Set Analyses:
Advanced Search

Advanced Search

Search By
Section (entire)



protein-coding   GIFtS: 75
GCID: GC01P156053

Lamin A/C

(Previous names: cardiomyopathy, dilated 1A (autosomal dominant), limb girdle...)
(Previous symbols: LMN1, CMD1A, LGMD1B, PRO1, LMNL1)
  See LMNA-related diseases

(According to 1HGNC, 2Entrez Gene,
3UniProtKB/Swiss-Prot, 4UniProtKB/TrEMBL, 5OMIM, 6GeneLoc, 7Ensembl, 8DME, 9miRBase, 10fRNAdb, 12H-InvDB, 13NCBI, 14NONCODE, and/or 15RNAdb)
About This Section

This gene clusters with an RNA gene
Subcategory (RNA class): lncRNA

Quality score for the ORGUL clustered with this gene is 3

Lamin A/C1 2     70 KDa Lamin2
LMN11 2 3 5     CDCD12
CMD1A1 2 5     CDDC2
LGMD1B1 2 5     CMT2B12
LMNL11 2     FPL2
PRO11 2     FPLD2
Lamin A/C-Like 11 2     IDC2
EMD22 5     LDP12
FPLD22 5     LFP2
HGPS2 5     LMNC2
Cardiomyopathy, Dilated 1A (Autosomal Dominant)1     lamin2
Limb Girdle Muscular Dystrophy 1B (Autosomal Dominant)1     prelamin-A/C2
Progeria 1 (Hutchinson-Gilford Type)1     Renal Carcinoma Antigen NY-REN-322

External Ids:    HGNC: 66361   Entrez Gene: 40002   Ensembl: ENSG000001607897   OMIM: 1503305   UniProtKB: P025453   
ORGUL members:         

Export aliases for LMNA gene to outside databases

Previous GC identifiers: GC01P153921 GC01P151817 GC01P152830 GC01P153301 GC01P152897 GC01P154318 GC01P127446

(According to Entrez Gene, GeneCards, Tocris Bioscience, Wikipedia's Gene Wiki, PharmGKB,
UniProtKB/Swiss-Prot, and/or UniProtKB/TrEMBL)
About This Section

Entrez Gene summary for LMNA Gene:
The nuclear lamina consists of a two-dimensional matrix of proteins located next to the inner nuclear membrane.
The lamin family of proteins make up the matrix and are highly conserved in evolution. During mitosis, the lamina
matrix is reversibly disassembled as the lamin proteins are phosphorylated. Lamin proteins are thought to be
involved in nuclear stability, chromatin structure and gene expression. Vertebrate lamins consist of two types, A
and B. Alternative splicing results in multiple transcript variants. Mutations in this gene lead to several
diseases: Emery-Dreifuss muscular dystrophy, familial partial lipodystrophy, limb girdle muscular dystrophy,
dilated cardiomyopathy, Charcot-Marie-Tooth disease, and Hutchinson-Gilford progeria syndrome. (provided by
RefSeq, Apr 2012)

GeneCards Summary for LMNA Gene:
LMNA (lamin A/C) is a protein-coding gene. Diseases associated with LMNA include mandibuloacral dysplasia with type a lipodystrophy, and lmna-related dilated cardiomyopathy. GO annotations related to this gene include structural molecule activity. An important paralog of this gene is DES.

UniProtKB/Swiss-Prot: LMNA_HUMAN, P02545
Function: Lamins are components of the nuclear lamina, a fibrous layer on the nucleoplasmic side of the inner
nuclear membrane, which is thought to provide a framework for the nuclear envelope and may also interact with
chromatin. Lamin A and C are present in equal amounts in the lamina of mammals. Plays an important role in
nuclear assembly, chromatin organization, nuclear membrane and telomere dynamics. Required for normal development
of peripheral nervous system and skeletal muscle and for muscle satellite cell proliferation. Required for
osteoblastogenesis and bone formation. Also prevents fat infiltration of muscle and bone marrow, helping to
maintain the volume and strength of skeletal muscle and bone
Function: Prelamin-A/C can accelerate smooth muscle cell senescence. It acts to disrupt mitosis and induce DNA
damage in vascular smooth muscle cells (VSMCs), leading to mitotic failure, genomic instability, and premature

Gene Wiki entry for LMNA Gene

(According to GeneLoc and/or HGNC, and/or
Entrez Gene (NCBI build 37),
and/or miRBase,
Genomic Views according to UCSC (hg19) and Ensembl (release 75), Regulatory elements and Epigenetics data according to QIAGEN, and/or SwitchGear Genomics)
About This Section

RefSeq DNA sequence at NCBI GenBank:
NC_000001.10  NC_018912.2  NT_004487.20  
Regulatory elements:
   Regulatory transcription factor binding sites in the LMNA gene promoter:
         STAT1   STAT1beta   STAT1alpha   
         Other transcription factors

SwitchGear Promoter luciferase reporter plasmidLMNA promoter sequence
   Search Chromatin IP Primers for LMNA

DNA Methylation CpG Assay Predesigned for Pyrosequencing in human, mouse, rat LMNA

Genomic Location:
Genomic View: UCSC Golden Path with GeneCards custom track

Entrez Gene cytogenetic band: 1q22   Ensembl cytogenetic band:  1q22   HGNC cytogenetic band: 1q22

LMNA Gene in genomic location: bands according to Ensembl, locations according to (and/or Entrez Gene and/or Ensembl if different)
LMNA gene location

GeneLoc information about chromosome 1         GeneLoc Exon Structure

GeneLoc location for GC01P156053:  view genomic region     (about GC identifiers)

156,052,364 bp from pter      End:
156,109,880 bp from pter
57,517 bases      Orientation:
plus strand

(According to 1UniProtKB, HORDE, 2neXtProt, Ensembl, and/or Reactome, Modification sites according to PhosphoSitePlus, Specific Peptides from DME, RefSeq according to NCBI, PDB rendering according to OCA and/or Proteopedia, Recombinant Proteins from EMD Millipore, R&D Systems, GenScript, Enzo Life Sciences, OriGene, Novus Biologicals, Sino Biological, ProSpec, Cloud-Clone Corp., eBioscience, antibodies-online, and/or GeneTex,
Biochemical Assays by EMD Millipore, R&D Systems, OriGene, GenScript, Cell Signaling Technology, Enzo Life Sciences, Cloud-Clone Corp., eBioscience, and/or antibodies-online, Antibodies by EMD Millipore, R&D Systems, Cell Signaling Technology, OriGene, Novus Biologicals, Thermo Fisher Scientific, Abcam, Cloud-Clone Corp, antibodies-online, and/or GeneTex.)
About This Section

UniProtKB/Swiss-Prot: LMNA_HUMAN, P02545 (See protein sequence)
Recommended Name: Prelamin-A/C precursor  
Size: 664 amino acids; 74139 Da
Subunit: Homodimer of lamin A and lamin C. Interacts with lamin-associated polypeptides IA, IB and TMPO-alpha, RB1
and with emerin. Interacts with SREBF1, SREBF2, SUN2 and TMEM43 (By similarity). Proteolytically processed
isoform A interacts with NARF. Interacts with SUN1. Prelamin-A/C interacts with EMD. Interacts with MLIP; may
regulate MLIP localization to the nucleus envelope. Interacts with DMPK; may regulate nuclear envelope stability.
Interacts with SUV39H1; the interaction increases stability of SUV39H1
Miscellaneous: There are three types of lamins in human cells: A, B, and C
Miscellaneous: The structural integrity of the lamina is strictly controlled by the cell cycle, as seen by the
disintegration and formation of the nuclear envelope in prophase and telophase, respectively
Sequence caution: Sequence=CAA27173.1; Type=Frameshift; Positions=582;
Selected PDB 3D structures from and Proteopedia for LMNA (see all 9):
1IFR (3D)        1IVT (3D)        1X8Y (3D)        2XV5 (3D)        2YPT (3D)        3GEF (3D)    
Secondary accessions: B4DI32 D3DVB0 D6RAQ3 E7EUI9 P02546 Q5I6Y4 Q5I6Y6 Q5TCJ2 Q5TCJ3 Q6UYC3
Q969I8 Q96JA2
Alternative splicing: 6 isoforms:  P02545-1   P02545-2   P02545-3   P02545-4   P02545-5   P02545-6   (Disease-associated isoform. Polymorphism at codon 608 results in activation of a cryptic splice donor site within exon 11, resulting in a truncated protein product that lacks the site for endoproteolytic cleavage)

Explore the universe of human proteins at neXtProt for LMNA: NX_P02545

Explore proteomics data for LMNA at MOPED

Post-translational modifications: 

  • Increased phosphorylation of the lamins occurs before envelope disintegration and probably plays a role in
    regulating lamin associations1
  • Proteolytic cleavage of the C-terminal of 18 residues of prelamin-A/C results in the production of lamin-A/C. The
    prelamin-A/C maturation pathway includes farnesylation of CAAX motif, ZMPSTE24/FACE1 mediated cleavage of the
    last three amino acids, methylation of the C-terminal cysteine and endoproteolytic removal of the last 15
    C-terminal amino acids. Proteolytic cleavage requires prior farnesylation and methylation, and absence of these
    blocks cleavage1
  • Sumoylation is necessary for the localization to the nuclear envelope1
  • Farnesylation of prelamin-A/C facilitates nuclear envelope targeting1
  • Ubiquitination2 at Lys78, Lys108, Lys135, Lys144, Lys171, Lys181, Lys201, Lys208, Lys265, Lys270,
                                 Lys311, Lys378, Lys470, Lys486
  • Modification sites at PhosphoSitePlus

  • See LMNA Protein Expression from SPIRE MOPED, PaxDB, and MaxQB

    REFSEQ proteins (7 alternative transcripts): 
    NP_001244303.1  NP_001269553.1  NP_001269554.1  NP_001269555.1  NP_005563.1  NP_733821.1  NP_733822.1  

    ENSEMBL proteins: 
     ENSP00000357284   ENSP00000357283   ENSP00000357282   ENSP00000395597   ENSP00000424518  
     ENSP00000357280   ENSP00000426535   ENSP00000421821   ENSP00000424977   ENSP00000292304  
     ENSP00000355292   ENSP00000376164  
    Reactome Protein details: P02545

    LMNA Human Recombinant Protein Products:

    Browse Purified and Recombinant Proteins at EMD Millipore
    Browse R&D Systems for human recombinant proteins
    Browse recombinant and purified proteins available from Enzo Life Sciences
    OriGene Purified Proteins for LMNA
    OriGene Protein Over-expression Lysate for LMNA
    OriGene MassSpec for LMNA
    OriGene Custom Protein Services for LMNA
    GenScript Custom Purified and Recombinant Proteins Services for LMNA
    Novus Biologicals LMNA Protein
    Novus Biologicals LMNA Lysates
    Browse Sino Biological Recombinant Proteins
    Browse Sino Biological Cell Lysates
    ProSpec Recombinant Protein for LMNA
    Cloud-Clone Corp. Proteins for LMNA

    Search eBioscience for Proteins for LMNA 

    antibodies-online proteins for LMNA (4 products) 

    antibodies-online peptides for LMNA

    Search GeneTex for Proteins for LMNA 

    LMNA Antibody Products:

    EMD Millipore Mono- and Polyclonal Antibodies for the study of LMNA
    Browse R&D Systems for Antibodies
    Cell Signaling Technology (CST) Antibodies for LMNA  (lamin A/C)
    OriGene Antibodies for LMNA
    OriGene Custom Antibody Services for LMNA
    Novus Biologicals LMNA Antibodies
    Abcam antibodies for LMNA (Q6UYC3, P20700, P02545)
    Cloud-Clone Corp. Antibodies for LMNA
    ThermoFisher Antibody for LMNA
    antibodies-online antibodies for LMNA (209 products) 

    GeneTex Antibodies for LMNA:  
                        LMNA Antibodies

    LMNA Assay Products:

    Browse Kits and Assays available from EMD Millipore
    OriGene Custom Assay Services for LMNA
    Browse R&D Systems for biochemical assays
    GenScript Custom Assay Services for LMNA
    Browse Enzo Life Sciences for kits & assays
    Cloud-Clone Corp. ELISAs for LMNA
    Cloud-Clone Corp. CLIAs for LMNA
    Search eBioscience for ELISAs for LMNA 
    antibodies-online kits for LMNA (18 products) 

    (According to HGNC, IUPHAR, InterPro, ProtoNet, UniProtKB, and/or BLOCKS, Sets of similar genes according to GenesLikeMe)
    About This Section

    HGNC Gene Families:
    IFF5: Intermediate filaments type V, lamins

    3 InterPro protein domains:
     IPR018039 Intermediate_filament_CS
     IPR001664 IF
     IPR001322 Lamin_tail_dom

    Graphical View of Domain Structure for InterPro Entry P02545

    ProtoNet protein and cluster: P02545

    2 Blocks protein domains:
    IPB001322 Intermediate filament
    IPB001664 Intermediate filament protein

    UniProtKB/Swiss-Prot: LMNA_HUMAN, P02545
    Similarity: Belongs to the intermediate filament family

    Find genes that share domains with LMNA           About GenesLikeMe

    (According to 1UniProtKB, Genatlas, LifeMap Discovery™, IUBMB, and/or 2DME, Human phenotypes from GenomeRNAi, Animal models from MGI Mar 06 2013, genOway, and/or Taconic Biosciences, CRISPR knockouts from OriGene, transcription factor targeting from QIAGEN and/or HOMER, miRNA Gene Targets from miRTarBase, shRNA from OriGene, siRNAs from OriGene, QIAGEN, microRNA from QIAGEN, SwitchGear Genomics, Clones from OriGene, GenScript, Sino Biological, Vector BioLabs and/or Addgene, Cell Lines from GenScript, ESI BIO, In Situ Hybridization Assays from Advanced Cell Diagnostics, Flow cytometry from eBioscience, Ontologies according to Gene Ontology Consortium 01 Apr 2014 via Entrez Gene, Sets of similar genes according to GenesLikeMe)
    About This Section

    Molecular Function:

         UniProtKB/Swiss-Prot Summary: LMNA_HUMAN, P02545
    Function: Lamins are components of the nuclear lamina, a fibrous layer on the nucleoplasmic side of the inner
    nuclear membrane, which is thought to provide a framework for the nuclear envelope and may also interact with
    chromatin. Lamin A and C are present in equal amounts in the lamina of mammals. Plays an important role in
    nuclear assembly, chromatin organization, nuclear membrane and telomere dynamics. Required for normal development
    of peripheral nervous system and skeletal muscle and for muscle satellite cell proliferation. Required for
    osteoblastogenesis and bone formation. Also prevents fat infiltration of muscle and bone marrow, helping to
    maintain the volume and strength of skeletal muscle and bone
    Function: Prelamin-A/C can accelerate smooth muscle cell senescence. It acts to disrupt mitosis and induce DNA
    damage in vascular smooth muscle cells (VSMCs), leading to mitotic failure, genomic instability, and premature

         Genatlas biochemistry entry for LMNA:
    lamin,types A and C,common gene,alternatively spliced isoforms

         Gene Ontology (GO): 2 molecular function terms:    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0005198structural molecule activity TAS3453101
    GO:0005515protein binding IPI10381623
    Find genes that share ontologies with LMNA           About GenesLikeMe

         3 GenomeRNAi human phenotypes for LMNA:
     Increased S DNA content  Increased gamma-H2AX phosphory  Upregulation of Wnt/beta-caten 

         Selected MGI mutant phenotypes (inferred from 16 alleles(MGI details for Lmna) (see all 25):
     adipose tissue  behavior/neurological  cardiovascular system  cellular  craniofacial 
     digestive/alimentary  endocrine/exocrine gland  growth/size/body  hearing/vestibular/ear  hematopoietic system 
     homeostasis/metabolism  immune system  integument  limbs/digits/tail  liver/biliary system 

    Find genes that share phenotypes with LMNA           About GenesLikeMe

    Animal Models:
         MGI mouse knock-outs for LMNA: Lmnatm6Lgf Lmnatm1Stw Lmnatm4Lgf Lmnatm5Lgf Lmnatm1Lgf Lmnatm2Lgf

       genOway: Develop your customized and physiologically relevant rodent model for LMNA

        Taconic Biosicences: Generate A Custom CRISPR Mouse Model For Your Study 

    CRISPR Knockouts: 
       OriGene CRISPR knockouts for LMNA

    miRTarBase miRNAs that target LMNA:
    hsa-mir-615-3p (MIRT040169), hsa-mir-296-3p (MIRT038445), hsa-let-7a-5p (MIRT052409), hsa-mir-340-5p (MIRT019532), hsa-mir-124-3p (MIRT022394), hsa-mir-9-5p (MIRT021388), hsa-let-7e-5p (MIRT051592)

    Block miRNA regulation of human, mouse, rat LMNA using miScript Target Protectors
    Selected qRT-PCR Assays for microRNAs that regulate LMNA (see all 15):
    hsa-miR-3163 hsa-miR-548d-3p hsa-miR-222* hsa-miR-767-5p hsa-miR-16-1* hsa-miR-548aa hsa-miR-221* hsa-miR-942
    SwitchGear 3'UTR luciferase reporter plasmidLMNA 3' UTR sequence
    Inhib. RNA
    OriGene RNAi products in human, mouse, rat for LMNA
    Predesigned siRNA for gene silencing in human, mouse, rat LMNA

    OriGene clones in human, mouse for LMNA (see all 18)
    OriGene ORF clones in mouse, rat for LMNA
    OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
    GenScript: all cDNA clones in your preferred vector (see all 3): LMNA (NM_170707)
    Sino Biological Human cDNA Clone for LMNA
    Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat LMNA
    Addgene plasmids for LMNA 

    Cell Line
    GenScript Custom overexpressing Cell Line Services for LMNA
    Browse ESI BIO Cell Lines and PureStem Progenitors for LMNA 
    In Situ Assay

    Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for LMNA

    (According to UniProtKB, COMPARTMENTS Subcellular localization database, Ontologies according to Gene Ontology Consortium 01 Apr 2014 via Entrez Gene, Sets of similar genes according to GenesLikeMe)
    About This Section

    Subcellular locations from UniProtKB/Swiss-Prot
    LMNA_HUMAN, P02545: Nucleus. Nucleus envelope. Nucleus lamina. Nucleus, nucleoplasm. Note=Farnesylation of
    prelamin-A/C facilitates nuclear envelope targeting and subsequent cleaveage by ZMPSTE24/FACE1 to remove the
    farnesyl group produces mature lamin-A/C, which can then be inserted into the nuclear lamina. EMD is required for
    proper localization of non-farnesylated prelamin-A/C
    LMNA_HUMAN, P02545: Isoform C: Nucleus speckle
    Subcellular locations from COMPARTMENTS: 

    plasma membrane1

    Gene Ontology (GO): Selected cellular component terms (see all 11):    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0005634nucleus IDA--
    GO:0005635nuclear envelope TAS3453101
    GO:0005638lamin filament TAS10080180
    GO:0005652nuclear lamina TAS8344919
    GO:0005654nucleoplasm TAS--

    Find genes that share ontologies with LMNA           About GenesLikeMe

    (SuperPaths according to PathCards, Pathways according to R&D Systems, Cell Signaling Technology, KEGG, PharmGKB, BioSystems, Sino Biological, Reactome, Tocris Bioscience, GeneGo (Thomson Reuters), QIAGEN, and/or UniProtKB, Sets of similar genes according to GenesLikeMe, Interaction Networks according to QIAGEN, and/or STRING, Interactions according to 1UniProtKB, 2MINT, 3I2D, and/or 4STRING, with links to IntAct and Ensembl, Ontologies according to Gene Ontology Consortium 01 Apr 2014 via Entrez Gene, Sets of similar genes according to GenesLikeMe)
    About This Section

    SuperPaths for LMNA About   (see all 21)  
    See pathways by source

    SuperPathContained pathways About
    1Apoptosis and survival Caspase cascade
    Apoptosis and survival Caspase cascade0.44
    Caspase cascade in apoptosis0.42
    Apoptosis and survival FAS signaling cascades0.44
    Breakdown of the nuclear lamina0.00
    FAS pathway and Stress induction of HSP regulation0.44
    2Hypertrophic cardiomyopathy (HCM)
    Hypertrophic cardiomyopathy (HCM)0.75
    Arrhythmogenic right ventricular cardiomyopathy (ARVC)0.54
    Dilated cardiomyopathy0.75
    Arrhythmogenic right ventricular cardiomyopathy0.54
    3Cell Cycle, Mitotic
    Cell Cycle, Mitotic0.90
    M Phase0.62
    Cell Cycle0.90
    4Unfolded Protein Response
    Unfolded Protein Response0.61
    Activation of Chaperone Genes by XBP1(S)0.59
    Activation of Chaperones by IRE1alpha0.61
    5Nuclear Envelope Reassembly
    Nuclear Envelope Reassembly
    Initiation of Nuclear Envelope Reformation0.00
    Clearance of Nuclear Envelope Membranes from Chromatin0.00

    Find genes that share SuperPaths with LMNA           About GenesLikeMe

    Pathways by source                                   See SuperPaths
    Show all pathways

    3 Downloadable PowerPoint Slides of GeneGlobe Pathway Central Maps for LMNA
        Caspase Cascade
    Granzyme Pathway
    Fas Signaling

    3 Cell Signaling Technology (CST) Pathways for LMNA
        Apoptosis and Autophagy
    Cell Cycle / Checkpoint Control
    Cytoskeletal Signaling

    2 GeneGo (Thomson Reuters) Pathways for LMNA
        Apoptosis and survival Caspase cascade
    Apoptosis and survival FAS signaling cascades

    4 BioSystems Pathways for LMNA
    FAS pathway and Stress induction of HSP regulation
    Arrhythmogenic right ventricular cardiomyopathy
    Caspase cascade in apoptosis

    1 Reactome Pathway for LMNA
        XBP1(S) activates chaperone genes

    1 PharmGKB Pathway for LMNA
        Antiarrhythmic Pathway, Pharmacodynamics

    3 Kegg Pathways  (Kegg details for LMNA):
        Hypertrophic cardiomyopathy (HCM)
    Arrhythmogenic right ventricular cardiomyopathy (ARVC)
    Dilated cardiomyopathy

        Pathway & Disease-focused RT2 Profiler PCR Arrays including LMNA: 
              TNF Ligands & Receptors in human mouse rat
              Skeletal Muscle: Myogenesis & Myopathy in human mouse rat
              Molecular Toxicology PathwayFinder 384HT in human mouse rat
              Adipogenesis in human mouse rat


        GeneGlobe Interaction Network for LMNA

    STRING Interaction Network Preview (showing 5 interactants - click image to see 25)

    Selected Interacting proteins for LMNA (P025451, 2, 3 ENSP000003572834) via UniProtKB, MINT, STRING, and/or I2D (see all 1002)
    InteractantInteraction Details
    GeneCardExternal ID(s)
    HIST2H3AQ71DI31, 2, 3, ENSP000003854794EBI-351935,EBI-750650 MINT-7893990 MINT-7893924 MINT-7894005 MINT-7894023 MINT-7893941 MINT-7894038 I2D: score=1 STRING: ENSP00000385479
    HIST2H3CQ71DI31, 2, 3EBI-351935,EBI-750650 MINT-7893990 MINT-7893924 MINT-7894005 MINT-7894023 MINT-7893941 MINT-7894038 I2D: score=1 
    HIST2H3DQ71DI31, 2, 3EBI-351935,EBI-750650 MINT-7893990 MINT-7893924 MINT-7894005 MINT-7894023 MINT-7893941 MINT-7894038 I2D: score=1 
    DDX39BQ138382, 3MINT-7945693 MINT-7947479 I2D: score=1 
    ENSG00000215425Q138382, 3MINT-7945693 MINT-7947479 I2D: score=1 
    About this table

    Gene Ontology (GO): Selected biological process terms (see all 21):    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0000278mitotic cell cycle TAS--
    GO:0006915apoptotic process TAS--
    GO:0006921cellular component disassembly involved in execution phase of apoptosis TAS--
    GO:0006987activation of signaling protein activity involved in unfolded protein response TAS--
    GO:0006997nucleus organization ----

    Find genes that share ontologies with LMNA           About GenesLikeMe

    (Chemical Compounds according to UniProtKB, Enzo Life Sciences, EMD Millipore, Tocris Bioscience, ApexBio, HMDB, BitterDB, and/or Novoseek, Ligands according to IUPHAR, and Drugs according to DrugBank, Enzo Life Sciences, and/or PharmGKB, Sets of similar genes according to GenesLikeMe)
    About This Section

    Browse Small Molecules at EMD Millipore
       Browse drugs & compounds from Enzo Life Sciences
      Browse compounds at ApexBio 

    Browse Tocris compounds for LMNA

    Selected Novoseek inferred chemical compound relationships for LMNA gene (see all 18)    About this table
    Compound   -log (P-Val)   Hits   PubMed IDs for Articles with Shared Sentences (# sentences)
    nelfinavir 23.7 2 14600514 (1), 18344876 (1)
    rosiglitazone 18 2 14510863 (2)
    indinavir 17.1 4 14600514 (1), 16184025 (1), 12844477 (1)
    zinc 14.2 12 16278265 (1), 19494770 (1), 19323649 (1), 15998779 (1) (see all 7)
    retinoic acid 12.4 18 15219855 (3), 10694499 (3), 12844477 (2), 11478838 (1) (see all 8)
    deoxyribonucleic acid 6.22 1 12015247 (1)
    calcium 0.975 2 1467310 (1), 19144047 (1)
    cholesterol 0 4 11136544 (1), 12524233 (1), 17994215 (1), 15205219 (1)
    atp 0 6 1965140 (2), 15892163 (1), 2004657 (1)
    lipid 0 3 20130076 (2), 16181372 (1)

    Find genes that share compounds with LMNA           About GenesLikeMe

    (Secondary structures according to fRNAdb,
    GenBank/EMBL/DDBJ Accessions according to
    Unigene (Build 236 Homo sapiens; Apr 25 2013) or GenBank,
    RefSeq according to Entrez Gene,
    DOTS (version 10), and/or AceView, transcript ids from Ensembl with links to UCSC,
    exon structure from GeneLoc, alternative splicing isoforms according to ASD and/or ECgene,
    siRNAs from OriGene, QIAGEN, shRNA from OriGene, microRNA from QIAGEN, SwitchGear Genomics,
    Tagged/untagged cDNA clones from OriGene, GenScript, Vector BioLabs, and/or Addgene, Primers from OriGene, and/or QIAGEN, Flow cytometry from eBioscience )
    About This Section

    REFSEQ mRNAs for LMNA gene (7 alternative transcripts): 
    NM_001257374.2  NM_001282624.1  NM_001282625.1  NM_001282626.1  NM_005572.3  NM_170707.3  NM_170708.3  

    Unigene Cluster for LMNA:

    Lamin A/C
    Hs.594444  [show with all ESTs]
    Unigene Representative Sequence: NM_170707
    Selected Ensembl transcripts including schematic representations, and UCSC links where relevant (see all 26):
    ENST00000502751 ENST00000368301(uc001fnf.1) ENST00000495341 ENST00000470835
    ENST00000515711 ENST00000368300(uc001fng.2 uc001fni.2 uc009wro.1 uc001fnk.2)
    ENST00000478063 ENST00000470199 ENST00000469565 ENST00000368299 ENST00000502357
    ENST00000448611(uc010pgz.1) ENST00000515459 ENST00000368297 ENST00000504687
    ENST00000473598 ENST00000515824 ENST00000496738(uc001fnj.2 uc010pha.1)

    Block miRNA regulation of human, mouse, rat LMNA using miScript Target Protectors
    Selected qRT-PCR Assays for microRNAs that regulate LMNA (see all 15):
    hsa-miR-3163 hsa-miR-548d-3p hsa-miR-222* hsa-miR-767-5p hsa-miR-16-1* hsa-miR-548aa hsa-miR-221* hsa-miR-942
    SwitchGear 3'UTR luciferase reporter plasmidLMNA 3' UTR sequence
    Inhib. RNA
    OriGene RNAi products in human, mouse, rat for LMNA
    Predesigned siRNA for gene silencing in human, mouse, rat LMNA
    OriGene clones in human, mouse for LMNA (see all 18)
    OriGene ORF clones in mouse, rat for LMNA
    OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
    GenScript: all cDNA clones in your preferred vector (see all 3): LMNA (NM_170707)
    Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat LMNA
    Addgene plasmids for LMNA 
    OriGene qPCR primer pairs and template standards for LMNA
    OriGene qSTAR qPCR primer pairs in human, mouse for LMNA
    Pre-validated RT2 qPCR Primer Assay in human, mouse, rat LMNA
      QuantiTect SYBR Green Assays in human, mouse, rat LMNA
      QuantiFast Probe-based Assays in human, mouse, rat LMNA

    Additional mRNA sequence: 

    AF381029.1 AK026584.1 AK056143.1 AK056191.1 AK057997.1 AK097801.1 AK098128.1 AK122732.1 
    AK130179.1 AK294217.1 AK295390.1 AK309539.1 AY357727.1 AY528714.1 AY847595.1 AY847596.1 
    AY847597.1 BC000511.2 BC003162.1 BC014507.1 BC018863.2 BC033088.1 M13451.1 M13452.1 
    NR_047544.1 NR_047545.1 X03444.1 X03445.1 

    Selected DOTS entries (see all 79):

    DT.100891747  DT.91871177  DT.92469899  DT.95246279  DT.100891714  DT.95294580  DT.100891710  DT.121347135 
    DT.92469913  DT.100891740  DT.100891733  DT.92057489  DT.101986435  DT.121347131  DT.121347084  DT.100891726 
    DT.99987681  DT.95322263  DT.100039687  DT.121347143  DT.121347120  DT.100891698  DT.100891751  DT.320389 

    Selected AceView cDNA sequences (see all 1597):

    CB150408 AL602697 BU528517 BU626255 BG831209 BU190818 BQ689214 BU543235 
    BM913668 CA436010 BM828139 AI654262 BQ219558 BQ215790 CD674183 BU178121 
    BM836839 BM763030 BE311540 AW245428 AU120748 BM837113 CB130594 BM785968 

    GeneLoc Exon Structure

    4 Alternative Splicing Database (ASD) splice patterns (SP) for LMNA    About this scheme

    ExUns: 1a · 1b ^ 2 ^ 3 ^ 4a · 4b ^ 5 ^ 6a · 6b ^ 7 ^ 8 ^ 9 ^ 10a · 10b ^ 11a · 11b ^ 12a · 12b · 12c
    SP1:                                            -                                   -                                 
    SP2:                                            -                                   -           -                     
    SP3:                                            -                                                                     

    ECgene alternative splicing isoforms for LMNA

    (RNA expression data according to H-InvDB, NONCODE, miRBase, and RNAdb, Expression images according to data from BioGPS, Illumina Human BodyMap, and CGAP SAGE, Sets of similar genes according to GenesLikeMe, in vivo and in vitro expression data from LifeMap Discovery™, Protein expression images according to data from SPIRE 1MOPED, 2PaxDb, and 3MaxQB, plus additional links to SOURCE, and/or BioGPS, and/or UniProtKB,
    PCR Arrays from QIAGEN, Primers from OriGene, and/or QIAGEN, In Situ Hybridization Assays from Advanced Cell Diagnostics)
    About This Section

    LMNA expression in normal human tissues (normalized intensities)
    See probesets specificity/sensitivity at GeneAnnot
    About this imageBioGPS <intensity>2/3
    LMNA Expression
    About this image

    LMNA expression in embryonic tissues and stem cells    About this table
    Data from LifeMap, the Embryonic Development and Stem Cells Database
     selected tissues (see all 28) fully expand
     Ovary (Reproductive System)    fully expand to see all 4 entries
             Primary Oocyte Primary Follicle
             Secondary follicles
     Brain (Nervous System)    fully expand to see all 4 entries
             Cerebral Cortex
             Dermal Fibroblasts Dorsal Dermis
     Dermis (Integumentary System)    fully expand to see all 3 entries
             Dermal Fibroblasts Dorsal Dermis
     Testis (Reproductive System)
             Leydig Cells Testis Interstitium
    LMNA Protein expression data from MOPED1, PaxDb2 and MaxQB3    About this image

    LMNA Protein Expression

    SOURCE GeneReport for Unigene cluster: Hs.594444

    UniProtKB/Swiss-Prot: LMNA_HUMAN, P02545
    Tissue specificity: In the arteries, prelamin-A/C accumulation is not observed in young healthy vessels but is
    prevalent in medial vascular smooth muscle cells (VSMCs) from aged individuals and in atherosclerotic lesions,
    where it often colocalizes with senescent and degenerate VSMCs. Prelamin-A/C expression increases with age and
    disease. In normal aging, the accumulation of prelamin-A/C is caused in part by the down-regulation of
    ZMPSTE24/FACE1 in response to oxidative stress

        Pathway & Disease-focused RT2 Profiler PCR Arrays including LMNA: 
              TNF Ligands & Receptors in human mouse rat
              Skeletal Muscle: Myogenesis & Myopathy in human mouse rat
              Molecular Toxicology PathwayFinder 384HT in human mouse rat
              Adipogenesis in human mouse rat

    OriGene qPCR primer pairs and template standards for LMNA
    OriGene qSTAR qPCR primer pairs in human, mouse for LMNA
    Pre-validated RT2 qPCR Primer Assay in human, mouse, rat LMNA
    QuantiTect SYBR Green Assays in human, mouse, rat LMNA
    QuantiFast Probe-based Assays in human, mouse, rat LMNA
    In Situ
    Assay Products:

    Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for LMNA

    (Orthologs according to 1,2HomoloGene (2older version, for species not in 1newer version), 3euGenes, 4SGD , 5MGI Mar 06 2013, with possible further links to Flybase and/or WormBase, and/or 6Ensembl pan taxonomic compara , Gene Trees according to Ensembl and TreeFam)
    About This Section

    This gene was present in the common ancestor of animals.

    Orthologs for LMNA gene from Selected species (see all 16)    About this table
    Organism Taxonomic
    Gene Description Human
    (Mus musculus)
    Mammalia Lmna1 , 5 lamin A1, 5 90.15(n)1
      3 (38.84 cM)5
    169051  NM_001002011.31  NP_001002011.21 
    (Gallus gallus)
    Aves --
    Uncharacterized protein
    many ↔ many
    (Anolis carolinensis)
    Reptilia --
    Uncharacterized protein
    1 ↔ many
    1 ↔ many
    African clawed frog
    (Xenopus laevis)
    Amphibia lmna-A2 lamin A/C 76.67(n)    X06345.1 
    (Danio rerio)
    Actinopterygii lmna2 lamin A 76.11(n)   195815  AF397016.1 
    fruit fly
    (Drosophila melanogaster)
    Insecta LamC3 nuclear envelope reassembly 37(a)
    (best of 2)
      51B1   --
    (Caenorhabditis elegans)
    Secernentea lmn-13 Intermediate filament proteins (2
    (best of 5)
      I(8771116-8773244)   --

    ENSEMBL Gene Tree for LMNA (if available)
    TreeFam Gene Tree for LMNA (if available)

    (Paralogs according to 1HomoloGene,
    2Ensembl, and 3SIMAP, Pseudogenes according to Build 68,Sets of similar genes according to GenesLikeMe)
    About This Section

    Paralogs for LMNA gene
    DES2  NEFM2  LMNB12  VIM2  INA2  LMNB22  NEFH2  GFAP2  
    5 SIMAP similar genes for LMNA using alignment to 5 protein entries:     LMNA_HUMAN (see all proteins):
    LMNB1    LMNB2    VIM    KRT5    keratin

    Find genes that share paralogs with LMNA           About GenesLikeMe

    (SNPs/Variants according to the 1NCBI SNP Database, 2Ensembl, 3PupaSUITE, and 4UniProtKB, Linkage Disequilibrium by HapMap, Structural Variations(CNVs/InDels/Inversions) from the Database of Genomic Variants, Mutations from the Human Gene Mutation Database (HGMD), the Human Cytochrome P450 Allele Nomenclature Database, and the Locus Specific Mutation Databases (LSDB), Blood group antigen gene mutations by BGMUT, Resequencing Primers, Cancer Mutation PCR Arrays and Assays, and Copy Number PCR Arrays from QIAGEN)
    About This Section

    Selected SNPs for LMNA (see all 1431)    About this table                                 

    Genomic DataTranscription Related DataAllele Frequencies
    SNP IDValidClinical
    Chr 1 posSequence#AA
    CEmery-Dreifuss muscular dystrophy 2, autosomal dominant (EDMD2)4 untested1162585673(+) CCACCC/G/TGCATC 11 R G C nc-transcript-variantmis10--------
    CCardiomyopathy, dilated, with hypergonadotropic hypogonadism (CMDHH)4 pathogenic1162585769(+) AGAACC/GCAGGG 7 P A nc-transcript-variantmis1 ese30--------
    CLipodystrophy, familial partial, 2 (FPLD2)4 pathogenic1162585778(+) GGCTGC/GGCCTT 7 R G nc-transcript-variantmis1 ese30--------
    CEmery-Dreifuss muscular dystrophy 2, autosomal dominant (EDMD2)4 untested1162585788(+) TCGCAA/G/TCACCG 11 N S I nc-transcript-variantmis10--------
    CCardiomyopathy, dilated 1A (CMD1A)4 pathogenic1162585854(+) CGAGCG/TCGGGG 7 R L nc-transcript-variantmis10--------
    CEmery-Dreifuss muscular dystrophy 2, autosomal dominant (EDMD2)4 pathogenic1162601334(+) GGCTCC/G/TGCTGA 16 P R L mis10--------
    CHutchinson-Gilford progeria syndrome (HGPS)4 pathogenic1162601355(+) GGCTCC/G/TGCTGA 16 P R L mis10--------
    CHutchinson-Gilford progeria syndrome (HGPS)4 pathogenic1162601364(+) GAACTC/TCAAGG 10 S F mis10--------
    CHutchinson-Gilford progeria syndrome (HGPS)4 pathogenic1162601369(+) CCAAGA/GAGGCC 10 K E mis10--------
    CCardiomyopathy, dilated 1A (CMD1A)4 pathogenic1162601417(+) AGGGCA/GAGCTG 10 K E mis10--------
    CCardiomyopathy, dilated 1A (CMD1A)4 untested1162605142(+) GGTGGA/G/TTGCTG 16 D G V mis10--------
    CCardiomyopathy, dilated 1A (CMD1A)4 pathogenic1162605152(+) GAGAAA/C/GAGGCT 16 K N mis10--------
    CCardiomyopathy, dilated 1A (CMD1A)4 pathogenic1162605175(+) GGAGGA/G/TACTGG 16 E G V mis1 ese3 trp30--------
    CEmery-Dreifuss muscular dystrophy 2, autosomal dominant (EDMD2)4 pathogenic1162605507(+) GCCGTC/TATGAG 10 H Y mis10--------
    CHutchinson-Gilford progeria syndrome (HGPS)4 pathogenic1162607629(+) TCAAGC/G/TGCCAG 16 R G C mis1 ese30--------
    CLipodystrophy, familial partial, 2 (FPLD2)4 pathogenic1162607663(+) TTACCA/G/TGTTCC 16 Q R L mis11NA 2
    CLipodystrophy, familial partial, 2 (FPLD2)4 pathogenic1162609212(+) CCTGCA/GCTCGC 6 H R mis10--------
    C,FEmery-Dreifuss muscular dystrophy 2, autosomal dominant (EDMD2)4 probable-non-pathogenic1162609271(+) CCAGCG/AGCTCA 6 /S /G mis11Minor allele frequency- A:0.00NA 3870
    Lipodystrophy, familial partial, 2 (FPLD2)4--see VAR_0099892 G D mis40--------
    Emery-Dreifuss muscular dystrophy 2, autosomal dominant (EDMD2)4--see VAR_0397882 R S mis40--------
    Lipodystrophy, familial partial, 2 (FPLD2)4--see VAR_0397782 R C mis40--------
    Muscular dystrophy congenital LMNA-related (MDCL)4--see VAR_0635912 L S mis40--------
    Emery-Dreifuss muscular dystrophy 2, autosomal dominant (EDMD2)4--see VAR_0099802 R Q mis40--------
    Emery-Dreifuss muscular dystrophy 2, autosomal dominant (EDMD2)4--see VAR_0397912 R H mis40--------
    Emery-Dreifuss muscular dystrophy 2, autosomal dominant (EDMD2)4--see VAR_0397872 R H mis40--------
    Limb-girdle muscular dystrophy 1B (LGMD1B)4--see VAR_0162052 R H mis40--------
    Emery-Dreifuss muscular dystrophy 2, autosomal dominant (EDMD2)4--see VAR_0649702 E K mis40--------
    Emery-Dreifuss muscular dystrophy 2, autosomal dominant (EDMD2)4--see VAR_0397632 R Q mis40--------
    Mandibuloacral dysplasia with type A lipodystrophy (MADA)4--see VAR_0397892 S L mis40--------
    Emery-Dreifuss muscular dystrophy 2, autosomal dominant (EDMD2)4--see VAR_0397572 E G mis40--------
    Emery-Dreifuss muscular dystrophy 2, autosomal dominant (EDMD2)4--see VAR_0099872 R K mis40--------
    Emery-Dreifuss muscular dystrophy 2, autosomal dominant (EDMD2)4--see VAR_0649732 D Y mis40--------
    Emery-Dreifuss muscular dystrophy 2, autosomal dominant (EDMD2)4--see VAR_0397722 L P mis40--------
    Emery-Dreifuss muscular dystrophy 2, autosomal dominant (EDMD2)4--see VAR_0397562 I N mis40--------
    Emery-Dreifuss muscular dystrophy 2, autosomal dominant (EDMD2)4--see VAR_0099862 M K mis40--------
    Hutchinson-Gilford progeria syndrome (HGPS)4--see VAR_0701752 E K mis40--------
    Lipodystrophy, familial partial, 2 (FPLD2)4--see VAR_0397702 D N mis40--------
    Cardiomyopathy, dilated 1A (CMD1A)4--see VAR_0397752 E K mis40--------
    Lipodystrophy, familial partial, 2 (FPLD2)4--see VAR_0099932 R W mis40--------
    Emery-Dreifuss muscular dystrophy 2, autosomal dominant (EDMD2)4--see VAR_0649742 W R mis40--------
    Emery-Dreifuss muscular dystrophy 2, autosomal dominant (EDMD2)4--see VAR_0099972 L P mis40--------
    Lipodystrophy, familial partial, 2 (FPLD2)4--see VAR_0099942 K N mis40--------
    Emery-Dreifuss muscular dystrophy 2, autosomal dominant (EDMD2)4--see VAR_0397602 L P mis40--------
    Emery-Dreifuss muscular dystrophy 2, autosomal dominant (EDMD2)4--see VAR_0649752 R P mis40--------
    Emery-Dreifuss muscular dystrophy 2, autosomal dominant (EDMD2)4--see VAR_0099832 R Q mis40--------
    Cardiomyopathy, dilated 1A (CMD1A)4--see VAR_0397762 R L mis40--------
    Cardiomyopathy, dilated 1A (CMD1A)4--see VAR_0397792 R C mis40--------
    Lipodystrophy, familial partial, 2 (FPLD2)4--see VAR_0701812 R C mis40--------
    Hutchinson-Gilford progeria syndrome (HGPS)4--see VAR_0176632 R C mis40--------
    Emery-Dreifuss muscular dystrophy 2, autosomal dominant (EDMD2)4--see VAR_0099902 I T mis40--------
    Emery-Dreifuss muscular dystrophy 2, autosomal dominant (EDMD2)4--see VAR_0397852 T R mis40--------
    Emery-Dreifuss muscular dystrophy 2, autosomal dominant (EDMD2)4--see VAR_0397802 D V mis40--------
    Emery-Dreifuss muscular dystrophy 2, autosomal dominant (EDMD2)4--see VAR_0099822 Q P mis40--------
    Cardiomyopathy, dilated 1A (CMD1A)4--see VAR_0701792 A T mis40--------
    Emery-Dreifuss muscular dystrophy 2, autosomal dominant (EDMD2)4--see VAR_0649662 L P mis40--------
    Cardiomyopathy, dilated 1A (CMD1A)4--see VAR_0672582 G R mis40--------
    Emery-Dreifuss muscular dystrophy 2, autosomal dominant (EDMD2)4--see VAR_0397812 N I mis40--------
    Charcot-Marie-Tooth disease 2B1 (CMT2B1)4--see VAR_0176612 R C mis40--------
    Lipodystrophy, familial partial, 2 (FPLD2)4--see VAR_0099912 R L mis40--------
    Emery-Dreifuss muscular dystrophy 2, autosomal dominant (EDMD2)4--see VAR_0397822 N K mis40--------
    Mandibuloacral dysplasia with type A lipodystrophy (MADA)4--see VAR_0347092 A V mis40--------
    Emery-Dreifuss muscular dystrophy 2, autosomal dominant (EDMD2)4--see VAR_0099962 T K mis40--------
    Emery-Dreifuss muscular dystrophy 2, autosomal dominant (EDMD2)4--see VAR_0649682 S P mis40--------
    Cardiomyopathy, dilated, with hypergonadotropic hypogonadism (CMDHH)4--see VAR_0640552 L R mis40--------
    Emery-Dreifuss muscular dystrophy 2, autosomal dominant (EDMD2)4--see VAR_0649642 F L mis40--------
    Muscular dystrophy congenital LMNA-related (MDCL)4--see VAR_0635932 R P mis40--------
    Cardiomyopathy, dilated 1A (CMD1A)4--see VAR_0701822 R H mis40--------
    Emery-Dreifuss muscular dystrophy 2, autosomal dominant (EDMD2)4--see VAR_0649652 S P mis40--------
    Mandibuloacral dysplasia with type A lipodystrophy (MADA)4--see VAR_0187272 R H mis40--------
    Muscular dystrophy congenital LMNA-related (MDCL)4--see VAR_0635882 N S mis40--------
    Emery-Dreifuss muscular dystrophy 2, autosomal dominant (EDMD2)4--see VAR_0397692 H P mis40--------
    Lipodystrophy, familial partial, 2 (FPLD2)4--see VAR_0169132 R L mis40--------
    Cardiomyopathy, dilated 1A (CMD1A)4--see VAR_0701762 R P mis40--------
    Hutchinson-Gilford progeria syndrome (HGPS)4--see VAR_0176642 G S mis40--------
    Cardiomyopathy, dilated 1A (CMD1A)4--see VAR_0701802 R H mis40--------
    Cardiomyopathy, dilated 1A (CMD1A)4--see VAR_0701772 I S mis40--------
    Emery-Dreifuss muscular dystrophy 2, autosomal dominant (EDMD2)4--see VAR_0649672 S P mis40--------
    Muscular dystrophy congenital LMNA-related (MDCL)4--see VAR_0635892 R W mis40--------
    Muscular dystrophy congenital LMNA-related (MDCL)4--see VAR_0099852 E K mis40--------
    Emery-Dreifuss muscular dystrophy 2, autosomal dominant (EDMD2)4--see VAR_0397512 E G mis40--------
    Muscular dystrophy congenital LMNA-related (MDCL)4--see VAR_0635922 R P mis40--------
    Emery-Dreifuss muscular dystrophy 2, autosomal dominant (EDMD2)4--see VAR_0099842 R Q mis40--------
    Hutchinson-Gilford progeria syndrome (HGPS)4--see VAR_0347102 K N mis40--------
    Emery-Dreifuss muscular dystrophy 3, autosomal recessive (EDMD3)4--see VAR_0676972 R Q mis40--------
    Cardiomyopathy, dilated 1A (CMD1A)4--see VAR_0701742 R P mis40--------
    Limb-girdle muscular dystrophy 1B (LGMD1B)4--see VAR_0397772 R L mis40--------
    Lipodystrophy, familial partial, 2 (FPLD2)4--see VAR_0099952 R P mis40--------
    Emery-Dreifuss muscular dystrophy 2, autosomal dominant (EDMD2)4--see VAR_0649622 R P mis40--------
    Muscular dystrophy congenital LMNA-related (MDCL)4--see VAR_0635942 N D mis40--------
    Cardiomyopathy, dilated 1A (CMD1A)4--see VAR_0672572 L F mis40--------
    Emery-Dreifuss muscular dystrophy 2, autosomal dominant (EDMD2)4--see VAR_0397842 W S mis40--------
    Emery-Dreifuss muscular dystrophy 2, autosomal dominant (EDMD2)4--see VAR_0397742 Y C mis40--------
    Cardiomyopathy, dilated 1A (CMD1A)4--see VAR_0397682 L P mis40--------
    Emery-Dreifuss muscular dystrophy 2, autosomal dominant (EDMD2)4--see VAR_0649722 L P mis40--------
    Muscular dystrophy congenital LMNA-related (MDCL)4--see VAR_0635902 L P mis40--------
    Emery-Dreifuss muscular dystrophy 2, autosomal dominant (EDMD2)4--see VAR_0397712 G E mis40--------
    Emery-Dreifuss muscular dystrophy 2, autosomal dominant (EDMD2)4--see VAR_0649712 G D mis40--------
    Limb-girdle muscular dystrophy 1B (LGMD1B)4--see VAR_0397832 Y H mis40--------
    Emery-Dreifuss muscular dystrophy 2, autosomal dominant (EDMD2)4--see VAR_0099882 R W mis40--------
    C,Fnon-pathogenic1162585651(+) GCCAGC/TTCCAC 7 S nc-transcript-variantsyn15Minor allele frequency- T:0.01NA NS EU 2677
    C,Fnon-pathogenic1162601293(+) TTTAGC/TAATAC 10 C R syn12Minor allele frequency- T:0.00NA EU 5759
    C,Fnon-pathogenic1162601374(+) GAGGCC/TGCACT 10 A syn13Minor allele frequency- T:0.01CSA NA 4524
    C,F,Hnon-pathogenic1162605179(+) GAACTG/AGACTT 10 /L syn112Minor allele frequency- A:0.01NS EA NA EU 7141
    C,F,Hnon-pathogenic1162605666(+) CTCTCG/TATTGG 6 -- int115Minor allele frequency- T:0.08NS EA NA CSA WA EU 2611
    C,Fnon-pathogenic1162605852(+) CTTTGT/ACCTCC 6 -- int11Minor allele frequency- A:0.00EU 963
    C,F,Anon-pathogenic1162605915(-) TGGGCA/GGCCCC 10 A syn1 ese311Minor allele frequency- G:0.21NA WA CSA EA EU 5834
    C,F,A,Hnon-pathogenic1162607072(-) TCCTCA/GTCCAC 10 D syn130Minor allele frequency- C:0.00EA NA MN NS WA CSA EU 7080
    C,F,Hnon-pathogenic1162608421(+) CACCAC/TGTGAG 9 H syn1 int1 ese322Minor allele frequency- T:0.20MN EA NA NS WA 6526
    Cpathogenic1162585616(+) CGTCCC/TAGCGG 7 Q * nc-transcript-variantstg10--------
    Cpathogenic1162585776(+) AGGGCG/TGCGCC 7 R L nc-transcript-variantmis10--------
    Cpathogenic1162605517(+) GACCCA/GACTGG 10 Q R mis10--------
    Cpathogenic1162605531(+) AGATTA/GACAAT 10 N D mis10--------
    Cpathogenic1162605588(+) AACTGC/TGGGCC 10 R W mis10--------
    Cpathogenic1162605620(+) CAGTAA/TAAGAA 10 * Y stg10--------
    Cpathogenic1162605946(+) GCATCC/TGCATC 10 R C mis10--------
    Cpathogenic1162606714(+) TGGACA/G/TAGTAC 16 K E * mis1 stg10--------
    Cpathogenic1162606772(+) CTACCA/G/TCAAGC 16 H R L mis10--------
    Cpathogenic1162606781(+) GCTCTC/TGGAGG 10 S L mis10--------
    Cpathogenic1162606929(+) GCAGCC/TGTGGC 10 R C mis10--------
    Cpathogenic1162607052(+) GGCGCA/GTGGCC 10 M V mis10--------
    Cpathogenic1162607091(+) TTGTCC/TGGCTG 10 R W mis10--------
    Cpathogenic1162607612(+) CATGGA/GCAATT 10 D G mis10--------
    Cpathogenic1162607662(+) CTTACC/TGGTTC 10 R W mis10--------
    Cpathogenic1162607695(+) CTGGGC/TAGGTG 10 Q * stg10--------
    Cpathogenic1162607881(+) GCCTGC/TGTACG 10 R C mis10--------
    Cpathogenic1162607882(+) CCTGCA/C/GTACGG 16 H P R mis10--------
    Cpathogenic1162607887(+) GTACGA/GCTCTC 10 T A mis10--------
    Cpathogenic1162607888(+) TACGGC/TTCTCA 10 A V mis10--------
    Cpathogenic1162607891(+) GGCTCC/TCATCA 10 P L mis10--------
    Cpathogenic1162608344(+) CCATGA/C/G/
    19 S R G C mis1 int10--------
    Cpathogenic1162608349(+) CGCAAC/GCTGGT 9 N K mis1 int10--------
    Cpathogenic1162608434(+) GTAGCA/C/TGCCGC 10 S R C int1 nc-transcript-variantmis10--------
    Cpathogenic1162609185(+) CAGCTC/TGGGGG 6 S L mis10--------
    Cpathogenic1162609288(+) CAGGTA/GGGCGG 6 V syn10--------
    Cpathogenic1162609289(+) AGGTGA/GGCGGA 6 S G mis10--------
    Cpathogenic1162609291(+) GTGGGC/TGGACC 6 G syn10--------
    C,F,Aprobable-non-pathogenic1162606815(-) CCCGAC/TGTCTC 6 -- int18Minor allele frequency- T:0.20NA WA CSA EA 371
    Cprobable-non-pathogenic1162607886(+) CGTACA/GGCTCT 10 T syn10--------
    C,Fprobable-non-pathogenic1162609228(+) GTGCTG/ATGCGG 6 /L syn11Minor allele frequency- A:0.00NA 3564
    Cuntested1162585605(+) CATGGA/GGACCC 7 E G nc-transcript-variantmis1 ese30--------
    Cuntested1162585699(+) AAGGAC/G/TGACCT 11 D E nc-transcript-variantmis10--------
    Cuntested1162605132(+) TGCTGC/TGGCGG 10 R W mis10--------
    C,Funtested1162605262(+) CTTGGA/G/TCTGGG 6 -- int17NA WA EA EU 1608
    Cuntested1162605279(+) GGGACC/TAGCTG 6 -- int15Minor allele frequency- T:0.05NA WA EA 362
    Cuntested1162605473(+) CTCCAA/C/GCCCTT 6 -- int10--------
    C,Huntested1162605534(+) TTGACA/CATGGG 10 N H mis1 ese34Minor allele frequency- C:0.00NS EA 406
    Cuntested1162605566(+) CGGCTA/GGCGGA 10 L syn10--------
    Cuntested1162605618(+) AGCAGC/G/TATAAG 16 H D Y mis10--------
    C,Funtested1162605714(+) ACCCAC/TGCTGG 6 -- int14Minor allele frequency- T:0.29CSA WA 126
    C,F,A,Huntested1162606496(+) GCCAGC/G/TTGTCT 6 -- int113NS EA NA WA CSA 783
    Cuntested1162606533(+) CCCATA/GCTTAG 6 -- int10--------
    Cuntested1162606664(+) GGAAAA/CGGAGC 10 K T mis1 trp30--------
    Cuntested1162606670(+) GGAGCA/GGGAGA 10 Q R mis10--------
    Cuntested1162606740(+) ATCAAA/GCTGGC 10 K syn10--------
    Cuntested1162606791(+) GGCGAA/GGAGGA 10 E syn10--------
    Cuntested1162606799(+) GGAGAA/G/TGTGGG 16 K R M mis10--------
    Cuntested1162606848(+) GCCGGC/TAACTG 6 -- int10--------
    C,Funtested1162606849(+) CCGGCA/GACTGG 6 -- int16Minor allele frequency- G:0.08NA CSA WA 256
    Cuntested1162607033(+) CAGCAC/TGCACG 10 H syn10--------
    Cuntested1162607037(+) ACGCAC/TGCACT 10 R C mis11Minor allele frequency- T:0.00NA 4372
    Cuntested1162607676(+) CCAAAC/G/TTTCAC 16 N K mis10--------
    Cuntested1162607711(+) GGTGAA/C/GTGGCA 6 -- int10--------
    C,F,A,Huntested1162607750(-) CCATCG/ACCACC 6 -- int126Minor allele frequency- A:0.19EA NA NS WA CSA EU 2951
    Cuntested1162607828(+) CCCCC-/CTACCG 10 T Y fra10--------
    Cuntested1162607885(+) GCGTAA/C/G/
    22 K T R M mis10--------
    Cuntested1162608345(+) CATGCA/C/GCAAGC 14 H P R mis1 int10--------
    Cuntested1162609338(+) CACTCA/G/TCAGCT 9 H R L mis1 ese33MN NA 188
    Cuntested1162609359(+) GGGGGA/GCAGTG 6 D G mis10--------
    Cuntested1162609375(+) GGCAGC/TTTCGG 6 S syn10--------
    Cuntested1162609436(+) CCCAGA/C/GTGAGT 3 -- spd11CSA 1
    C,Funtested1162609461(+) CTCCAA/GATCCT 3 -- int14Minor allele frequency- G:0.01CSA WA EU 1393
    Cuntested1162609811(+) GTGGGA/GGTGGA 3 -- ut31 int10--------
    C,F,Auntested1162609863(-) CATGAC/GGTGCA 3 -- int1 ut31 ese310Minor allele frequency- G:0.14MN NA WA CSA EA 555
    Cuntested1162609931(+) TTTTCT/AAAAAA 3 -- int1 ut31 trp31Minor allele frequency- A:0.00NA 2
    Cuntested1162609976(+) AAAACA/CCAAGC 3 -- int1 ut311Minor allele frequency- C:0.00NA 2
    Cuntested1162610125(+) TTATAG/TAGGCT 3 -- int1 ut31 ese30--------
    Cuntested1162610523(+) CTTTAG/AACCCT 3 -- ut31 ese31Minor allele frequency- A:0.00MN 184
    C,Funtested1162610699(+) CTTGCC/TTCCCC 3 -- ut31 ese30--------
    C,Funtested1162610806(+) GTGTAC/TTGAGG 3 -- ds5001 int11Minor allele frequency- T:0.11WA 118
    Cunknown1162601273(+) ATCTAC/TTCTCC 6 -- int10--------
    Cunknown1162607869(+) GCTGCA/GGGAAC 10 R G mis10--------
    C,Funknown1162609397(+) TCACCA/C/TGCTCC 9 S R C mis12NA EU 5603
    C--156054119(+) AAGGTT/CGGGGG 1 -- int12Minor allele frequency- C:0.25NA 4
    C,F--156054126(+) GGGGGC/G/TGGTGG 1 -- int12NA 4
    --156054128(+) GGGTG-/GTGGGGG 1 -- int10--------
    C--156054129(+) GGTGGG/TGGGGG 1 -- int11Minor allele frequency- T:0.00NA 2
    C--156054129(+) GGTGG-/TGGGGG 1 -- int10--------
    C--156059392(+) AAAAA-/AAAG  
    1 -- int10--------
    C--156065299(+) TTTTT-/TCTTTT 1 -- int10--------
    C--156067744(+) CGTGC-/GT/TG 
    1 -- int10--------
    C--156075193(+) TCCCT-/CTACTCT 1 -- int10--------
    C--156075194(+) ATCCCCT/-TACTC 1 -- int11Minor allele frequency- -:0.00CSA 2
    C--156076231(+) CACAG-/AGACACA 1 -- int10--------
    --156076409(+) CCCCA-/CCCACGCCTC
    1 -- int10--------
    C--156076436(+) CCCAC-/GCCTCTGTCC
    1 -- int11Minor allele frequency- GCCTCTGTCCCCACCCCCCCAC:0.00NA 2
    C--156080441(+) CCAACC/-TTGGC 1 -- int11Minor allele frequency- -:0.00CSA 2
    C--156081241(+) GTCTC-/AAAAAA 1 -- int1 trp31Minor allele frequency- A:0.50CSA 2
    C,F--156083859(+) CCCCC-/CAAACT 1 -- int12Minor allele frequency- C:0.01MN EA 1252
    C--156092931(+) GCAAG-/AAGGACAG 4 -- int10--------
    C,F--156095413(-) AACCTC/TCACCT 6 -- int1 us2k12Minor allele frequency- T:0.50WA CSA 4
    C--156097478(+) TTTTT-/TGAGAT 6 -- int11Minor allele frequency- T:0.00NA 2
    C,F--156097564(+) TCTCCG/ACCTCC 6 -- int13Minor allele frequency- A:0.21WA CSA 122
    C,F--156097622(+) ATGGAC/AGTGCA 6 -- int11Minor allele frequency- A:0.50WA 2
    C,F--156097633(-) ggggaA/Tggtgg 6 -- int15Minor allele frequency- T:0.23NA CSA WA 244
    C,A--156102628(+) TCTCtC/Tttttt 6 -- int1 trp31Minor allele frequency- T:0.50CSA 2
    C,F--156102935(+) AAGACA/GTGTTC 6 -- int10--------
    C--156103192(-) tagagA/Gcaggg 6 -- int10--------
    C,F--156103235(-) ACAGAT/CATGGG 6 -- int12Minor allele frequency- C:0.25WA CSA 4
    C,F--156103254(+) CTACTC/TGGGAG 6 -- int11Minor allele frequency- T:0.50CSA 2
    --162551302(+) CCCACC/TCAGGG 1 -- us2k10--------
    --162551415(+) GTGAAG/TGTTTC 1 -- us2k10--------
    --162551493(+) TCTGGC/TCCAAG 1 -- us2k10--------
    --162551531(+) GAGAGA/GGAAGA 1 -- us2k10--------
    --162551965(+) TGCGAA/GGATAT 1 -- us2k10--------
    --162552037(+) GTAACA/GGGGAA 1 -- us2k10--------
    C--162552183(+) AGTGGT/CCCCGG 1 -- us2k11Minor allele frequency- C:0.00EU 419
    C--162552732(+) AGAGG-/GAGAGAG 1 -- us2k10--------
    C,F--162553058(+) TCTAGC/ACCCCG 1 -- us2k12Minor allele frequency- A:0.12WA 120
    C--162553197(+) GCATGG/AAACTG 1 -- us2k18Minor allele frequency- A:0.00NA WA CSA EA 250
    --162553418(+) GGAAAC/TAGAGC 1 -- int10--------
    C,A,H--162553567(+) CCGCTC/GGCTCA 1 -- int14Minor allele frequency- G:0.28NA WA 242
    --162553739(+) CTGCGC/TGTTGT 1 -- nc-transcript-variant0--------
    C,H--162553846(+) CCCCCC/GCCCCC 1 -- nc-transcript-variantese30--------
    F--162553938(+) CGGTGG/AAGTGA 1 -- int11Minor allele frequency- A:0.03WA 118
    C,F--162554041(+) TAACCG/ATTTGG 1 -- int11Minor allele frequency- A:0.50WA 2
    --162554083(+) AGGGAA/GGAGAG 1 -- int10--------
    --162554364(+) GCCGAG/TCATGG 1 -- int10--------
    C--162554501(+) AAACA-/AAAC  
    1 -- int10--------
    C,F--162554542(+) GACTCC/TGGAAA 1 -- int11Minor allele frequency- T:0.02WA 118
    --162554621(+) GAGTGA/TAATGC 1 -- int10--------
    --162554890(+) AACAGA/TTGAAT 1 -- int10--------
    --162554912(+) ACTTAC/GCAATG 1 -- int10--------
    --162554946(+) TTAGTA/CCAGTT 1 -- int10--------
    --162554966(+) GTTTCG/TTGGAA 1 -- int10--------
    --162555028(+) GAAGG-/TTCGGG 1 -- int10--------
    C--162555035(+) GGGGG-/GTGGTGG 1 -- int10--------
    C--162555213(+) CTACTC/GCCACC 1 -- int10--------
    --162555694(+) GTGGGC/TGAGGC 1 -- int10--------
    --162555746(+) AGAATC/GAATCA 1 -- int10--------
    C,F--162555979(+) TCTCAG/AAGTGT 1 -- int11Minor allele frequency- A:0.50WA 2
    --162556001(+) CCTTCG/TCTCTC 1 -- int10--------
    C,F--162556008(+) TCTCTC/GCCGGA 1 -- int18Minor allele frequency- G:0.42NA WA EA 368
    C,F,A,H--162556094(+) TTCCCT/CGCTTG 1 -- int1 trp327Minor allele frequency- C:0.47NS EA NA WA CSA 2776
    --162556159(+) CCACTC/TTCTGC 1 -- int10--------
    C,F,A,H--162556253(+) TGGTCC/TCCAAC 1 -- int125Minor allele frequency- T:0.11NS EA NA CSA WA 2768
    C,F,A--162556291(+) CCCTGC/TCCAGA 1 -- int18Minor allele frequency- T:0.14NA CSA WA EA 368
    --162556317(+) GGGTAG/TGTTGA 1 -- int10--------
    --162556370(+) AGCAGA/GTCTCC 1 -- int10--------
    --162556756(+) AAAAAA/GTAAAA 1 -- int10--------
    --162557010(+) AGACTC/TGCTGA 1 -- int10--------
    C--162557094(+) TCTGA-/CT/CT 
    1 -- int10--------
    C--162557443(+) AAGCTA/GTTCTC 1 -- int10--------
    --162557678(+) CTGGGC/TACCTG 1 -- int10--------
    --162557749(+) CCTTAA/GCCCTA 1 -- int10--------
    C,F,H--162557876(+) TCTCTA/GTCTGT 1 -- int114Minor allele frequency- G:0.06NS EA NA 1352
    --162558012(+) ATCTCA/GGCTCA 1 -- int10--------
    C,F--162558235(+) GCGCCC/TGGCTC 1 -- int17Minor allele frequency- T:0.46NA WA CSA EA 366
    --162558313(+) AGTGGC/TTTGAT 1 -- int10--------
    C,F--162558325(+) ATGGCT/CCACTG 1 -- int13Minor allele frequency- C:0.05CSA WA 121
    --162558372(+) CTCAGC/TCTCTC 1 -- int10--------
    --162558534(+) GGAATC/GAGCCA 1 -- int10--------
    --162558602(+) TGTCTC/TGCTCG 1 -- int10--------
    --162558697(+) TCCTGA/GGTAGC 1 -- int10--------
    --162558812(+) GATCCA/GCCCGC 1 -- int10--------
    --162558925(+) CTAACC/TACCGT 1 -- int10--------
    --162559232(+) AGCACG/TGTGGC 1 -- int10--------
    --162559273(+) AAGGTA/GGAAGG 1 -- int10--------
    C--162559372(+) GAGACA/GGAGTC 1 -- int10--------
    C,F--162559762(+) ACTTCG/AAACTC 1 -- int11Minor allele frequency- A:0.03NA 120
    --162559918(+) TGATCC/TGCCTA 1 -- int10--------
    C,F--162559954(+) TGCAGG/ACATGT 1 -- int11Minor allele frequency- A:0.08EA 120
    C--162559979(+) CCTTG-/TTTA  
    1 -- int10--------
    C--162560097(+) TCAAGC/TGATTC 1 -- int10--------
    --162560140(+) CAGGCA/GCGCAC 1 -- int10--------
    C,F,A,H--162560184(+) GAGACA/GGGGTT 1 -- int14Minor allele frequency- G:0.38NA 8
    C--162560252(+) CCTCCA/GTTGCA 1 -- int10--------
    C,F--162560303(+) AAAAAG/AAAAGA 1 -- int13Minor allele frequency- A:0.40WA CSA 5
    C,F--162560394(+) TTGTTG/TTGGAT 1 -- int11Minor allele frequency- T:0.01NA 120
    --162560413(+) CAAGGA/GCTTTG 1 -- int10--------
    --162560606(+) GGCTGA/GACCCA 1 -- int10--------
    --162560687(+) CTCTGA/GTTTCG 1 -- int10--------
    C,F,A,H--162561062(+) GATCTG/CTCATG 1 -- int126Minor allele frequency- C:0.42EA NS NA WA 2934
    --162561231(+) TTCACA/GTGAAG 1 -- nc-transcript-variant0--------
    --162561350(+) AGAGGC/TAGACA 1 -- int10--------
    H--162561400(+) GGGAGT/GGGTTC 1 -- int14Minor allele frequency- G:0.00NS EA 392
    C--162561507(+) TTGCTC/GGTTGA 1 -- int10--------
    C,F--162561569(+) AACACA/GTCTTT 1 -- int110Minor allele frequency- G:0.49NA WA CSA EA 371
    F--162561611(+) AATTCC/GTAGAA 1 -- int10--------
    --162561697(+) GCTTCC/TTCAGG 1 -- int10--------
    C--162561852(+) TCACCC/TGGAGA 1 -- int10--------
    --162561898(+) CGCCCC/TTCTGA 1 -- int10--------
    C,F,A--162562134(+) AACCCC/GGTCTC 1 -- int17Minor allele frequency- G:0.23NA WA CSA 13
    --162562135(+) ACCCGA/GTCTCT 1 -- int10--------
    F--162562173(+) GGTGGC/TGCATA 1 -- int10--------
    C,F,A--162562198(+) TACTCA/GGGAGG 1 -- int15Minor allele frequency- G:0.33NA WA CSA 9
    --162562223(+) TCTCTC/TGAACC 1 -- int10--------
    --162562300(+) AACTCC/TGTCTC 1 -- int10--------
    --162562301(+) ACTCCA/GTCTCA 1 -- int10--------
    --162562598(+) AACATA/CGTGAG 1 -- int10--------
    --162562706(+) ACCTCC/TGCCTC 1 -- int10--------
    --162562974(+) TCTTAA/GCTACT 1 -- int10--------
    --162563003(+) GGAGCA/GCTTGA 1 -- int10--------
    --162563062(+) GTGACA/CGAGCG 1 -- int10--------
    --162563209(+) AAACCC/TCGTCT 1 -- int10--------
    --162563351(+) CACTCC/TGGCTC 1 -- int10--------
    C,F,A,H--162563444(+) TCCCCG/ATTGCC 1 -- int122Minor allele frequency- A:0.50NS EA NA WA CSA 2345
    --162563509(+) CCTGCA/CCACCT 1 -- int10--------
    --162563597(+) TCTTTC/TTTTTT 1 -- int10--------
    --162563660(+) GATCTC/TGGCTC 1 -- int10--------
    C--162563795(+) ACCATA/GTTGGC 1 -- int10--------
    --162563851(+) CCCCCA/C/GCAAAG 1 -- int10--------