b1-cdg, and intellectual disability. GO annotations related to this gene include mannosyl-oligosaccharide 1,2-alpha-mannosidase activity and calcium ion binding. An important paralog of this gene is MAN1A1.

UniProtKB/Swiss-Prot: MA1B1_HUMAN, Q9UKM7
Function: Involved in glycoprotein quality control targeting of misfolded glycoproteins for degradation. It
primarily trims a single alpha-1,2-linked mannose residue from Man(9)GlcNAc(2) to produce Man(8)GlcNAc(2), but at
high enzyme concentrations, as found in the ER quality control compartment (ERQC), it further trims the
carbohydrates to Man(5-6)GlcNAc(2)

summary for MAN1B1 Gene:
Mannosidases are divided into two subtypes; I and II, (EC numbers and respectively)
which display a wide expression pattern. Mannosidase I hydrolyzes (1,2)-linked alpha-D-mannose residues in
the oligo-mannose oligosaccharide Man9(GlcNAc)2 and mannosidase II hydrolyzes (1,3)- and (1,6)-linked
alpha-D-mannose residues in Man5(GlcNAc)3. Both subtypes require a divalent cation cofactor. Mutations in
mannosidases can cause mannosidosis (mannosidase I deficiency).

Gene Wiki entry for MAN1B1 Gene

(According to GeneLoc and/or HGNC, and/or
Entrez Gene (NCBI build 37),
and/or miRBase,
Genomic Views according to UCSC (hg19) and Ensembl (release 75), Regulatory elements and Epigenetics data according to QIAGEN, and/or SwitchGear Genomics)
About This Section

TryGeneCards Plus
RefSeq DNA sequence at NCBI GenBank:
NC_000009.11  NT_008470.20  NC_018920.2  
Regulatory elements:
   Regulatory transcription factor binding sites in the MAN1B1 gene promoter:
         HOXA9B   HOXA9   AhR   Pax-5   Meis-1b   Arnt   HSF2   Meis-1   
         Other transcription factors

SwitchGear Promoter luciferase reporter plasmidMAN1B1 promoter sequence
   Search Chromatin IP Primers for MAN1B1

DNA Methylation CpG Assay Predesigned for Pyrosequencing in human, mouse, rat MAN1B1

Genomic Location:
Genomic View: UCSC Golden Path with GeneCards custom track

Entrez Gene cytogenetic band: 9q34   Ensembl cytogenetic band:  9q34.3   HGNC cytogenetic band: 9q34.3

MAN1B1 Gene in genomic location: bands according to Ensembl, locations according to (and/or Entrez Gene and/or Ensembl if different)
MAN1B1 gene location

GeneLoc information about chromosome 9         GeneLoc Exon Structure

GeneLoc location for GC09P139981:  view genomic region     (about GC identifiers)

139,981,379 bp from pter      End:
140,003,639 bp from pter
22,261 bases      Orientation:
plus strand

(According to 1UniProtKB, HORDE, 2neXtProt, Ensembl, and/or Reactome, Modification sites according to PhosphoSitePlus, Specific Peptides from DME, RefSeq according to NCBI, PDB rendering according to OCA and/or Proteopedia, Recombinant Proteins from EMD Millipore, R&D Systems, GenScript, Enzo Life Sciences, OriGene, Novus Biologicals, Sino Biological, ProSpec, Cloud-Clone Corp., eBioscience, and/or antibodies-online,
Biochemical Assays by EMD Millipore, R&D Systems, OriGene, GenScript, Cell Signaling Technology, Enzo Life Sciences, Cloud-Clone Corp., eBioscience, and/or antibodies-online, Antibodies by EMD Millipore, R&D Systems, Cell Signaling Technology, OriGene, Novus Biologicals, Thermo Fisher Scientific, Abcam, Cloud-Clone Corp, antibodies-online, and/or others.)
About This Section

TryGeneCards Plus

UniProtKB/Swiss-Prot: MA1B1_HUMAN, Q9UKM7 (See protein sequence)
Recommended Name: Endoplasmic reticulum mannosyl-oligosaccharide 1,2-alpha-mannosidase  
Size: 699 amino acids; 79580 Da
Cofactor: Calcium
Caution: It is uncertain whether Met-1 or Met-37 is the initiator
4 PDB 3D structures from and Proteopedia for MAN1B1:
1FMI (3D)        1FO2 (3D)        1FO3 (3D)        1X9D (3D)    
Secondary accessions: Q5VSG3 Q9BRS9 Q9Y5K7

Explore the universe of human proteins at neXtProt for MAN1B1: NX_Q9UKM7

Explore proteomics data for MAN1B1 at MOPED

Post-translational modifications: 

  • Glycosylation2 at Ser174, Thr204, Thr219, Ser223, Thr230, Thr239, Thr242, Thr381, Thr508
  • Modification sites at PhosphoSitePlus

  • See MAN1B1 Protein Expression from SPIRE MOPED, PaxDB, and MaxQB

    REFSEQ proteins: NP_057303.2  
    ENSEMBL proteins: 
     ENSP00000360645   ENSP00000444966   ENSP00000441398   ENSP00000440314   ENSP00000444189  
     ENSP00000440616   ENSP00000447256   ENSP00000448658   ENSP00000450147  
    Reactome Protein details: Q9UKM7

    MAN1B1 Human Recombinant Protein Products:

    Browse Purified and Recombinant Proteins at EMD Millipore
    Browse R&D Systems for human recombinant proteins
    Browse recombinant and purified proteins available from Enzo Life Sciences
    Browse OriGene full length recombinant human proteins expressed in human HEK293 cells
    OriGene Protein Over-expression Lysate for MAN1B1
    OriGene Custom MassSpec
    OriGene Custom Protein Services for MAN1B1
    GenScript Custom Purified and Recombinant Proteins Services for MAN1B1
    Novus Biologicals MAN1B1 Protein
    Novus Biologicals MAN1B1 Lysate
    Browse Sino Biological Recombinant Proteins
    Browse Sino Biological Cell Lysates
    Browse ProSpec Recombinant Proteins
    Cloud-Clone Corp. Proteins for MAN1B1

    Search eBioscience for Proteins for MAN1B1 

    antibodies-online proteins for MAN1B1 (6 products) 

    Search antibodies-online for peptides for MAN1B1

    MAN1B1 Antibody Products:

    Browse EMD Millipore's Extensive Line of Mono- and Polyclonal Antibodies
    Browse R&D Systems for Antibodies
    OriGene Antibodies for MAN1B1
    OriGene Custom Antibody Services for MAN1B1
    Novus Biologicals MAN1B1 Antibodies
    Abcam antibodies for MAN1B1
    Cloud-Clone Corp. Antibodies for MAN1B1
    ThermoFisher Antibodies for MAN1B1
    antibodies-online antibodies for MAN1B1 (18 products) 

    MAN1B1 Assay Products:

    Browse Kits and Assays available from EMD Millipore
    OriGene Custom Assay Services for MAN1B1
    Browse R&D Systems for biochemical assays
    GenScript Custom Assay Services for MAN1B1
    Browse Enzo Life Sciences for kits & assays
    Cloud-Clone Corp. ELISAs for MAN1B1
    Cloud-Clone Corp. CLIAs for MAN1B1
    Search eBioscience for ELISAs for MAN1B1 
    antibodies-online kits for MAN1B1 (6 products) 

    (According to HGNC, IUPHAR, InterPro, ProtoNet, UniProtKB, and/or BLOCKS, Sets of similar genes according to GeneDecks)
    About This Section

    TryGeneCards Plus
    1 InterPro protein domain:
     IPR001382 Glyco_hydro_47

    Graphical View of Domain Structure for InterPro Entry Q9UKM7

    ProtoNet protein and cluster: Q9UKM7

    1 Blocks protein domain: IPB001382 Glycosyl hydrolase family 47 signature

    UniProtKB/Swiss-Prot: MA1B1_HUMAN, Q9UKM7
    Similarity: Belongs to the glycosyl hydrolase 47 family

    Find genes that share domains with MAN1B1           About GenesLikeMe

    (According to 1UniProtKB, Genatlas, LifeMap Discovery™, IUBMB, and/or 2DME, Human phenotypes from GenomeRNAi, Animal models from MGI Mar 06 2013, genOway,
    transcription factor targeting from QIAGEN and/or HOMER, miRNA Gene Targets from miRTarBase, shRNA from OriGene, siRNAs from OriGene, QIAGEN, microRNA from QIAGEN, SwitchGear Genomics, Gene Editing from DNA2.0, Clones from OriGene, GenScript, Sino Biological, DNA2.0, Vector BioLabs and/or Addgene, Cell Lines from GenScript, ESI BIO, In Situ Hybridization Assays from Advanced Cell Diagnostics, Flow cytometry from eBioscience, Ontologies according to Gene Ontology Consortium 01 Apr 2014 via Entrez Gene.)
    About This Section

    TryGeneCards Plus

    Molecular Function:

         UniProtKB/Swiss-Prot Summary: MA1B1_HUMAN, Q9UKM7
    Function: Involved in glycoprotein quality control targeting of misfolded glycoproteins for degradation. It
    primarily trims a single alpha-1,2-linked mannose residue from Man(9)GlcNAc(2) to produce Man(8)GlcNAc(2), but at
    high enzyme concentrations, as found in the ER quality control compartment (ERQC), it further trims the
    carbohydrates to Man(5-6)GlcNAc(2)
    Catalytic activity: Hydrolysis of the terminal (1->2)-linked alpha-D-mannose residues in the oligo-mannose
    oligosaccharide Man(9)(GlcNAc)(2)
    Enzyme regulation: Inhibited by both 1-deoxymannojirimycin (dMNJ) and kifunensine
    Biophysicochemical properties: Kinetic parameters: KM=0.4 mM for Man9GlcNAc2; pH dependence: Optimum pH is between
    6.5 and 6.9;

         Enzyme Number (IUBMB): EC

         Gene Ontology (GO): 2 molecular function terms:    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0004571mannosyl-oligosaccharide 1,2-alpha-mannosidase activity TAS10521544
    GO:0005509calcium ion binding TAS10521544
    Find genes that share ontologies with MAN1B1           About GenesLikeMe

         1 GenomeRNAi human phenotype for MAN1B1:
     Increased gamma-H2AX phosphory 

    Animal Models:
       genOway: Develop your customized and physiologically relevant rodent model for MAN1B1

    miRTarBase miRNAs that target MAN1B1:
    hsa-mir-1 (MIRT023765)

    Block miRNA regulation of human, mouse, rat MAN1B1 using miScript Target Protectors
    Selected qRT-PCR Assays for microRNAs that regulate MAN1B1 (see all 9):
    hsa-miR-30c hsa-miR-125a-5p hsa-miR-30d hsa-miR-30a hsa-miR-670 hsa-miR-125b hsa-miR-30b hsa-miR-30e
    SwitchGear 3'UTR luciferase reporter plasmidMAN1B1 3' UTR sequence
    Inhib. RNA
    OriGene RNAi products in human, mouse, rat for MAN1B1
    Predesigned siRNA for gene silencing in human, mouse, rat MAN1B1

    Gene Editing
    DNA2.0 Custom Protein Engineering Service for MAN1B1

    OriGene clones in human, mouse for MAN1B1 (see all 7)
    OriGene ORF clones in mouse, rat for MAN1B1
    OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
    GenScript: all cDNA clones in your preferred vector: MAN1B1 (NM_016219)
    Sino Biological Human cDNA Clone for MAN1B1
    DNA2.0 Custom Codon Optimized Gene Synthesis Service for MAN1B1
    Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat MAN1B1

    Cell Line
    GenScript Custom overexpressing Cell Line Services for MAN1B1
    Browse ESI BIO Cell Lines and PureStem Progenitors for MAN1B1 
    In Situ Assay

    Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for MAN1B1

    (According to UniProtKB, COMPARTMENTS Subcellular localization database, Ontologies according to Gene Ontology Consortium 01 Apr 2014 via Entrez Gene.)
    About This Section

    TryGeneCards Plus

    Subcellular locations from UniProtKB/Swiss-Prot
    MA1B1_HUMAN, Q9UKM7: Endoplasmic reticulum membrane; Single-pass type II membrane protein
    Subcellular locations from COMPARTMENTS: 

    endoplasmic reticulum5
    golgi apparatus2
    plasma membrane1

    Gene Ontology (GO): 5 cellular component terms:    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0005783endoplasmic reticulum IDA18003979
    GO:0005789endoplasmic reticulum membrane IEA--
    GO:0016020membrane IDA18003979
    GO:0016021integral component of membrane TAS10521544
    GO:0044322endoplasmic reticulum quality control compartment TAS--

    Find genes that share ontologies with MAN1B1           About GenesLikeMe

    (SuperPaths according to PathCards, Pathways according to R&D Systems, Cell Signaling Technology, KEGG, PharmGKB, BioSystems, Sino Biological, Reactome, Tocris Bioscience, GeneGo (Thomson Reuters), QIAGEN, and/or UniProtKB, Sets of similar genes according to GeneDecks, Interaction Networks according to QIAGEN, and/or STRING, Interactions according to 1UniProtKB, 2MINT, 3I2D, and/or 4STRING, with links to IntAct and Ensembl, Ontologies according to Gene Ontology Consortium 01 Apr 2014 via Entrez Gene).
    About This Section

    TryGeneCards Plus

    SuperPaths for MAN1B1 About    
    See pathways by source

    SuperPathContained pathways About
    1Biosynthesis of the N-glycan precursor (dolichol lipid-linked oligosaccharide, LLO) and transfer to a nascent protein
    Asparagine N-linked glycosylation0.49
    Calnexin/calreticulin cycle0.00
    N-Glycan biosynthesis0.49
    N-glycan trimming in the ER and Calnexin/Calreticulin cycle0.00
    Post-translational protein modification0.43
    ER Quality Control Compartment (ERQC)0.00
    Metabolism of proteins0.30
    Metabolic pathways0.38
    3Mechanisms of CFTR activation by S nitrosoglutathione normal and CF
    CFTR folding and maturation norm and CF 0.37
    4Protein processing in endoplasmic reticulum
    Protein processing in endoplasmic reticulum

    Find genes that share SuperPaths with MAN1B1           About GenesLikeMe

    Pathways by source                                                                                                                                                                 See SuperPaths
    Show all pathways

    1 GeneGo (Thomson Reuters) Pathway for MAN1B1
        CFTR folding and maturation (norm and CF)

    1 Reactome Pathway for MAN1B1
        ER Quality Control Compartment (ERQC)

    3 Kegg Pathways  (Kegg details for MAN1B1):
        N-Glycan biosynthesis
    Metabolic pathways
    Protein processing in endoplasmic reticulum

    UniProtKB/Swiss-Prot: MA1B1_HUMAN, Q9UKM7
    Pathway: Protein modification; protein glycosylation

        Pathway & Disease-focused RT2 Profiler PCR Array including MAN1B1: 

              Glycosylation in human mouse rat


        Search GeneGlobe Interaction Network for MAN1B1

    STRING Interaction Network Preview (showing 5 interactants - click image to see 13)

    Selected Interacting proteins for MAN1B1 (Q9UKM72, 3 ENSP000003606454) via UniProtKB, MINT, STRING, and/or I2D (see all 24)
    InteractantInteraction Details
    GeneCardExternal ID(s)
    DNM2P505702, 3, ENSP000003527214MINT-8254454 I2D: score=2 STRING: ENSP00000352721
    RER1O152583, ENSP000003020884I2D: score=1 STRING: ENSP00000302088
    UBCP0CG483, ENSP000003448184I2D: score=1 STRING: ENSP00000344818
    HACL1Q9UJ833I2D: score=1 
    HSPA5P110213I2D: score=1 
    About this table

    Gene Ontology (GO): Selected biological process terms (see all 7):    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0006457protein folding TAS--
    GO:0006487protein N-linked glycosylation NAS10521544
    GO:0009311oligosaccharide metabolic process TAS10409699
    GO:0018279protein N-linked glycosylation via asparagine TAS--
    GO:0030433ER-associated ubiquitin-dependent protein catabolic process IMP18003979

    Find genes that share ontologies with MAN1B1           About GenesLikeMe

    (Chemical Compounds according to UniProtKB, Enzo Life Sciences, EMD Millipore, Tocris Bioscience, ApexBio, HMDB, BitterDB, and/or Novoseek, Ligands according to IUPHAR, and Drugs according to DrugBank, Enzo Life Sciences, and/or PharmGKB)
    About This Section

    TryGeneCards Plus
    Browse Small Molecules at EMD Millipore
       Browse drugs & compounds from Enzo Life Sciences
      Browse compounds at ApexBio 

    Compounds for MAN1B1 available from Tocris Bioscience    About this table
    CompoundAction CAS #
    KifunensineInhibitor of class I alpha-mannosidases[109944-15-2]
    1-DeoxynojirimycinGlucosidase I and II inhibitor[19130-96-2]
    1-Deoxymannojirimycin hydrochloridealpha-Mannosidase I inhibitor[73465-43-7]
    Miglitolalpha-glucosidase inhibitor[72432-03-2]
    OGT 2115Antiangiogenic. Heparanase inhibitor[853929-59-6]

    3 HMDB Compounds for MAN1B1    About this table
    CompoundSynonyms CAS #PubMed Ids
    CalciumCa (see all 2)7440-70-2--
    D-MannoseDL-mannose (see all 13)3458-28-4--
    WaterDihydrogen oxide (see all 2)7732-18-5--

    5 DrugBank Compounds for MAN1B1    About this table
    CompoundSynonyms CAS #TypeActionsPubMed Ids
    Alpha-D-Mannose-- 3458-28-4target--17139284 17016423 10592235
    1,4-Butanediol-- 110-63-4target--17139284 17016423
    Kifunensine-- 109944-15-2target--17139284 17016423
    Methyl-2-S-(Alpha-D-Mannopyranosyl)-2-Thio-Alpha-D-Mannopyranoside-- --target--17139284 17016423
    1-Deoxynojirimycin1-Deoxy-Nojirimycin (see all 7)19130-96-2target--10592235

    (Secondary structures according to fRNAdb,
    GenBank/EMBL/DDBJ Accessions according to
    Unigene (Build 236 Homo sapiens; Apr 25 2013) or GenBank,
    RefSeq according to Entrez Gene,
    DOTS (version 10), and/or AceView, transcript ids from Ensembl with links to UCSC,
    exon structure from GeneLoc, alternative splicing isoforms according to ASD and/or ECgene,
    siRNAs from OriGene, QIAGEN, shRNA from OriGene, microRNA from QIAGEN, SwitchGear Genomics,
    Tagged/untagged cDNA clones from OriGene, GenScript, DNA2.0, Vector BioLabs, and/or Addgene, Primers from OriGene, and/or QIAGEN, Flow cytometry from eBioscience )
    About This Section

    TryGeneCards Plus

    REFSEQ mRNAs for MAN1B1 gene: 

    Unigene Cluster for MAN1B1:

    Mannosidase, alpha, class 1B, member 1
    Hs.279881  [show with all ESTs]
    Unigene Representative Sequence: NR_045721
    16 Ensembl transcripts including schematic representations, and UCSC links where relevant:
    ENST00000371589(uc011meo.1 uc011mep.2 uc004cld.2 uc010ncc.2)
    ENST00000544448 ENST00000535144 ENST00000545539 ENST00000371587(uc004clc.2)
    ENST00000542372 ENST00000545096 ENST00000540346 ENST00000474902 ENST00000536349
    ENST00000540391(uc004clf.1) ENST00000535028 ENST00000480100 ENST00000536268
    ENST00000475449 ENST00000550113
    Block miRNA regulation of human, mouse, rat MAN1B1 using miScript Target Protectors
    Selected qRT-PCR Assays for microRNAs that regulate MAN1B1 (see all 9):
    hsa-miR-30c hsa-miR-125a-5p hsa-miR-30d hsa-miR-30a hsa-miR-670 hsa-miR-125b hsa-miR-30b hsa-miR-30e
    SwitchGear 3'UTR luciferase reporter plasmidMAN1B1 3' UTR sequence
    Inhib. RNA
    OriGene RNAi products in human, mouse, rat for MAN1B1
    Predesigned siRNA for gene silencing in human, mouse, rat MAN1B1
    OriGene clones in human, mouse for MAN1B1 (see all 7)
    OriGene ORF clones in mouse, rat for MAN1B1
    OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
    GenScript: all cDNA clones in your preferred vector: MAN1B1 (NM_016219)
    DNA2.0 Custom Codon Optimized Gene Synthesis Service for MAN1B1
    Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat MAN1B1
    OriGene qPCR primer pairs and template standards for MAN1B1
    OriGene qSTAR qPCR primer pairs in human, mouse for MAN1B1
    Pre-validated RT2 qPCR Primer Assay in human, mouse, rat MAN1B1
      QuantiTect SYBR Green Assays in human, mouse, rat MAN1B1
      QuantiFast Probe-based Assays in human, mouse, rat MAN1B1

    Additional mRNA sequence: 

    AF145732.1 AF148509.1 AK074559.1 AK074699.1 AK130143.1 AK298480.1 AK309808.1 AK315797.1 
    AY358465.1 BC002953.1 BC006079.1 NR_045720.1 NR_045721.1 

    21 DOTS entries:

    DT.114957  DT.91698922  DT.91965231  DT.100790680  DT.101985319  DT.75157921  DT.101985320  DT.40217466 
    DT.100790683  DT.100790686  DT.92000822  DT.92038235  DT.95279716  DT.95279724  DT.100790687  DT.95151625 
    DT.95279714  DT.95279725  DT.95279730  DT.97864225  DT.99944052 

    Selected AceView cDNA sequences (see all 317):

    AL556479 BE389207 BX094536 AW166519 BQ218308 NM_016219 BU182640 BC002953 
    BE391009 AA603464 AA508844 AI608918 AI811801 AL134391 BU538366 BI869581 
    AW590093 BE709955 AK128033 CA454425 AI745062 AI613099 BF054944 AI652343 

    GeneLoc Exon Structure

    Selected Alternative Splicing Database (ASD) splice patterns (SP) for MAN1B1 (see all 11)    About this scheme

    ExUns: 1 ^ 2a · 2b ^ 3a · 3b ^ 4 ^ 5 ^ 6a · 6b · 6c ^ 7 ^ 8 ^ 9a · 9b ^ 10a · 10b · 10c ^ 11 ^ 12a · 12b ^ 13a · 13b ^ 14a · 14b · 14c ^ 15a ·
    SP1:        -     -           -           -                                                                 -     -           -                                 
    SP2:                                                                                                        -     -           -                                 
    SP3:        -     -           -           -                                                                                                                     
    SP4:                                                                                                                          -                                 
    SP5:                                                                                                        -     -           -                                 

    ExUns: 15b ^ 16a · 16b · 16c
    SP1:  -                     
    SP2:  -                     
    SP4:  -                     

    ECgene alternative splicing isoforms for MAN1B1

    (RNA expression data according to H-InvDB, NONCODE, miRBase, and RNAdb, Expression images according to data from BioGPS, Illumina Human BodyMap, and CGAP SAGE, Sets of similar genes according to GeneDecks, in vivo and in vitro expression data from LifeMap Discovery™, Protein expression images according to data from SPIRE 1MOPED, 2PaxDb, and 3MaxQB, plus additional links to SOURCE, and/or BioGPS, and/or UniProtKB,
    PCR Arrays from QIAGEN, Primers from OriGene, and/or QIAGEN, In Situ Hybridization Assays from Advanced Cell Diagnostics)
    About This Section

    TryGeneCards Plus

    MAN1B1 expression in normal human tissues (normalized intensities)
    See probesets specificity/sensitivity at GeneAnnot
    About this imageBioGPS <intensity>2/3
    MAN1B1 Expression
    About this image

    MAN1B1 Protein expression data from MOPED1, PaxDb2 and MaxQB3    About this image

    MAN1B1 Protein Expression

    SOURCE GeneReport for Unigene cluster: Hs.279881

    UniProtKB/Swiss-Prot: MA1B1_HUMAN, Q9UKM7
    Tissue specificity: Widely expressed

        Pathway & Disease-focused RT2 Profiler PCR Array including MAN1B1: 
              Glycosylation in human mouse rat

    OriGene qPCR primer pairs and template standards for MAN1B1
    OriGene qSTAR qPCR primer pairs in human, mouse for MAN1B1
    Pre-validated RT2 qPCR Primer Assay in human, mouse, rat MAN1B1
    QuantiTect SYBR Green Assays in human, mouse, rat MAN1B1
    QuantiFast Probe-based Assays in human, mouse, rat MAN1B1
    In Situ
    Assay Products:

    Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for MAN1B1

    (Orthologs according to 1,2HomoloGene (2older version, for species not in 1newer version), 3euGenes, 4SGD , 5MGI Mar 06 2013, with possible further links to Flybase and/or WormBase, and/or 6Ensembl pan taxonomic compara , Gene Trees according to Ensembl and TreeFam)
    About This Section

    TryGeneCards Plus

    This gene was present in the common ancestor of eukaryotes.

    Orthologs for MAN1B1 gene from Selected species (see all 18)    About this table
    Organism Taxonomic
    Gene Description Human
    (Mus musculus)
    Mammalia Man1b11 , 5 mannosidase, alpha, class 1B, member 11, 5 79.5(n)1
      2 (17.17 cM)5
    2276191  NM_001029983.21  NP_001025154.11 
    (Gallus gallus)
    Aves MAN1B11 mannosidase, alpha, class 1B, member 1 69.37(n)
      417296  XM_415569.4  XP_415569.4 
    (Anolis carolinensis)
    Reptilia MAN1B16
    mannosidase, alpha, class 1B, member 1
    1 ↔ 1
    tropical clawed frog
    (Xenopus tropicalis)
    Amphibia man1b11 mannosidase, alpha, class 1B, member 1 69.39(n)
      100145194  NM_001126684.1  NP_001120156.1 
    (Danio rerio)
    Actinopterygii BM103988.12   -- 79.72(n)    BM103988.1 
    fruit fly
    (Drosophila melanogaster)
    Insecta CG118743
    alpha Mannosidase Ib1
    434361  NM_143410.41  NP_651667.11 
    (Caenorhabditis elegans)
    Secernentea T03G11.41 , 3 man(9)-alpha-mannosidase3
    (best of 2)3
    1807871  NM_076476.41  NP_508877.11 
    baker's yeast
    (Saccharomyces cerevisiae)
    Saccharomycetes MNS1(YJR131W)4 Alpha-1,2-mannosidase involved in ER quality control; more   --   10(667644-669293) 853595  NP_012665.1 
    thale cress
    (Arabidopsis thaliana)
    eudicotyledons MNS31 MNS3 53.24(n)
      839879  NM_102740.2  NP_564345.1 
    (Oryza sativa)
    Liliopsida Os.213432 Oryza sativa (japonica cultivar-group) cDNA cloneJ more 74.71(n)    AK069043.1 

    ENSEMBL Gene Tree for MAN1B1 (if available)
    TreeFam Gene Tree for MAN1B1 (if available)

    (Paralogs according to 1HomoloGene,
    2Ensembl, and 3SIMAP, Pseudogenes according to Build 68)
    About This Section

    TryGeneCards Plus
    Paralogs for MAN1B1 gene
    MAN1A12  MAN1C12  MAN1A22  
    8 SIMAP similar genes for MAN1B1 using alignment to 9 protein entries:     MA1B1_HUMAN (see all proteins):
    DKFZp686C04126    DKFZp434I213    pp6318    MAN1C1    MAN1A2    MAN1A1
    EDEM3    EDEM1

    Find genes that share paralogs with MAN1B1           About GenesLikeMe

    2 Pseudogenes for MAN1B1
    PGOHUM00000242215 PGOHUM00000260490

    (SNPs/Variants according to the 1NCBI SNP Database, 2Ensembl, 3PupaSUITE, 4UniProtKB, and DNA2.0, Linkage Disequilibrium by HapMap, Structural Variations(CNVs/InDels/Inversions) from the Database of Genomic Variants, Mutations from the Human Gene Mutation Database (HGMD), the Human Cytochrome P450 Allele Nomenclature Database, and the Locus Specific Mutation Databases (LSDB), Blood group antigen gene mutations by BGMUT, Resequencing Primers, Cancer Mutation PCR Arrays and Assays, and Copy Number PCR Arrays from QIAGEN)
    About This Section

    TryGeneCards Plus

    Selected SNPs for MAN1B1 (see all 1065)    About this table                                 

    Genomic DataTranscription Related DataAllele Frequencies
    SNP IDValidClinical
    Chr 9 posSequence#AA
    Mental retardation, autosomal recessive 15 (MRT15)4--see VAR_0665932 E K mis40--------
    Mental retardation, autosomal recessive 15 (MRT15)4--see VAR_0665922 R C mis40--------
    C,F,A,H--109464973(+) ACCGCG/AATGTC 3 -- ut31 nc-transcript-variant21Minor allele frequency- A:0.43NS EA WA NA 2342
    C--139985997(+) TTTTTG/TAGACA 3 -- int11Minor allele frequency- T:0.50CSA 2
    C--139999788(+) CCACA-/CCATCCACGTG
    3 -- int10--------
    C--139999808(+) TCCCA-/CACGCCATCCA
    3 -- int11Minor allele frequency- CACGCCATCCACGTGAGGCTCCCA:0.00NA 2
    C--140001341(+) AAAAGAAC/-AACGA 3 -- cds1 int11Minor allele frequency- -:0.00NA 2
    C--140001341(+) AAAAAG/CAACGA 3 -- int11Minor allele frequency- C:0.50NA 2
    C--140003529(+) CTGGC-/CCGCCC 3 -- ut31 nc-transcript-variant0--------
    C,F,A,H--140016358(+) AATTGC/TAATGC 3 -- us2k19Minor allele frequency- T:0.21NS EA NA CSA WA 782

    HapMap Linkage Disequilibrium report for MAN1B1 (139981379 - 140003639 bp)

    Structural Variations
         Database of Genomic Variants (DGV) Selected variations for MAN1B1 (see all 38):    About this table    
    Variant IDTypeSubtypePubMed ID
    dgv1342e201CNV Deletion23290073
    esv2422220CNV Deletion17116639
    esv1403415CNV Insertion17803354
    nsv894591CNV Loss21882294
    dgv8445n71CNV Loss21882294
    dgv8441n71CNV Loss21882294
    nsv894521CNV Loss21882294
    nsv894503CNV Loss21882294
    nsv831761CNV Loss17160897
    nsv894570CNV Loss21882294

    Human Gene Mutation Database (HGMD): MAN1B1
    Site Specific Mutation Identification with PCR Assays
    SeqTarget long-range PCR primers for resequencing MAN1B1
    DNA2.0 Custom Variant and Variant Library Synthesis for MAN1B1

    (in which this Gene is Involved, According to MalaCards, OMIM, UniProtKB, the University of Copenhagen DISEASES database, Genatlas, GeneTests, GAD, HuGE Navigator, and/or TGDB.)
    About This Section

    TryGeneCards Plus
    OMIM gene information: 604346   
    OMIM disorders: 614202  
    UniProtKB/Swiss-Prot: MA1B1_HUMAN, Q9UKM7
  • Mental retardation, autosomal recessive 15 (MRT15) [MIM:614202]: A disorder characterized by
    significantly below average general intellectual functioning associated with impairments in adaptive behavior and
    manifested during the developmental period. Note=The disease is caused by mutations affecting the gene
    represented in this entry

  • 4 diseases for MAN1B1:    
    About MalaCards
    man1b1-cdg    intellectual disability    pelvic inflammatory disease    mental retardation, autosomal recessive 43

    Find genes that share disorders with MAN1B1           About GenesLikeMe

    Genetic Association Database (GAD): MAN1B1
    Human Genome Epidemiology (HuGE) Navigator: MAN1B1 (2 documents)

    Export disorders for MAN1B1 gene to outside databases

    (in PubMed. Associations of this gene to articles via 1Entrez Gene, 2UniProtKB/Swiss-Prot, 3HGNC, 4GAD, 5PharmGKB, 6HMDB, 7DrugBank, 8UniProtKB/TrEMBL, 9 Novoseek, and/or 10fRNAdb)
    About This Section

    TryGeneCards Plus

    PubMed articles for MAN1B1 gene, integrated from 10 sources (see all 54):
    (articles sorted by number of sources associating them with MAN1B1)
        Utopia: connect your pdf to the dynamic
    world of online information

    1. Cloning and expression of a specific human alpha1,2-mannosidase that trims Man9GlcNAc2 to Man8GlcNAc2 isomer B during N-glycan biosynthesis. (PubMed id 10521544)1, 2, 3 Tremblay L.O. and Herscovics A. (Glycobiology 1999)
    2. Identification, expression, and characterization of a cDNA encoding human endoplasmic reticulum mannosidase I, the enzyme that catalyzes the first mannose trimming step in mammalian Asn-linked oligosaccharide biosynthesis. (PubMed id 10409699)1, 2, 3 Gonzalez D.S....Moremen K.W. (J. Biol. Chem. 1999)
    3. Polymorphism in the endoplasmic reticulum mannosidase I (MAN1B1) gene is not associated with liver disease in individuals homozygous for the Z variant of the alpha1-antitrypsin protease inhibitor (PiZZ individuals). (PubMed id 19739260)1, 4, 9 Chappell S....Kalsheker N. (Hepatology 2009)
    4. Mutations in the alpha 1,2-mannosidase gene, MAN1B1, cause autosomal- recessive intellectual disability. (PubMed id 21763484)1, 2 Rafiq M.A....Najmabadi H. (Am. J. Hum. Genet. 2011)
    5. Single nucleotide polymorphism-mediated translational suppression of endoplasmic reticulum mannosidase I modifies the onset of end-stage liver disease in alpha1-antitrypsin deficiency. (PubMed id 19444872)1, 4 Pan S....Sifers R.N. (Hepatology 2009)
    6. Endoplasmic reticulum (ER) mannosidase I is compartmentalized and required for N-glycan trimming to Man5-6GlcNAc2 in glycoprotein ER- associated degradation. (PubMed id 18003979)1, 2 Avezov E.... Lederkremer G.Z. (Mol. Biol. Cell 2008)
    7. Mechanism of class 1 (glycosylhydrolase family 47) {alpha}- mannosidases involved in N-glycan processing and endoplasmic reticulum quality control. (PubMed id 15713668)1, 2 Karaveg K.... Moremen K.W. (J. Biol. Chem. 2005)
    8. DNA sequence and analysis of human chromosome 9. (PubMed id 15164053)1, 2 Humphray S.J.... Dunham I. (Nature 2004)
    9. The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). (PubMed id 15489334)1, 2 Gerhard D.S.... Malek J. (Genome Res. 2004)
    10. The secreted protein discovery initiative (SPDI), a large-scale effort to identify novel human secreted and transmembrane proteins: a bioinformatics assessment. (PubMed id 12975309)1, 2 Clark H.F.... Gray A.M. (Genome Res. 2003)

    (in PubMed, OMIM, and NCBI Bookshelf)
    About This Section

    TryGeneCards Plus
    Free Text  

      Query String
    NCBI Bookshelf
      (Note: In FireFox, select the above section and copy using Ctrl-C)

    (According to Entrez Gene, HGNC, AceView, euGenes, Ensembl, miRBase, ECgene, Kegg, and/or H-InvDB)
    About This Section

    TryGeneCards Plus
    Entrez Gene: 11253 HGNC: 6823 AceView: MAN1B1 Ensembl:ENSG00000177239 euGenes: HUgn11253
    ECgene: MAN1B1 Kegg: 11253 H-InvDB: MAN1B1

    (According to HUGE)
    About This Section

    TryGeneCards Plus

    (According to PharmGKB, ATLAS, HORDE, IMGT, LEIDEN, UniProtKB/Swiss-Prot, UniProtKB/TrEMBL, and/or others, e.g. Wikipedia and GeneReviews, via UniProtKB/Swiss-Prot)
    About This Section

    TryGeneCards Plus
    PharmGKB entry for MAN1B1 Pharmacogenomics, SNPs, Pathways

    (Patent information from GeneIP,
    Licensable technologies from WIS Yeda, Salk, Tufts,
    IP news from LifeMap Sciences, Inc.)
    About This Section

    TryGeneCards Plus
    Patent Information for MAN1B1 gene:
    Search GeneIP for patents involving MAN1B1

    GeneCards and IP:
    Japan Patent Office Licenses GeneCards     European Patent Office Licenses GeneCards     Improving the IP Search

    (Antibodies, recombinant proteins, and assays from EMD Millipore, R&D Systems, OriGene, QIAGEN, GenScript, Cell Signaling Technology, Novus Biologicals, Sino Biological, Enzo Life Sciences, Abcam, ProSpec, Cloud-Clone Corp., Thermo Fisher Scientific, eBioscience, antibodies-online, and/or others, Gene Editing from DNA2.0. Clones from OriGene, GenScript, Sino Biological, DNA2.0, SwitchGear Genomics, Vector BioLabs, Addgene, Cell lines from GenScript, and ESI BIO, Flow cytometery from eBioscience, PCR Arrays from QIAGEN, Drugs and/or compounds from EMD Millipore, Tocris Bioscience, Enzo Life Sciences, and/or ApexBio, In Situ Hybridization Assays from
    Advanced Cell Diagnostics, Animal models from genOway)
    About This Section

    TryGeneCards Plus

     EMD Millipore genomic analysis products

     Browse Antibodies   Browse Cell Culture Products  
     Browse ELISAs   Browse Flow Cytometry Kits  
     Browse Primer Pairs   Browse Enzyme Activity Assays/Reagents  
     Browse ELISpot/FluoroSpot Kits/Development Modules   Browse TFB/Immunoprecipitation Assays  
     Browse Apoptosis Detection Kits/Reagents   Browse Ubiquitin Proteasome Pathway (UPP) Assay Kits/Reagents  
     Browse DNA Damage/Repair Kits/Reagents   Browse Luminex Assays  
     Browse Cell Selection/Detection Kits/Reagents   Browse Secondary Antibodies/Controls/Staining Reagents  
     Browse Recombinant/Natural Proteins   Browse Stem Cell Products  
     Browse cDNA Clones   Browse Proteome Profiler Antibody Arrays  
     OriGene Antibodies for MAN1B1   OriGene RNAi products in human, mouse, rat for MAN1B1  
     OriGene qPCR primer pairs and template standards for MAN1B1   OriGene Protein Over-expression Lysate for MAN1B1  
     OriGene Custom Mass Spec   OriGene clones in human, mouse for MAN1B1  
     OriGene qSTAR qPCR primer pairs in human, mouse for MAN1B1   Browse OriGene full length recombinant human proteins expressed in human HEK293 cells  
     OriGene ORF clones in mouse, rat for MAN1B1   OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling  
     OriGene Custom Antibody Services for MAN1B1   OriGene Custom Protein Services for MAN1B1  

     Block miRNA regulation of human, mouse, rat MAN1B1 using miScript Target Protectors SeqTarget long-range PCR primers for resequencing MAN1B1
     DNA Methylation CpG Assay Predesigned for Pyrosequencing in human, mouse, rat MAN1B1 Predesigned siRNA for gene silencing in human, mouse, rat MAN1B1
     QuantiFast Probe-based Assays in human, mouse, rat MAN1B1 QuantiTect SYBR Green Assays in human, mouse, rat MAN1B1
     PCR Arrays including human, mouse, rat MAN1B1 Search Chromatin IP Primers for MAN1B1
     Pre-validated RT2 qPCR Primer Assay in human, mouse, rat MAN1B1  Search GeneGlobe Interaction Network for MAN1B1
     Regulatory tfbs in MAN1B1 promoter
     GenScript Custom Purified and Recombinant Proteins Services for MAN1B1 GenScript cDNA clones with any tag delivered in your preferred vector for MAN1B1
     GenScript Custom Assay Services for MAN1B1 GenScript Custom overexpressing Cell Line Services for MAN1B1
     CloneReady with Over 120,000 Genes  Gene Synthesis: Any Gene in Any Vector
     Vector-based siRNA and miRNA, Ready for Transfection Gene Mutant Library, Variants up to 10^11
     Plasmid Preparation Custom Peptide Services
     Search for Antibodies & Assays

     Tocris compounds for MAN1B1
     Browse Sino Biological Proteins
     Browse Sino Biological Cell Lysates
     cDNA Clones for MAN1B1
     4000+ Proteins
     Search Sino Biological for antibodies, proteins & pathways
     Protein Production Services
     Transfection Reagents
     Protein A/G/L resins
     Isotyping reagents
     Search for proteins, assays, substrates, inhibitors & antibodies

     Novus Tissue Slides
     MAN1B1 antibodies
     MAN1B1 proteins
     MAN1B1 lysates
     Antibodies for MAN1B1
     See all of Abcam's Antibodies, Kits and Proteins for MAN1B1
     Custom Antibody / Protein Production Service
     Bulk Purchasing
     Advantages of Rabbit Monoclonal antibodies
     Abcam protocols and scientific support
     Browse ProSpec Recombinant Proteins
     Proteins for MAN1B1
     Antibodies for MAN1B1
     ELISAs for MAN1B1
     CLIAs for MAN1B1

     Browse ESI BIO Cell Lines and PureStem Progenitors for MAN1B1
     Gene Synthesis
     Protein Engineering
     Variant Library Synthesis
     Codon Optimization
     Protein Production and Purification
     Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for MAN1B1
     SwitchGear 3'UTR luciferase reporter plasmids for MAN1B1
     SwitchGear Promoter luciferase reporter plasmids for MAN1B1
     ThermoFisher Antibodies for MAN1B1
     Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat MAN1B1
     Browse compounds at ApexBio
     Search Addgene for plasmids for MAN1B1
      Search eBioscience for proteins for MAN1B1
      Search eBioscience for elisas for MAN1B1
      eBioscience FlowRNA Probe Sets
     genOway: Develop your customized and physiologically relevant rodent model for MAN1B1
     antibodies-online antibodies for MAN1B1 (18 products)
     antibodies-online kits for MAN1B1 (6 products)
      Search antibodies-online for peptides for MAN1B1
     antibodies-online proteins for MAN1B1 (6 products)
    GeneCards Homepage - Last full update: 7 May 2014 - Incrementals: 9 May 2014 , 2 Jun 2014 , 26 Jun 2014 , 30 Jun 2014 , 21 Aug 2014 , 8 Sep 2014 , 7 Oct 2014

    View Random Gene

    (GIFtS: )
    GIFtS Group
    The GeneCards human gene database gene index: 1 3 5 A B C D E F G H I J K L M N O P Q R S T U V W X Y Z 

    Developed at the Crown Human Genome Center, Department of Molecular Genetics, the Weizmann Institute of Science

    Hot genes      Disease genes      MAN1B1 gene at Home site.
    Version: 3.12.264 25 Dec 2014
    hostname: index build: 128 solr: 1.4