Free for academic non-profit institutions. Other users need a Commercial license

Aliases for MALL Gene

Aliases for MALL Gene

  • Mal, T-Cell Differentiation Protein Like 2 3 5
  • BENE 3 4
  • MAL-Like Protein 3
  • Protein BENE 4

External Ids for MALL Gene

Previous GeneCards Identifiers for MALL Gene

  • GC02U990066
  • GC02M110199
  • GC02M110841
  • GC02M103981

Summaries for MALL Gene

Entrez Gene Summary for MALL Gene

  • This gene encodes an element of the machinery for raft-mediated trafficking in endothelial cells. The encoded protein, a member of the MAL proteolipid family, predominantly localizes in glycolipid- and cholesterol-enriched membrane (GEM) rafts. It interacts with caveolin-1. [provided by RefSeq, Jul 2008]

GeneCards Summary for MALL Gene

MALL (Mal, T-Cell Differentiation Protein Like) is a Protein Coding gene. Diseases associated with MALL include Maxillary Sinus Cancer and Paranasal Sinus Cancer. An important paralog of this gene is MAL2.

Gene Wiki entry for MALL Gene

No data available for CIViC summary , UniProtKB/Swiss-Prot , Tocris Summary , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for MALL Gene

Genomics for MALL Gene

Regulatory Elements for MALL Gene

Enhancers for MALL Gene
GeneHancer Identifier Enhancer Score Enhancer Sources Gene-Enhancer Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor Binding Sites within enhancer Gene Targets for Enhancer
GH02G110111 1.5 FANTOM5 ENCODE dbSUPER 15.3 +3.2 3196 5.9 ELF3 PKNOX1 SIN3A ZNF48 RAD21 FOS IKZF2 ZNF263 ZHX2 JUNB MALL LINC01123 LINC00116 GC02M110047
GH02G110099 1.8 FANTOM5 Ensembl ENCODE dbSUPER 7.8 +13.2 13234 11.8 PKNOX1 FOXA2 ARID4B SIN3A BRCA1 GTF3C2 GLIS2 GATA2 FOS ZNF263 LINC00116 LINC01106 MALL ENSG00000231536 ENSG00000186148 LIMS3 GC02M110047
GH02G110148 1 Ensembl ENCODE 8.1 -31.8 -31848 2.5 CTCF JUN FOSL1 ZFHX2 ZNF316 GATA3 GATA2 EGR1 FOSL2 FOS LINC00116 NPHP1 LINC01123 MALL GC02P110145 GC02P110162
GH02G110155 1 Ensembl ENCODE 7.2 -38.7 -38721 2.1 ELF3 DRAP1 CTCF JUN ZSCAN9 RAD21 TEAD3 SMC3 ZNF143 HOMEZ NPHP1 MALL LINC00116 GC02P110162 GC02P110145
GH02G110118 0.5 dbSUPER 7.7 -1.0 -1046 1.0 CTCF ZNF580 CEBPB MALL GC02M110125
- Elite enhancer and/or Elite enhancer-gene association Download GeneHancer data dump

Enhancers around MALL on UCSC Golden Path with GeneCards custom track

Genomic Location for MALL Gene

110,083,870 bp from pter
110,118,139 bp from pter
34,270 bases
Minus strand

Genomic View for MALL Gene

Genes around MALL on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
MALL Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for MALL Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for MALL Gene

Proteins for MALL Gene

  • Protein details for MALL Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Recommended name:
    MAL-like protein
    Protein Accession:
    Secondary Accessions:
    • B3KWR6
    • Q9BTU0

    Protein attributes for MALL Gene

    153 amino acids
    Molecular mass:
    17350 Da
    Quaternary structure:
    No Data Available

neXtProt entry for MALL Gene

Post-translational modifications for MALL Gene

  • Modification sites at PhosphoSitePlus
  • Modification sites at neXtProt

Other Protein References for MALL Gene

No data available for DME Specific Peptides for MALL Gene

Domains & Families for MALL Gene

Protein Domains for MALL Gene


Suggested Antigen Peptide Sequences for MALL Gene

GenScript: Design optimal peptide antigens:

Graphical View of Domain Structure for InterPro Entry



  • Belongs to the MAL family.
  • Belongs to the MAL family.
genes like me logo Genes that share domains with MALL: view

No data available for Gene Families for MALL Gene

Function for MALL Gene

Molecular function for MALL Gene

GENATLAS Biochemistry:
T-cell differentiation proteolipid protein-like,6kb distal from NPHP1,MAL-like

Gene Ontology (GO) - Molecular Function for MALL Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005515 protein binding IPI 11294831
GO:0019911 structural constituent of myelin sheath IBA --
genes like me logo Genes that share ontologies with MALL: view
genes like me logo Genes that share phenotypes with MALL: view

Animal Model Products

  • Taconic Biosciences Mouse Models for MALL

Inhibitory RNA Products

Clone Products

Flow Cytometry Products

No data available for Enzyme Numbers (IUBMB) , Human Phenotype Ontology , Animal Models , Transcription Factor Targets and HOMER Transcription for MALL Gene

Localization for MALL Gene

Subcellular locations from UniProtKB/Swiss-Prot for MALL Gene

Membrane; Multi-pass membrane protein.

Subcellular locations from

Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for MALL gene
Compartment Confidence
plasma membrane 5
golgi apparatus 4
lysosome 1

Gene Ontology (GO) - Cellular Components for MALL Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0000139 Golgi membrane IDA 11294831
GO:0005886 plasma membrane IDA 11294831
GO:0016020 membrane IEA --
GO:0016021 integral component of membrane IBA,IEA --
GO:0030136 clathrin-coated vesicle IDA 11294831
genes like me logo Genes that share ontologies with MALL: view

Pathways & Interactions for MALL Gene

No Data Available

Gene Ontology (GO) - Biological Process for MALL Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0001766 membrane raft polarization IBA --
GO:0008104 protein localization IBA --
GO:0042552 myelination IBA --
GO:0042632 cholesterol homeostasis NAS 11294831
genes like me logo Genes that share ontologies with MALL: view

No data available for Pathways by source and SIGNOR curated interactions for MALL Gene

Transcripts for MALL Gene

Unigene Clusters for MALL Gene

Mal, T-cell differentiation protein-like:
Representative Sequences:

Inhibitory RNA Products

Clone Products

Flow Cytometry Products

Alternative Splicing Database (ASD) splice patterns (SP) for MALL Gene

ExUns: 1 ^ 2a · 2b · 2c · 2d ^ 3 ^ 4a · 4b ^ 5a · 5b ^ 6a · 6b · 6c · 6d · 6e
SP1: -
SP2: - - - - - -
SP3: - -
SP4: - -
SP6: - - - - -

Relevant External Links for MALL Gene

GeneLoc Exon Structure for
ECgene alternative splicing isoforms for

Expression for MALL Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for MALL Gene

mRNA expression in embryonic tissues and stem cells from LifeMap Discovery

mRNA differential expression in normal tissues according to GTEx for MALL Gene

This gene is overexpressed in Esophagus - Mucosa (x16.4), Vagina (x5.4), and Colon - Transverse (x4.4).

NURSA nuclear receptor signaling pathways regulating expression of MALL Gene:


SOURCE GeneReport for Unigene cluster for MALL Gene:


Evidence on tissue expression from TISSUES for MALL Gene

  • Kidney(4.1)
  • Intestine(2.9)
  • Lung(2.4)
  • Stomach(2.1)
genes like me logo Genes that share expression patterns with MALL: view

Primer Products

No data available for Protein differential expression in normal tissues , Protein expression , Protein tissue co-expression partners , mRNA Expression by UniProt/SwissProt and Phenotype-based relationships between genes and organs from Gene ORGANizer for MALL Gene

Orthologs for MALL Gene

This gene was present in the common ancestor of chordates.

Orthologs for MALL Gene

Organism Taxonomy Gene Similarity Type Details
(Pan troglodytes)
Mammalia MALL 34 35
  • 99.35 (n)
(Canis familiaris)
Mammalia MALL 34 35
  • 84.87 (n)
(Bos Taurus)
Mammalia MALL 34 35
  • 83.77 (n)
(Rattus norvegicus)
Mammalia Mall 34
  • 83.77 (n)
(Mus musculus)
Mammalia Mall 34 16 35
  • 83.55 (n)
(Monodelphis domestica)
Mammalia MALL 35
  • 70 (a)
(Ornithorhynchus anatinus)
Mammalia MALL 35
  • 67 (a)
(Gallus gallus)
Aves MALL 34 35
  • 65.57 (n)
(Anolis carolinensis)
Reptilia MALL 35
  • 62 (a)
tropical clawed frog
(Silurana tropicalis)
Amphibia mall 34
  • 53.94 (n)
Species where no ortholog for MALL was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • fruit fly (Drosophila melanogaster)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea squirt (Ciona intestinalis)
  • sea squirt (Ciona savignyi)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)
  • worm (Caenorhabditis elegans)
  • zebrafish (Danio rerio)

Evolution for MALL Gene

Gene Tree for MALL (if available)
Gene Tree for MALL (if available)

Paralogs for MALL Gene

Paralogs for MALL Gene

(4) SIMAP similar genes for MALL Gene using alignment to 3 proteins: Pseudogenes for MALL Gene

genes like me logo Genes that share paralogs with MALL: view

Variants for MALL Gene

Sequence variations from dbSNP and Humsavar for MALL Gene

SNP ID Clin Chr 02 pos Sequence Context AA Info Type
rs1000096266 -- 110,092,596(+) CTATG(C/T)TTTTT intron-variant
rs1000173500 -- 110,112,418(+) AGTGG(A/G)CCAAG intron-variant
rs1000260220 -- 110,098,610(+) CACTC(A/T)TTTGC intron-variant
rs1000354149 -- 110,105,735(+) AGTTG(A/G)AAGGA intron-variant
rs1000541704 -- 110,117,617(+) TGTGT(-/GTGTGTGTGAGAGAGAGAGA)GAGAG intron-variant, upstream-variant-2KB

Structural Variations from Database of Genomic Variants (DGV) for MALL Gene

Variant ID Type Subtype PubMed ID
dgv1162e212 CNV gain 25503493
dgv1163e212 CNV loss 25503493
dgv154e55 CNV loss 17911159
dgv155e55 CNV gain 17911159
dgv4037n100 CNV gain 25217958
dgv4038n100 CNV loss 25217958
dgv4041n100 CNV gain 25217958
dgv4044n100 CNV gain+loss 25217958
dgv4046n100 CNV loss 25217958
dgv471n27 CNV gain 19166990
dgv472n27 CNV loss 19166990
dgv473n27 CNV gain 19166990
dgv6999n54 CNV gain 21841781
dgv7000n54 CNV loss 21841781
dgv7001n54 CNV gain+loss 21841781
dgv7002n54 CNV loss 21841781
dgv7003n54 CNV loss 21841781
dgv7004n54 CNV gain 21841781
dgv727e214 CNV loss 21293372
dgv728e214 CNV gain 21293372
esv2556499 CNV gain 19546169
esv2751812 CNV loss 17911159
esv33999 CNV loss 18971310
esv3584010 CNV loss 25503493
esv3591955 CNV loss 21293372
esv3591956 CNV gain 21293372
esv3893070 CNV gain+loss 25118596
nsv1003103 CNV gain+loss 25217958
nsv1010477 CNV gain+loss 25217958
nsv1149522 OTHER inversion 26484159
nsv2875 CNV deletion 18451855
nsv458751 CNV loss 19166990
nsv470479 CNV gain 18288195
nsv499578 OTHER inversion 21111241
nsv510884 OTHER complex 20534489
nsv515996 CNV gain+loss 19592680
nsv582654 CNV loss 21841781
nsv582658 CNV loss 21841781
nsv582666 CNV loss 21841781
nsv582670 CNV gain+loss 21841781
nsv7324 OTHER inversion 18451855
nsv818076 CNV loss 17921354
nsv834329 CNV gain 17160897
nsv961859 CNV duplication 23825009
nsv961860 CNV duplication 23825009

Variation tolerance for MALL Gene

Gene Damage Index Score: 0.12; 2.74% of all genes are more intolerant (likely to be disease-causing)

Relevant External Links for MALL Gene

Human Gene Mutation Database (HGMD)
SNPedia medical, phenotypic, and genealogical associations of SNPs for

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for MALL Gene

Disorders for MALL Gene

MalaCards: The human disease database

(3) MalaCards diseases for MALL Gene - From: DISEASES and GeneCards

Disorder Aliases PubMed IDs
maxillary sinus cancer
  • malignant neoplasm of antrum
paranasal sinus cancer
  • adenoid cystic carcinoma of accessory sinus
sinus cancer
- elite association - COSMIC cancer census association via MalaCards
Search MALL in MalaCards View complete list of genes associated with diseases

Relevant External Links for MALL

Human Genome Epidemiology (HuGE) Navigator
Atlas of Genetics and Cytogenetics in Oncology and Haematology:
genes like me logo Genes that share disorders with MALL: view

No data available for UniProtKB/Swiss-Prot and Genatlas for MALL Gene

Publications for MALL Gene

  1. Complete sequencing and characterization of 21,243 full-length human cDNAs. (PMID: 14702039) Ota T. … Sugano S. (Nat. Genet. 2004) 3 4 64
  2. The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). (PMID: 15489334) Gerhard D.S. … Malek J. (Genome Res. 2004) 3 4 64
  3. A novel gene encoding an SH3 domain protein is mutated in nephronophthisis type 1. (PMID: 9326933) Hildebrandt F. … Brandis M. (Nat. Genet. 1997) 2 3 64
  4. A novel gene that encodes a protein with a putative src homology 3 domain is a candidate gene for familial juvenile nephronophthisis. (PMID: 9361039) Saunier S. … Antignac C. (Hum. Mol. Genet. 1997) 3 22 64
  5. Searching for non-V kappa transcripts from the human immunoglobulin kappa locus. (PMID: 7622049) Lautner-Rieske A. … Zachau H.G. (Gene 1995) 3 4 64

Products for MALL Gene

Sources for MALL Gene

Loading form....