Set Analyses:
Advanced Search

Advanced Search

 
Search By
Section (entire)
for


 
or upload a file of gene symbols


Category   Symbol Source: HGNC EntrezGene Ensembl GeneCards RNA genes CroW21
GIFtS

LMNA Gene

protein-coding   GIFtS: 74
GCID: GC01P156053

Lamin A/C

(Previous names: cardiomyopathy, dilated 1A (autosomal dominant), limb girdle...)
(Previous symbols: LMN1, CMD1A, LGMD1B, PRO1, LMNL1)
Microbiology & Infectious Diseases Congress
  See related diseases
at  

(According to 1HGNC, 2Entrez Gene,
3UniProtKB/Swiss-Prot, 4UniProtKB/TrEMBL, 5OMIM, 6GeneLoc, 7Ensembl, 8DME, 9miRBase, 10fRNAdb, 12H-InvDB, 13NCBI, 14NONCODE, and/or 15RNAdb)
About This Section

Aliases
Lamin A/C1 2     70 KDa Lamin2
LMN11 2 3 5     CDCD12
CMD1A1 2 5     CDDC2
LGMD1B1 2 5     CMT2B12
LMNL11 2     FPL2
PRO11 2     FPLD22
Lamin A/C-Like 11 2     IDC2
EMD22 5     LDP12
FPLD2 5     LFP2
HGPS2 5     LMNC2
Cardiomyopathy, Dilated 1A (Autosomal Dominant)1     lamin2
Limb Girdle Muscular Dystrophy 1B (Autosomal Dominant)1     prelamin-A/C2
Progeria 1 (Hutchinson-Gilford Type)1     Renal Carcinoma Antigen NY-REN-322

External Ids:    HGNC: 66361   Entrez Gene: 40002   Ensembl: ENSG000001607897   OMIM: 1503305   UniProtKB: P025453   

Export aliases for LMNA gene to outside databases

Previous GC identifers: GC01P153921 GC01P151817 GC01P152830 GC01P153301 GC01P152897 GC01P154318 GC01P127446


(According to Entrez Gene, Tocris Bioscience, Wikipedia's Gene Wiki, PharmGKB,
UniProtKB/Swiss-Prot, and/or UniProtKB/TrEMBL)
About This Section

Entrez Gene summary for LMNA Gene:
The nuclear lamina consists of a two-dimensional matrix of proteins located next to the inner nuclear membrane.
The lamin family of proteins make up the matrix and are highly conserved in evolution. During mitosis, the lamina
matrix is reversibly disassembled as the lamin proteins are phosphorylated. Lamin proteins are thought to be
involved in nuclear stability, chromatin structure and gene expression. Vertebrate lamins consist of two types, A
and B. Alternative splicing results in multiple transcript variants. Mutations in this gene lead to several
diseases: Emery-Dreifuss muscular dystrophy, familial partial lipodystrophy, limb girdle muscular dystrophy,
dilated cardiomyopathy, Charcot-Marie-Tooth disease, and Hutchinson-Gilford progeria syndrome. (provided by
RefSeq, Apr 2012)

GeneCards Summary for LMNA Gene: 
LMNA (lamin A/C) is a protein-coding gene. Diseases associated with LMNA include progeria, and dilated cardiomyopathy, and among its related super-pathways are Apoptosis and survival FAS signaling cascades and Hypertrophic cardiomyopathy (HCM). GO annotations related to this gene include protein binding and structural molecule activity. An important paralog of this gene is LMNB1.

UniProtKB/Swiss-Prot: LMNA_HUMAN, P02545
Function: Lamins are components of the nuclear lamina, a fibrous layer on the nucleoplasmic side of the inner
nuclear membrane, which is thought to provide a framework for the nuclear envelope and may also interact with
chromatin. Lamin A and C are present in equal amounts in the lamina of mammals. Plays an important role in
nuclear assembly, chromatin organization, nuclear membrane and telomere dynamics
Function: Prelamin-A/C can accelerate smooth muscle cell senescence. It acts to disrupt mitosis and induce DNA
damage in vascular smooth muscle cells (VSMCs), leading to mitotic failure, genomic instability, and premature
senescence

Gene Wiki entry for LMNA Gene


(According to GeneLoc and/or HGNC, and/or
Entrez Gene (NCBI build 37),
and/or miRBase,
Genomic Views according to UCSC (hg19) and Ensembl (release 73), Regulatory elements and Epigenetics data according to QIAGEN, SABiosciences, and/or SwitchGear Genomics)
About This Section
RefSeq DNA sequence:
NC_000001.10  NC_018912.2  NT_004487.19  
Regulatory elements:
   SABiosciences Regulatory transcription factor binding sites in the LMNA gene promoter:
         STAT1   STAT1beta   STAT1alpha   
         Other transcription factors

SwitchGear Promoter luciferase reporter plasmidLMNA promoter sequence
   Search SABiosciences Chromatin IP Primers for LMNA

Epigenetics:
QIAGEN PyroMark CpG Assay predesigned Pyrosequencing DNA Methylation assays in human, mouse, rat LMNA


Genomic Location:
Genomic View: UCSC Golden Path with GeneCards custom track

Entrez Gene cytogenetic band: 1q22   Ensembl cytogenetic band:  1q22   HGNC cytogenetic band: 1q22

LMNA Gene in genomic location: bands according to Ensembl, locations according to (and/or Entrez Gene and/or Ensembl if different)
LMNA gene location

GeneLoc information about chromosome 1         GeneLoc Exon Structure

GeneLoc location for GC01P156053:  view genomic region     (about GC identifiers)

Start:
156,052,364 bp from pter      End:
156,109,880 bp from pter
Size:
57,517 bases      Orientation:
plus strand

(According to UniProtKB, HORDE, neXtProt, Ensembl, and/or Reactome, Modification sites according to PhosphoSitePlus, Specific Peptides from DME, Protein expression images according to data from SPIRE 1MOPED, 2PaxDb, and 3MAXQB RefSeq according to NCBI, PDB rendering according to OCA and/or Proteopedia, Recombinant Proteins from EMD Millipore, R&D Systems, GenScript, Enzo Life Sciences, OriGene, Novus Biologicals, Sino Biological, ProSpec, and/or Cloud-Clone Corp.,
Biochemical Assays by EMD Millipore, R&D Systems, OriGene, GenScript, Cell Signaling Technology, Enzo Life Sciences, and/or Cloud-Clone Corp., Ontologies according to Gene Ontology Consortium 01 Oct 2013 and Entrez Gene, Antibodies by EMD Millipore, R&D Systems, GenScript, Cell Signaling Technology, OriGene, Novus Biologicals, Thermo Fisher Scientific, LSBio, Abcam, and/or Cloud-Clone Corp.)
About This Section

UniProtKB/Swiss-Prot: LMNA_HUMAN, P02545 (See protein sequence)
Recommended Name: Prelamin-A/C precursor  
Size: 664 amino acids; 74139 Da
Subunit: Homodimer of lamin A and lamin C. Interacts with lamin-associated polypeptides IA, IB and TMPO-alpha, RB1
and with emerin. Interacts with SREBF1, SREBF2, SUN2 and TMEM43 (By similarity). Proteolytically processed
isoform A interacts with NARF. Interacts with SUN1. Prelamin-A/C interacts with EMD. Interacts with MLIP; may
regulate MLIP localization to the nucleus envelope. Interacts with DMPK; may regulate nuclear envelope stability
Subcellular location: Nucleus. Nucleus envelope. Note=Farnesylation of prelamin-A/C facilitates nuclear envelope
targeting and subsequent cleaveage by ZMPSTE24/FACE1 to remove the farnesyl group produces mature lamin-A/C,
which can then be inserted into the nuclear lamina. EMD is required for proper localization of non-farnesylated
prelamin-A/C
Miscellaneous: There are three types of lamins in human cells: A, B, and C
Miscellaneous: The structural integrity of the lamina is strictly controlled by the cell cycle, as seen by the
disintegration and formation of the nuclear envelope in prophase and telophase, respectively
Sequence caution: Sequence=CAA27173.1; Type=Frameshift; Positions=582;
6/8 PDB 3D structures from and Proteopedia for LMNA (see all 8):
1IFR (3D)        1IVT (3D)        1X8Y (3D)        2XV5 (3D)        3GEF (3D)        3V4Q (3D)    
Secondary accessions: B4DI32 D3DVB0 E7EUI9 P02546 Q5TCJ2 Q5TCJ3 Q969I8 Q96JA2
Alternative splicing: 4 isoforms:  P02545-1   P02545-2   P02545-3   P02545-4   (No experimental confirmation available. Ref.3 (BAG58344) sequence is in conflict in position: 556:G->R)

Explore the universe of human proteins at neXtProt for LMNA: NX_P02545

Explore proteomics data for LMNA at MOPED 

Post-translational modifications:

  • UniProtKB: Increased phosphorylation of the lamins occurs before envelope disintegration and probably plays a role in
    regulating lamin associations
  • UniProtKB: Proteolytic cleavage of the C-terminal of 18 residues of prelamin-A/C results in the production of lamin-A/C. The
    prelamin-A/C maturation pathway includes farnesylation of CAAX motif, ZMPSTE24/FACE1 mediated cleavage of the
    last three amino acids, methylation of the C-terminal cysteine and endoproteolytic removal of the last 15
    C-terminal amino acids. Proteolytic cleavage requires prior farnesylation and methylation, and absence of these
    blocks cleavage
  • UniProtKB: Sumoylation is necessary for the localization to the nuclear envelope
  • UniProtKB: Farnesylation of prelamin-A/C facilitates nuclear envelope targeting
  • View modification sites using PhosphoSitePlus
  • View neXtProt modification sites for NX_P02545

  • LMNA Protein expression data from MOPED1, PaxDb2 and MAXQB3 :    About this image 

    LMNA Protein Expression
    REFSEQ proteins (7 alternative transcripts): 
    NP_001244303.1  NP_001269553.1  NP_001269554.1  NP_001269555.1  NP_005563.1  NP_733821.1  NP_733822.1  

    ENSEMBL proteins: 
     ENSP00000357284   ENSP00000357283   ENSP00000357282   ENSP00000395597   ENSP00000424518  
     ENSP00000357280   ENSP00000426535   ENSP00000421821   ENSP00000424977   ENSP00000292304  
     ENSP00000355292   ENSP00000376164  
    Reactome Protein details: P02545
    Human Recombinant Protein Products for LMNA: 
    Browse Purified and Recombinant Proteins at EMD Millipore
    Browse R&D Systems for human recombinant proteins
    Browse recombinant and purified proteins available from Enzo Life Sciences
    OriGene Purified Proteins for LMNA
    OriGene Protein Over-expression Lysate for LMNA
    OriGene MassSpec for LMNA 
    OriGene Custom Protein Services for LMNA
    GenScript Custom Purified and Recombinant Proteins Services for LMNA
    Novus Biologicals LMNA Protein
    Novus Biologicals LMNA Lysates
    Browse Sino Biological Recombinant Proteins
    Browse Sino Biological Cell Lysates 
    ProSpec Recombinant Protein for LMNA
    Cloud-Clone Corp. Proteins for LMNA 

    Gene Ontology (GO): 5/9 cellular component terms (GO ID links to tree view) (see all 9):    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0005634nucleus IDA--
    GO:0005635nuclear envelope TAS3453101
    GO:0005638lamin filament TAS10080180
    GO:0005652nuclear lamina TAS8344919
    GO:0005654nucleoplasm TAS--

    LMNA for ontologies           About GeneDecksing



    LMNA Antibody Products: 
    EMD Millipore Mono- and Polyclonal Antibodies for the study of LMNA
    Browse R&D Systems for Antibodies
    Cell Signaling Technology (CST) Antibodies for LMNA  (lamin A/C)
    OriGene Antibodies for LMNA
    OriGene Custom Antibody Services for LMNA
    GenScript Superior Antibodies for LMNA
    Novus Biologicals LMNA Antibodies
    Abcam antibodies for LMNA
    Cloud-Clone Corp. Antibodies for LMNA 
    ThermoFisher Antibody for LMNA
    LSBio Antibodies in human, mouse, rat for LMNA 

    Assay Products for LMNA: 
    Browse Kits and Assays available from EMD Millipore
    OriGene Custom Assay Services for LMNA
    Browse R&D Systems for biochemical assays
    GenScript Custom Assay Services for LMNA
    Browse Enzo Life Sciences for kits & assays
    Cloud-Clone Corp. ELISAs for LMNA 
    Cloud-Clone Corp. CLIAs for LMNA


    (According to HGNC, IUPHAR, InterPro, ProtoNet, UniProtKB, and/or BLOCKS, Sets of similar genes according to GeneDecks)
    About This Section
    HGNC Gene Families: 
    IFF5: Intermediate filaments type V, lamins

    4 InterPro protein domains:
     IPR018039 Intermediate_filament_CS
     IPR001664 IF
     IPR016044 F
     IPR001322 Lamin_tail_dom

    Graphical View of Domain Structure for InterPro Entry P02545

    ProtoNet protein and cluster: P02545

    2 Blocks protein domains:
    IPB001322 Intermediate filament
    IPB001664 Intermediate filament protein


    UniProtKB/Swiss-Prot: LMNA_HUMAN, P02545
    Similarity: Belongs to the intermediate filament family


    LMNA for domains           About GeneDecksing


    (According to 1UniProtKB, Genatlas, LifeMap Discovery™, IUBMB, and/or 2DME, Human phenotypes from GenomeRNAi, Animal models from MGI Mar 06 2013, inGenious Targeting Laboratory, genOway,
    bound targets from SABiosciences, miRNA Gene Targets from miRTarBase, shRNA from OriGene, RNAi from EMD Millipore, siRNAs from OriGene, QIAGEN, microRNA from QIAGEN, Gene Editing from DNA2.0, Sirion Biotech, Clones from EMD Millipore, OriGene, SwitchGear Genomics, GenScript, Sino Biological, DNA2.0, Vector BioLabs, and Sirion Biotech, Cell Lines from GenScript, LifeMap BioReagents, In Situ Hybridization Assays from Advanced Cell Diagnostics, Ontologies according to Gene Ontology Consortium 01 Oct 2013 via Entrez Gene.)
    About This Section

    Molecular Function:

         UniProtKB/Swiss-Prot Summary: LMNA_HUMAN, P02545
    Function: Lamins are components of the nuclear lamina, a fibrous layer on the nucleoplasmic side of the inner
    nuclear membrane, which is thought to provide a framework for the nuclear envelope and may also interact with
    chromatin. Lamin A and C are present in equal amounts in the lamina of mammals. Plays an important role in
    nuclear assembly, chromatin organization, nuclear membrane and telomere dynamics
    Function: Prelamin-A/C can accelerate smooth muscle cell senescence. It acts to disrupt mitosis and induce DNA
    damage in vascular smooth muscle cells (VSMCs), leading to mitotic failure, genomic instability, and premature
    senescence

         Genatlas biochemistry entry for LMNA:
    lamin,types A and C,common gene,alternatively spliced isoforms

         Gene Ontology (GO): 2 molecular function terms (GO ID links to tree view):    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0005198structural molecule activity TAS3453101
    GO:0005515protein binding IPI10381623
         
    LMNA for ontologies           About GeneDecksing


    Phenotypes:
         3 GenomeRNAi human phenotypes for LMNA:
     Increased S DNA content  Increased gamma-H2AX phosphory  Upregulation of Wnt/beta-caten 

         15/25 MGI mutant phenotypes (inferred from 16 alleles(MGI details for Lmna) (see all 25):
     adipose tissue  behavior/neurological  cardiovascular system  cellular  craniofacial 
     digestive/alimentary  endocrine/exocrine gland  growth/size  hearing/vestibular/ear  hematopoietic system 
     homeostasis/metabolism  immune system  integument  limbs/digits/tail  liver/biliary system 

    LMNA for phenotypes           About GeneDecksing

    Animal Models:
         MGI mouse knock-outs for LMNA: Lmnatm6Lgf Lmnatm1Stw Lmnatm4Lgf Lmnatm5Lgf Lmnatm1Lgf Lmnatm2Lgf

       inGenious Targeting Laboratory - Custom generated mouse model solutions for LMNA 
       inGenious Targeting Laboratory - Custom generated inducible mouse model solutions for LMNA

       genOway customized KO model: permanent, tissue-specific or time-controlled inactivation for LMNA 
       genOway customized Knockin model: humanization, point mutation, expression monitoring, etc. for LMNA 

    miRNA
    Products:
        
    QIAGEN Custom miScript Target Protector blocks miRNA-binding site of human, mouse, rat LMNA
    8/15 QIAGEN miScript miRNA Assays for microRNAs that regulate LMNA (see all 15):
    hsa-miR-3163 hsa-miR-548d-3p hsa-miR-222* hsa-miR-767-5p hsa-miR-16-1* hsa-miR-548aa hsa-miR-221* hsa-miR-942
    SwitchGear 3'UTR luciferase reporter plasmidLMNA 3' UTR sequence
    Inhib. RNA
    Products:
        
    Browse for Gene Knock-down Tools from EMD Millipore
    OriGene RNAi products in human, mouse, rat for LMNA
    QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat LMNA

    Gene Editing
    Products:
    DNA2.0 Custom Protein Engineering Service for LMNA
    Sirion Biotech Validated adenovirus to knockdown LMNA in human, mouse 
                         Customized adenovirus for overexpression of LMNA

    Clone
    Products:
         
    Browse Clones for the Expression of Recombinant Proteins Available from EMD Millipore
    OriGene clones in human, mouse for LMNA (see all 17)
    OriGene ORF clones in mouse, rat for LMNA
    OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
    GenScript: all cDNA clones in your preferred vector (see all 3): LMNA (NM_170707)
    Sino Biological Human cDNA Clone for LMNA
    DNA2.0 Custom Codon Optimized Gene Synthesis Service for LMNA
    Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat LMNA
    Sirion Biotech Customized lentivirus for stable overexpression of LMNA 
                         Customized lentivirus expression plasmids for stable overexpression of LMNA 

    Cell Line
    Products:
         
    GenScript Custom overexpressing Cell Line Services for LMNA
    Search LifeMap BioReagents cell lines for LMNA
    In Situ Assay
    Products:
       

     
    Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for LMNA


    (Pathways according to EMD Millipore, R&D Systems, Cell Signaling Technology, KEGG, PharmGKB, BioSystems, Sino Biological, Reactome, Tocris Bioscience, GeneGo (Thomson Reuters), QIAGEN, and/or UniProtKB, Sets of similar genes according to GeneDecks, Interaction Networks according to SABiosciences, and/or STRING, Interactions according to 1UniProtKB, 2MINT, 3I2D, and/or 4STRING, with links to IntAct and Ensembl, Ontologies according to Gene Ontology Consortium 01 Oct 2013 via Entrez Gene).
    About This Section

    SuperPaths for LMNA About   (see all 20)                                                                                              See pathways by source

    SuperPathContained pathways About
    1Apoptosis and survival Caspase cascade
    Apoptosis and survival FAS signaling cascades0.44
    FAS pathway and Stress induction of HSP regulation0.44
    Apoptosis and survival Caspase cascade0.44
    Caspase cascade in apoptosis0.42
    2Hypertrophic cardiomyopathy (HCM)
    Hypertrophic cardiomyopathy (HCM)0.75
    Arrhythmogenic right ventricular cardiomyopathy (ARVC)0.54
    Dilated cardiomyopathy0.75
    Arrhythmogenic right ventricular cardiomyopathy0.53
    3M Phase
    Mitotic Anaphase0.94
    M Phase0.88
    Mitotic Metaphase and Anaphase0.94
    Mitotic M-M/G1 phases0.88
    4Activation of Chaperone Genes by XBP1(S)
    Activation of Chaperones by IRE1alpha0.94
    Unfolded Protein Response0.76
    Activation of Chaperone Genes by XBP1(S)0.94
    5Initiation of Nuclear Envelope Reformation
    Initiation of Nuclear Envelope Reformation0.69
    Nuclear Envelope Reassembly0.69
    Clearance of Nuclear Envelope Membranes from Chromatin0.69

    Pathways by source                                                                                                                                                                 See SuperPaths
    Show all pathways

    2 EMD Millipore Pathways for LMNA
        Apoptosis and survival Caspase cascade
    Apoptosis and survival FAS signaling cascades

    3 Downloadable PowerPoint Slides of QIAGEN Pathway Central Maps for LMNA
        Caspase Cascade
    Granzyme Pathway
    Fas Signaling

    3 Cell Signaling Technology (CST) Pathways for LMNA
        Apoptosis and Autophagy
    Cell Cycle / Checkpoint Control
    Cytoskeletal Signaling

    2 GeneGo (Thomson Reuters) Pathways for LMNA
        Apoptosis and survival Caspase cascade
    Apoptosis and survival FAS signaling cascades

    4 BioSystems Pathways for LMNA
        Adipogenesis
    FAS pathway and Stress induction of HSP regulation
    Arrhythmogenic right ventricular cardiomyopathy
    Caspase cascade in apoptosis


    5/22        Reactome Pathways for LMNA (see all 22)
        Initiation of Nuclear Envelope Reformation
    Clearance of Nuclear Envelope Membranes from Chromatin
    Cell Cycle
    M Phase
    Apoptosis

    1 PharmGKB Pathway for LMNA
        Antiarrhythmic Pathway, Pharmacodynamics

    3         Kegg Pathways  (Kegg details for LMNA):
        Hypertrophic cardiomyopathy (HCM)
    Arrhythmogenic right ventricular cardiomyopathy (ARVC)
    Dilated cardiomyopathy


    LMNA for pathways           About GeneDecksing

    Interactions:

        SABiosciences Gene Network CentralTM Interacting Genes and Proteins Network for LMNA

    STRING Interaction Network Preview (showing 5 interactants - click image to see 25)

    5/964 Interacting proteins for LMNA (P025451, 2, 3 ENSP000003572834) via UniProtKB, MINT, STRING, and/or I2D (see all 964)
    InteractantInteraction Details
    GeneCardExternal ID(s)
    HIST2H3AQ71DI32, 3, ENSP000003854794MINT-7893990 MINT-7893924 MINT-7894005 MINT-7894023 MINT-7893941 MINT-7894038 I2D: score=1 STRING: ENSP00000385479
    DDX39BQ138382, 3MINT-7945693 MINT-7947479 I2D: score=1 
    ENSG00000215425Q138382, 3MINT-7945693 MINT-7947479 I2D: score=1 
    ENSG00000225073Q138382, 3MINT-7945693 MINT-7947479 I2D: score=1 
    ENSG00000225859Q138382, 3MINT-7945693 MINT-7947479 I2D: score=1 
    About this table

    Gene Ontology (GO): 5/19 biological process terms (GO ID links to tree view) (see all 19):    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0000278mitotic cell cycle TAS--
    GO:0006915apoptotic process TAS--
    GO:0006921cellular component disassembly involved in execution phase of apoptosis TAS--
    GO:0006987activation of signaling protein activity involved in unfolded protein response TAS--
    GO:0006997nucleus organization ----

    LMNA for ontologies           About GeneDecksing



    (Chemical Compounds according to UniProtKB, Enzo Life Sciences, EMD Millipore, Tocris Bioscience HMDB, BitterDB, and/or Novoseek, Ligands according to IUPHAR, and Drugs according to DrugBank, Enzo Life Sciences, and/or PharmGKB, with drugs/clinical trials/news search links to CenterWatch)
    About This Section

    LMNA for compounds           About GeneDecksing

    Browse Small Molecules at EMD Millipore
    Browse drugs & compounds from Enzo Life Sciences

    Browse Tocris compounds for LMNA

    10/18 Novoseek inferred chemical compound relationships for LMNA gene (see all 18)    About this table
    Compound   -log (P-Val)   Hits   PubMed IDs for Articles with Shared Sentences (# sentences)
    nelfinavir 23.7 2 14600514 (1), 18344876 (1)
    rosiglitazone 18 2 14510863 (2)
    indinavir 17.1 4 14600514 (1), 16184025 (1), 12844477 (1)
    zinc 14.2 12 16278265 (1), 19494770 (1), 19323649 (1), 15998779 (1) (see all 7)
    retinoic acid 12.4 18 15219855 (3), 10694499 (3), 12844477 (2), 11478838 (1) (see all 8)
    deoxyribonucleic acid 6.22 1 12015247 (1)
    calcium 0.975 2 1467310 (1), 19144047 (1)
    cholesterol 0 4 11136544 (1), 12524233 (1), 17994215 (1), 15205219 (1)
    atp 0 6 1965140 (2), 15892163 (1), 2004657 (1)
    lipid 0 3 20130076 (2), 16181372 (1)

    Search CenterWatch for drugs/clinical trials and news about LMNA

    (Secondary structures according to fRNAdb,
    GenBank/EMBL/DDBJ Accessions according to
    Unigene (Build 236 Homo sapiens; Apr 25 2013) or GenBank,
    RefSeq according to Entrez Gene,
    DOTS (version 10), and/or AceView, transcript ids from Ensembl with links to UCSC,
    Conferences by KenesGroup, exon structure from GeneLoc, alternative splicing isoforms according to ASD and/or ECgene,
    RNAi Products from EMD Millipore,
    siRNAs from OriGene, QIAGEN, shRNA from OriGene, microRNA from QIAGEN,
    Tagged/untagged cDNA clones from OriGene, SwitchGear Genomics, GenScript, DNA2.0, Vector BioLabs, Sirion Biotech, Primers from OriGene, SABiosciences, and/or QIAGEN )
    About This Section

    REFSEQ mRNAs for LMNA gene (7 alternative transcripts): 
    NM_001257374.2  NM_001282624.1  NM_001282625.1  NM_001282626.1  NM_005572.3  NM_170707.3  NM_170708.3  

    Unigene Cluster for LMNA:

    Lamin A/C
    Hs.594444  [show with all ESTs]
    Unigene Representative Sequence: NM_170707
    18/26 Ensembl transcripts including schematic representations, and UCSC links where relevant (see all 26):
    ENST00000502751 ENST00000368301(uc001fnf.1) ENST00000495341 ENST00000470835
    ENST00000515711 ENST00000368300(uc001fng.2 uc001fni.2 uc009wro.1 uc001fnk.2)
    ENST00000478063 ENST00000470199 ENST00000469565 ENST00000368299 ENST00000502357
    ENST00000448611(uc010pgz.1) ENST00000515459 ENST00000368297 ENST00000504687
    ENST00000473598 ENST00000515824 ENST00000496738(uc001fnj.2 uc010pha.1)

    Congresses - knowledge worth sharing:  
    European Congress of Clinical Microbiology and Infectious Diseases (ECCMID) 10 - 13 May 2014

    miRNA
    Products:
         
    QIAGEN Custom miScript Target Protector blocks miRNA-binding site of human, mouse, rat LMNA
    8/15 QIAGEN miScript miRNA Assays for microRNAs that regulate LMNA (see all 15):
    hsa-miR-3163 hsa-miR-548d-3p hsa-miR-222* hsa-miR-767-5p hsa-miR-16-1* hsa-miR-548aa hsa-miR-221* hsa-miR-942
    SwitchGear 3'UTR luciferase reporter plasmidLMNA 3' UTR sequence
    Inhib. RNA
    Products:
         
    Browse for Gene Knock-down Tools from EMD Millipore
    OriGene RNAi products in human, mouse, rat for LMNA
    QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat LMNA
    Clone
    Products:
         
    OriGene clones in human, mouse for LMNA (see all 17)
    OriGene ORF clones in mouse, rat for LMNA
    OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
    GenScript: all cDNA clones in your preferred vector (see all 3): LMNA (NM_170707)
    DNA2.0 Custom Codon Optimized Gene Synthesis Service for LMNA
    Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat LMNA
    Sirion Biotech Customized lentivirus for stable overexpression of LMNA 
                         Customized lentivirus expression plasmids for stable overexpression of LMNA 
    Primer
    Products:
        
    OriGene qPCR primer pairs and template standards for LMNA
    OriGene qSTAR qPCR primer pairs in human, mouse for LMNA
    SABiosciences RT2 qPCR Primer Assay in human, mouse, rat LMNA
      QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat LMNA
      QIAGEN QuantiFast Probe-based Assays in human, mouse, rat LMNA

    Additional mRNA sequence: 

    AF381029.1 AK026584.1 AK056143.1 AK056191.1 AK057997.1 AK097801.1 AK098128.1 AK122732.1 
    AK130179.1 AK294217.1 AK295390.1 AK309539.1 AY357727.1 AY528714.1 AY847595.1 AY847596.1 
    AY847597.1 BC000511.2 BC003162.1 BC014507.1 BC018863.2 BC033088.1 M13451.1 M13452.1 
    NR_047544.1 NR_047545.1 X03444.1 X03445.1 

    24/79 DOTS entries (see all 79):

    DT.100891747  DT.91871177  DT.92469899  DT.95246279  DT.100891714  DT.95294580  DT.100891710  DT.121347135 
    DT.92469913  DT.100891740  DT.100891733  DT.92057489  DT.101986435  DT.121347131  DT.121347084  DT.100891726 
    DT.99987681  DT.95322263  DT.100039687  DT.121347143  DT.121347120  DT.100891698  DT.100891751  DT.320389 

    24/1597 AceView cDNA sequences (see all 1597):

    BQ899088 CR626536 BE383355 CD367718 CA423881 BM560647 BQ934954 H13874 
    BG059624 AK056191 CA405830 AI654262 BQ219808 BU838224 BQ933470 BQ929963 
    BG749019 CB123672 BQ949807 T75500 BE741126 BQ777189 CA454200 BQ958754 

    GeneLoc Exon Structure

    4 Alternative Splicing Database (ASD) splice patterns (SP) for LMNA    About this scheme

    ExUns: 1a · 1b ^ 2 ^ 3 ^ 4a · 4b ^ 5 ^ 6a · 6b ^ 7 ^ 8 ^ 9 ^ 10a · 10b ^ 11a · 11b ^ 12a · 12b · 12c
    SP1:                                            -                                   -                                 
    SP2:                                            -                                   -           -                     
    SP3:                                            -                                                                     
    SP4:                                                                                                                  


    ECgene alternative splicing isoforms for LMNA

    (RNA expression data according to H-InvDB, NONCODE, miRBase, and RNAdb, Expression images according to data from BioGPS, Illumina Human BodyMap, and CGAP SAGE, Sets of similar genes according to GeneDecks, in vivo and in vitro expression data from LifeMap Discovery™, plus additional links to Genevestigator, and/or SOURCE, and/or BioGPS, and/or UniProtKB,
    PCR Arrays from SABiosciences, Primers from OriGene, SABiosciences, and/or QIAGEN, In Situ Hybridization Assays from Advanced Cell Diagnostics)
    About This Section

    LMNA expression in normal human tissues (normalized intensities)      LMNA embryonic expression: see
    See probesets specificity/sensitivity at GeneAnnot
    About this imageBioGPS <intensity>2/3
    CGAP TAG: GGAGGGGGCT
    LMNA Expression
    About this image


    LMNA expression in embryonic tissues and stem cells    About this table
    Data from LifeMap, the Embryonic Development and Stem Cells Database 
     5/38 selected tissues (see all 38) fully expand
     
     Epithelium
             vagina ; squamous epithelial cells   
     
     Uterus
             uterus, post-menopause ; glandular cells   
     
     Blood (Hematopoietic System)    fully expand to see all 4 entries
             Hematopoietic Stem Cells Hematopoietic Bone Marrow
             lung ; macrophages   
             cd14+ cells   
     
     Ovary (Reproductive System)    fully expand to see all 4 entries
             Primary Oocyte Primary Follicle
             Secondary follicles
             ovary ; follicle cells   
     
     Testis (Reproductive System)    fully expand to see all 4 entries
             Leydig Cells Testis Interstitium
             seminal vesicle ; glandular cells   

    See LMNA Protein Expression from SPIRE MOPED and PaxDB
    Genevestigator expression for LMNA

    SOURCE GeneReport for Unigene cluster: Hs.594444

    UniProtKB/Swiss-Prot: LMNA_HUMAN, P02545
    Tissue specificity: In the arteries, prelamin-A/C accumulation is not observed in young healthy vessels but is
    prevalent in medial vascular smooth muscle cells (VSMCs) from aged individuals and in atherosclerotic lesions,
    where it often colocalizes with senescent and degenerate VSMCs. Prelamin-A/C expression increases with age and
    disease. In normal aging, the accumulation of prelamin-A/C is caused in part by the down-regulation of
    ZMPSTE24/FACE1 in response to oxidative stress

        SABiosciences Expression via Pathway-Focused PCR Arrays including LMNA: 
              TNF Ligands & Receptors in human mouse rat
              Skeletal Muscle: Myogenesis & Myopathy in human mouse rat
              Molecular Toxicology PathwayFinder 384HT in human mouse rat
              Adipogenesis in human mouse rat

    Primer
    Products:
    OriGene qPCR primer pairs and template standards for LMNA
    OriGene qSTAR qPCR primer pairs in human, mouse for LMNA
    SABiosciences RT2 qPCR Primer Assay in human, mouse, rat LMNA
    QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat LMNA
    QIAGEN QuantiFast Probe-based Assays in human, mouse, rat LMNA
    In Situ
    Assay Products:
     

     
    Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for LMNA

    (Orthologs according to 1,2HomoloGene (2older version, for species not in 1newer version), 3euGenes, 4SGD , 5MGI Mar 06 2013, with possible further links to Flybase and/or WormBase, and/or 6Ensembl pan taxonomic compara , Gene Trees according to Ensembl and TreeFam)
    About This Section

    This gene was present in the common ancestor of animals.

    Orthologs for LMNA gene from 7/15 species (see all 15)    About this table
    Organism Taxonomic
    classification
    Gene Description Human
    Similarity
    Orthology
    Type
    Details
    mouse
    (Mus musculus)
    Mammalia Lmna1 , 5 lamin A1, 5 90.3(n)1
    96.83(a)1
      3 (38.84 cM)5
    169051  NM_001002011.21  NP_001002011.21 
     884811485 
    chicken
    (Gallus gallus)
    Aves LMNA6
    lamin A/C
    47(a)
    1 ↔ 1
    10(10954013-10971823)
    lizard
    (Anolis carolinensis)
    Reptilia --
    --
    (see all 3)
    Uncharacterized protein
    (see all 3)
    68(a)
    53(a)
    (see all 3)
    1 ↔ many
    1 ↔ many
    (see all 3)
    GL344336.1(6444-21018)
    2(41214999-41216574)
    African clawed frog
    (Xenopus laevis)
    Amphibia lmna-A2 lamin A/C 76.67(n)    X06345.1 
    zebrafish
    (Danio rerio)
    Actinopterygii lmna2 lamin A 76.11(n)   195815  AF397016.1 
    fruit fly
    (Drosophila melanogaster)
    Insecta LamC3 nuclear envelope reassembly 37(a)
    (best of 2)
      51B1   --
    worm
    (Caenorhabditis elegans)
    Secernentea lmn-13 Intermediate filament proteins (2
    domains)
    30(a)
    (best of 5)
      I(8771116-8773244)   --


    ENSEMBL Gene Tree for LMNA (if available)
    TreeFam Gene Tree for LMNA (if available)

    (Paralogs according to 1HomoloGene,
    2Ensembl, and 3SIMAP, Pseudogenes according to 4Pseudogene.org Build 68)
    About This Section
    Paralogs for LMNA gene
    LMNB12  VIM2  INA2  PRPH2  NEFM2  DES2  LMNB22  NEFH2  
    GFAP2  
    5 SIMAP similar genes for LMNA using alignment to 9 protein entries:     LMNA_HUMAN (see all proteins):
    LMNB1    LMNB2    VIM    KRT5    keratin

    LMNA for paralogs           About GeneDecksing



    (SNPs/Variants according to the 1NCBI SNP Database, 2Ensembl, 3PupaSUITE, 4UniProtKB, and DNA2.0, Linkage Disequilibrium by HapMap, Structural Variations(CNVs/InDels/Inversions) from the Database of Genomic Variants, Mutations from the Human Gene Mutation Database (HGMD) and the Locus Specific Mutation Databases (LSDB), Blood group antigen gene mutations by BGMUT, Resequencing Primers from QIAGEN, Cancer Mutation PCR Arrays and Assays and Copy Number PCR Arrays from SABiosciences)
    About This Section

    1087/1420 SNPs in LMNA are shown (see all 1420)    About this table     
    Genomic DataTranscription Related DataAllele Frequencies
    SNP IDValidClinical
    significance
    Chr 1 posSequence#AA
    Chg
    TypeMore#Allele
    freq
    PopTotal
    sample
    More
    ----------
    VAR_0099894
    Lipodystrophy, familial partial, 2 (FPLD2)4--see VAR_0099892 G D mis40--------
    VAR_0397884
    Emery-Dreifuss muscular dystrophy 2, autosomal dominant (EDMD2)4--see VAR_0397882 R S mis40--------
    VAR_0397784
    Lipodystrophy, familial partial, 2 (FPLD2)4--see VAR_0397782 R C mis40--------
    VAR_0635914
    Muscular dystrophy congenital LMNA-related (MDCL)4--see VAR_0635912 L S mis40--------
    VAR_0099804
    Emery-Dreifuss muscular dystrophy 2, autosomal dominant (EDMD2)4--see VAR_0099802 R Q mis40--------
    VAR_0397914
    Emery-Dreifuss muscular dystrophy 2, autosomal dominant (EDMD2)4--see VAR_0397912 R H mis40--------
    VAR_0397874
    Emery-Dreifuss muscular dystrophy 2, autosomal dominant (EDMD2)4--see VAR_0397872 R H mis40--------
    VAR_0162054
    Limb-girdle muscular dystrophy 1B (LGMD1B)4--see VAR_0162052 R H mis40--------
    VAR_0649704
    Emery-Dreifuss muscular dystrophy 2, autosomal dominant (EDMD2)4--see VAR_0649702 E K mis40--------
    VAR_0397634
    Emery-Dreifuss muscular dystrophy 2, autosomal dominant (EDMD2)4--see VAR_0397632 R Q mis40--------
    VAR_0397894
    Mandibuloacral dysplasia with type A lipodystrophy (MADA)4--see VAR_0397892 S L mis40--------
    VAR_0397574
    Emery-Dreifuss muscular dystrophy 2, autosomal dominant (EDMD2)4--see VAR_0397572 E G mis40--------
    VAR_0099874
    Emery-Dreifuss muscular dystrophy 2, autosomal dominant (EDMD2)4--see VAR_0099872 R K mis40--------
    VAR_0649734
    Emery-Dreifuss muscular dystrophy 2, autosomal dominant (EDMD2)4--see VAR_0649732 D Y mis40--------
    VAR_0397724
    Emery-Dreifuss muscular dystrophy 2, autosomal dominant (EDMD2)4--see VAR_0397722 L P mis40--------
    VAR_0397564
    Emery-Dreifuss muscular dystrophy 2, autosomal dominant (EDMD2)4--see VAR_0397562 I N mis40--------
    VAR_0099864
    Emery-Dreifuss muscular dystrophy 2, autosomal dominant (EDMD2)4--see VAR_0099862 M K mis40--------
    VAR_0397704
    Lipodystrophy, familial partial, 2 (FPLD2)4--see VAR_0397702 D N mis40--------
    VAR_0397754
    Cardiomyopathy, dilated 1A (CMD1A)4--see VAR_0397752 E K mis40--------
    VAR_0099934
    Lipodystrophy, familial partial, 2 (FPLD2)4--see VAR_0099932 R W mis40--------
    VAR_0649744
    Emery-Dreifuss muscular dystrophy 2, autosomal dominant (EDMD2)4--see VAR_0649742 W R mis40--------
    VAR_0099974
    Emery-Dreifuss muscular dystrophy 2, autosomal dominant (EDMD2)4--see VAR_0099972 L P mis40--------
    VAR_0099944
    Lipodystrophy, familial partial, 2 (FPLD2)4--see VAR_0099942 K N mis40--------
    VAR_0397604
    Emery-Dreifuss muscular dystrophy 2, autosomal dominant (EDMD2)4--see VAR_0397602 L P mis40--------
    VAR_0649754
    Emery-Dreifuss muscular dystrophy 2, autosomal dominant (EDMD2)4--see VAR_0649752 R P mis40--------
    VAR_0099834
    Emery-Dreifuss muscular dystrophy 2, autosomal dominant (EDMD2)4--see VAR_0099832 R Q mis40--------
    VAR_0397764
    Cardiomyopathy, dilated 1A (CMD1A)4--see VAR_0397762 R L mis40--------
    VAR_0397794
    Cardiomyopathy, dilated 1A (CMD1A)4--see VAR_0397792 R C mis40--------
    VAR_0176634
    Hutchinson-Gilford progeria syndrome (HGPS)4--see VAR_0176632 R C mis40--------
    VAR_0099904
    Emery-Dreifuss muscular dystrophy 2, autosomal dominant (EDMD2)4--see VAR_0099902 I T mis40--------
    VAR_0397854
    Emery-Dreifuss muscular dystrophy 2, autosomal dominant (EDMD2)4--see VAR_0397852 T R mis40--------
    VAR_0397804
    Emery-Dreifuss muscular dystrophy 2, autosomal dominant (EDMD2)4--see VAR_0397802 D V mis40--------
    VAR_0099824
    Emery-Dreifuss muscular dystrophy 2, autosomal dominant (EDMD2)4--see VAR_0099822 Q P mis40--------
    VAR_0649664
    Emery-Dreifuss muscular dystrophy 2, autosomal dominant (EDMD2)4--see VAR_0649662 L P mis40--------
    VAR_0672584
    Cardiomyopathy, dilated 1A (CMD1A)4--see VAR_0672582 G R mis40--------
    VAR_0397814
    Emery-Dreifuss muscular dystrophy 2, autosomal dominant (EDMD2)4--see VAR_0397812 N I mis40--------
    VAR_0176614
    Charcot-Marie-Tooth disease 2B1 (CMT2B1)4--see VAR_0176612 R C mis40--------
    VAR_0099914
    Lipodystrophy, familial partial, 2 (FPLD2)4--see VAR_0099912 R L mis40--------
    VAR_0397824
    Emery-Dreifuss muscular dystrophy 2, autosomal dominant (EDMD2)4--see VAR_0397822 N K mis40--------
    VAR_0347094
    Mandibuloacral dysplasia with type A lipodystrophy (MADA)4--see VAR_0347092 A V mis40--------
    VAR_0099964
    Emery-Dreifuss muscular dystrophy 2, autosomal dominant (EDMD2)4--see VAR_0099962 T K mis40--------
    VAR_0649684
    Emery-Dreifuss muscular dystrophy 2, autosomal dominant (EDMD2)4--see VAR_0649682 S P mis40--------
    VAR_0640554
    Cardiomyopathy, dilated, with hypergonadotropic hypogonadism (CMDHH)4--see VAR_0640552 L R mis40--------
    VAR_0649644
    Emery-Dreifuss muscular dystrophy 2, autosomal dominant (EDMD2)4--see VAR_0649642 F L mis40--------
    VAR_0635934
    Muscular dystrophy congenital LMNA-related (MDCL)4--see VAR_0635932 R P mis40--------
    VAR_0649654
    Emery-Dreifuss muscular dystrophy 2, autosomal dominant (EDMD2)4--see VAR_0649652 S P mis40--------
    VAR_0187274
    Mandibuloacral dysplasia with type A lipodystrophy (MADA)4--see VAR_0187272 R H mis40--------
    VAR_0635884
    Muscular dystrophy congenital LMNA-related (MDCL)4--see VAR_0635882 N S mis40--------
    VAR_0397694
    Emery-Dreifuss muscular dystrophy 2, autosomal dominant (EDMD2)4--see VAR_0397692 H P mis40--------
    VAR_0169134
    Lipodystrophy, familial partial, 2 (FPLD2)4--see VAR_0169132 R L mis40--------
    VAR_0176644
    Hutchinson-Gilford progeria syndrome (HGPS)4--see VAR_0176642 G S mis40--------
    VAR_0649674
    Emery-Dreifuss muscular dystrophy 2, autosomal dominant (EDMD2)4--see VAR_0649672 S P mis40--------
    VAR_0635894
    Muscular dystrophy congenital LMNA-related (MDCL)4--see VAR_0635892 R W mis40--------
    VAR_0099854
    Muscular dystrophy congenital LMNA-related (MDCL)4--see VAR_0099852 E K mis40--------
    VAR_0397514
    Emery-Dreifuss muscular dystrophy 2, autosomal dominant (EDMD2)4--see VAR_0397512 E G mis40--------
    VAR_0635924
    Muscular dystrophy congenital LMNA-related (MDCL)4--see VAR_0635922 R P mis40--------
    VAR_0099844
    Emery-Dreifuss muscular dystrophy 2, autosomal dominant (EDMD2)4--see VAR_0099842 R Q mis40--------
    VAR_0347104
    Hutchinson-Gilford progeria syndrome (HGPS)4--see VAR_0347102 K N mis40--------
    VAR_0676974
    Emery-Dreifuss muscular dystrophy 3, autosomal recessive (EDMD3)4--see VAR_0676972 R Q mis40--------
    VAR_0397774
    Limb-girdle muscular dystrophy 1B (LGMD1B)4--see VAR_0397772 R L mis40--------
    VAR_0099954
    Lipodystrophy, familial partial, 2 (FPLD2)4--see VAR_0099952 R P mis40--------
    VAR_0649624
    Emery-Dreifuss muscular dystrophy 2, autosomal dominant (EDMD2)4--see VAR_0649622 R P mis40--------
    VAR_0635944
    Muscular dystrophy congenital LMNA-related (MDCL)4--see VAR_0635942 N D mis40--------
    VAR_0672574
    Cardiomyopathy, dilated 1A (CMD1A)4--see VAR_0672572 L F mis40--------
    VAR_0397844
    Emery-Dreifuss muscular dystrophy 2, autosomal dominant (EDMD2)4--see VAR_0397842 W S mis40--------
    VAR_0397744
    Emery-Dreifuss muscular dystrophy 2, autosomal dominant (EDMD2)4--see VAR_0397742 Y C mis40--------
    VAR_0397684
    Cardiomyopathy, dilated 1A (CMD1A)4--see VAR_0397682 L P mis40--------
    VAR_0649724
    Emery-Dreifuss muscular dystrophy 2, autosomal dominant (EDMD2)4--see VAR_0649722 L P mis40--------
    VAR_0635904
    Muscular dystrophy congenital LMNA-related (MDCL)4--see VAR_0635902 L P mis40--------
    VAR_0397714
    Emery-Dreifuss muscular dystrophy 2, autosomal dominant (EDMD2)4--see VAR_0397712 G E mis40--------
    VAR_0649714
    Emery-Dreifuss muscular dystrophy 2, autosomal dominant (EDMD2)4--see VAR_0649712 G D mis40--------
    VAR_0397834
    Limb-girdle muscular dystrophy 1B (LGMD1B)4--see VAR_0397832 Y H mis40--------
    VAR_0099884
    Emery-Dreifuss muscular dystrophy 2, autosomal dominant (EDMD2)4--see VAR_0099882 R W mis40--------
    rs583275331,2,4
    CEmery-Dreifuss muscular dystrophy 2, autosomal dominant (EDMD2)4 untested1162585673(+) CCACCC/G/TGCATC 11 R G C nc-transcript-variantmis10--------
    rs289289031,2,4
    CCardiomyopathy, dilated, with hypergonadotropic hypogonadism (CMDHH)4 pathogenic1162585769(+) AGAACC/GCAGGG 7 P A nc-transcript-variantmis1 ese30--------
    rs289289001,2,4
    CLipodystrophy, familial partial, 2 (FPLD2)4 pathogenic1162585778(+) GGCTGC/GGCCTT 7 R G nc-transcript-variantmis1 ese30--------
    rs577937371,2,4
    CEmery-Dreifuss muscular dystrophy 2, autosomal dominant (EDMD2)4 untested1162585788(+) TCGCAA/G/TCACCG 11 N S I nc-transcript-variantmis10--------
    rs289330901,2,4
    CCardiomyopathy, dilated 1A (CMD1A)4 pathogenic1162585854(+) CGAGCG/TCGGGG 7 R L nc-transcript-variantmis10--------
    rs608642301,2,4
    CEmery-Dreifuss muscular dystrophy 2, autosomal dominant (EDMD2)4 pathogenic1162601334(+) GGCTCC/G/TGCTGA 16 P R L mis10--------
    rs606522251,2,4
    CHutchinson-Gilford progeria syndrome (HGPS)4 pathogenic1162601355(+) GGCTCC/G/TGCTGA 16 P R L mis10--------
    rs589126331,2,4
    CHutchinson-Gilford progeria syndrome (HGPS)4 pathogenic1162601364(+) GAACTC/TCAAGG 10 S F mis10--------
    rs603102641,2,4
    CHutchinson-Gilford progeria syndrome (HGPS)4 pathogenic1162601369(+) CCAAGA/GAGGCC 10 K E mis10--------
    rs289330931,2,4
    CCardiomyopathy, dilated 1A (CMD1A)4 pathogenic1162601417(+) AGGGCA/GAGCTG 10 K E mis10--------
    rs570458551,2,4
    CCardiomyopathy, dilated 1A (CMD1A)4 untested1162605142(+) GGTGGA/G/TTGCTG 16 D G V mis10--------
    rs289330911,2,4
    CCardiomyopathy, dilated 1A (CMD1A)4 pathogenic1162605152(+) GAGAAA/C/GAGGCT 16 K N mis10--------
    rs289330921,2,4
    CCardiomyopathy, dilated 1A (CMD1A)4 pathogenic1162605175(+) GGAGGA/G/TACTGG 16 E G V mis1 ese3 trp30--------
    rs289289011,2,4
    CEmery-Dreifuss muscular dystrophy 2, autosomal dominant (EDMD2)4 pathogenic1162605507(+) GCCGTC/TATGAG 10 H Y mis10--------
    rs289289021,2,4
    CHutchinson-Gilford progeria syndrome (HGPS)4 pathogenic1162607629(+) TCAAGC/G/TGCCAG 16 R G C mis1 ese30--------
    rs115759371,2,4
    CLipodystrophy, familial partial, 2 (FPLD2)4 pathogenic1162607663(+) TTACCA/G/TGTTCC 16 Q R L mis11NA 2
    rs578309851,2,4
    CLipodystrophy, familial partial, 2 (FPLD2)4 pathogenic1162609212(+) CCTGCA/GCTCGC 6 H R mis10--------
    rs606623021,2,4
    C,FEmery-Dreifuss muscular dystrophy 2, autosomal dominant (EDMD2)4 probable-non-pathogenic1162609271(+) CCAGCG/AGCTCA 6 /S /G mis11Minor allele frequency- A:0.00NA 3870
    rs115496681,2
    C,Fnon-pathogenic1162585651(+) GCCAGC/TTCCAC 7 S nc-transcript-variantsyn15Minor allele frequency- T:0.01NA NS EU 2677
    rs413138801,2
    C,Fnon-pathogenic1162601293(+) TTTAGC/TAATAC 10 C R syn12Minor allele frequency- T:0.00NA EU 5759
    rs803568051,2
    C,Fnon-pathogenic1162601374(+) GAGGCC/TGCACT 10 A syn13Minor allele frequency- T:0.01CSA NA 4524
    rs121175521,2
    C,F,Hnon-pathogenic1162605179(+) GAACTG/AGACTT 10 /L syn112Minor allele frequency- A:0.01NS EA NA EU 7141
    rs112644441,2
    C,F,Hnon-pathogenic1162605666(+) CTCTCG/TATTGG 6 -- int115Minor allele frequency- T:0.08NS EA NA CSA WA EU 2611
    rs803568091,2
    C,Fnon-pathogenic1162605852(+) CTTTGT/ACCTCC 6 -- int11Minor allele frequency- A:0.00EU 963
    rs5380891,2
    C,F,Anon-pathogenic1162605915(-) TGGGCA/GGCCCC 10 A syn1 ese311Minor allele frequency- G:0.21NA WA CSA EA EU 5834
    rs5050581,2
    C,F,A,Hnon-pathogenic1162607072(-) TCCTCA/GTCCAC 10 D syn130Minor allele frequency- C:0.00EA NA MN NS WA CSA EU 7080
    rs46411,2
    C,F,Hnon-pathogenic1162608421(+) CACCAC/TGTGAG 9 H syn1 int1 ese322Minor allele frequency- T:0.20MN EA NA NS WA 6526
    rs610464661,2
    Cpathogenic1162585616(+) CGTCCC/TAGCGG 7 Q * nc-transcript-variantstg10--------
    rs589229111,2
    Cpathogenic1162585776(+) AGGGCG/TGCGCC 7 R L nc-transcript-variantmis10--------
    rs1994747241,2
    Cpathogenic1162605517(+) GACCCA/GACTGG 10 Q R mis10--------
    rs612149271,2
    Cpathogenic1162605531(+) AGATTA/GACAAT 10 N D mis10--------
    rs1219124961,2
    Cpathogenic1162605588(+) AACTGC/TGGGCC 10 R W mis10--------
    rs580480781,2
    Cpathogenic1162605620(+) CAGTAA/TAAGAA 10 * Y stg10--------
    rs598853381,2
    Cpathogenic1162605946(+) GCATCC/TGCATC 10 R C mis10--------
    rs604580161,2
    Cpathogenic1162606714(+) TGGACA/G/TAGTAC 16 K E * mis1 stg10--------
    rs616728781,2
    Cpathogenic1162606772(+) CTACCA/G/TCAAGC 16 H R L mis10--------
    rs1219124951,2
    Cpathogenic1162606781(+) GCTCTC/TGGAGG 10 S L mis10--------
    rs586721721,2
    Cpathogenic1162606929(+) GCAGCC/TGTGGC 10 R C mis10--------
    rs1219124931,2
    Cpathogenic1162607052(+) GGCGCA/GTGGCC 10 M V mis10--------
    rs589327041,2
    Cpathogenic1162607091(+) TTGTCC/TGGCTG 10 R W mis10--------
    rs612821061,2
    Cpathogenic1162607612(+) CATGGA/GCAATT 10 D G mis10--------
    rs579200711,2
    Cpathogenic1162607662(+) CTTACC/TGGTTC 10 R W mis10--------
    rs566994801,2
    Cpathogenic1162607695(+) CTGGGC/TAGGTG 10 Q * stg10--------
    rs573186421,2
    Cpathogenic1162607881(+) GCCTGC/TGTACG 10 R C mis10--------
    rs575208921,2
    Cpathogenic1162607882(+) CCTGCA/C/GTACGG 16 H P R mis10--------
    rs1219124941,2
    Cpathogenic1162607887(+) GTACGA/GCTCTC 10 T A mis10--------
    rs605805411,2
    Cpathogenic1162607888(+) TACGGC/TTCTCA 10 A V mis10--------
    rs609340031,2
    Cpathogenic1162607891(+) GGCTCC/TCATCA 10 P L mis10--------
    rs569845621,2
    Cpathogenic1162608344(+) CCATGA/C/G/
            
    GCAAG
    19 S R G C mis1 int10--------
    rs566731691,2
    Cpathogenic1162608349(+) CGCAAC/GCTGGT 9 N K mis1 int10--------
    rs803389381,2
    Cpathogenic1162608434(+) GTAGCA/C/TGCCGC 10 S R C int1 nc-transcript-variantmis10--------
    rs608906281,2
    Cpathogenic1162609185(+) CAGCTC/TGGGGG 6 S L mis10--------
    rs598862141,2
    Cpathogenic1162609288(+) CAGGTA/GGGCGG 6 V syn10--------
    rs610641301,2
    Cpathogenic1162609289(+) AGGTGA/GGCGGA 6 S G mis10--------
    rs585963621,2
    Cpathogenic1162609291(+) GTGGGC/TGGACC 6 G syn10--------
    rs5348071,2
    C,F,Aprobable-non-pathogenic1162606815(-) CCCGAC/TGTCTC 6 -- int18Minor allele frequency- T:0.20NA WA CSA EA 371
    rs803568121,2
    Cprobable-non-pathogenic1162607886(+) CGTACA/GGCTCT 10 T syn10--------
    rs803568131,2
    C,Fprobable-non-pathogenic1162609228(+) GTGCTG/ATGCGG 6 /L syn11Minor allele frequency- A:0.00NA 3564
    rs115496691,2
    Cuntested1162585605(+) CATGGA/GGACCC 7 E G nc-transcript-variantmis1 ese30--------
    rs579668211,2,4
    Cuntested1162585699(+) AAGGAC/G/TGACCT 11 D E nc-transcript-variantmis10--------
    rs2676076261,2
    Cuntested1162605132(+) TGCTGC/TGGCGG 10 R W mis10--------
    rs112644421,2
    C,Funtested1162605262(+) CTTGGA/G/TCTGGG 6 -- int17NA WA EA EU 1608
    rs112644431,2
    Cuntested1162605279(+) GGGACC/TAGCTG 6 -- int15Minor allele frequency- T:0.05NA WA EA 362
    rs803568071,2
    Cuntested1162605473(+) CTCCAA/C/GCCCTT 6 -- int10--------
    rs115496661,2
    C,Huntested1162605534(+) TTGACA/CATGGG 10 N H mis1 ese34Minor allele frequency- C:0.00NS EA 406
    rs582358101,2
    Cuntested1162605566(+) CGGCTA/GGCGGA 10 L syn10--------
    rs605783281,2
    Cuntested1162605618(+) AGCAGC/G/TATAAG 16 H D Y mis10--------
    rs112644451,2
    C,Funtested1162605714(+) ACCCAC/TGCTGG 6 -- int14Minor allele frequency- T:0.29CSA WA 126
    rs6468401,2
    C,F,A,Huntested1162606496(+) GCCAGC/G/TTGTCT 6 -- int113NS EA NA WA CSA 783
    rs1809266991,2
    Cuntested1162606533(+) CCCATA/GCTTAG 6 -- int10--------
    rs115496671,2
    Cuntested1162606664(+) GGAAAA/CGGAGC 10 K T mis1 trp30--------
    rs611773901,2
    Cuntested1162606670(+) GGAGCA/GGGAGA 10 Q R mis10--------
    rs579013071,2
    Cuntested1162606740(+) ATCAAA/GCTGGC 10 K syn10--------
    rs2676076031,2
    Cuntested1162606791(+) GGCGAA/GGAGGA 10 E syn10--------
    rs2676075451,2
    Cuntested1162606799(+) GGAGAA/G/TGTGGG 16 K R M mis10--------
    rs1418794531,2
    Cuntested1162606848(+) GCCGGC/TAACTG 6 -- int10--------
    rs168371981,2
    C,Funtested1162606849(+) CCGGCA/GACTGG 6 -- int16Minor allele frequency- G:0.08NA CSA WA 256
    rs612174361,2
    Cuntested1162607033(+) CAGCAC/TGCACG 10 H syn10--------
    rs1508409241,2
    Cuntested1162607037(+) ACGCAC/TGCACT 10 R C mis11Minor allele frequency- T:0.00NA 4372
    rs599811611,2
    Cuntested1162607676(+) CCAAAC/G/TTTCAC 16 N K mis10--------
    rs2676075431,2
    Cuntested1162607711(+) GGTGAA/C/GTGGCA 6 -- int10--------
    rs5530161,2
    C,F,A,Huntested1162607750(-) CCATCG/ACCACC 6 -- int126Minor allele frequency- A:0.19EA NA NS WA CSA EU 2951
    rs580133251,2
    Cuntested1162607828(+) CCCCC-/CTACCG 10 T Y fra10--------
    rs576293611,2
    Cuntested1162607885(+) GCGTAA/C/G/
            
    GGCTC
    22 K T R M mis10--------
    rs614444591,2
    Cuntested1162608345(+) CATGCA/C/GCAAGC 14 H P R mis1 int10--------
    rs137681,2
    Cuntested1162609338(+) CACTCA/G/TCAGCT 9 H R L mis1 ese33MN NA 188
    rs2676076481,2
    Cuntested1162609359(+) GGGGGA/GCAGTG 6 D G mis10--------
    rs803568141,2
    Cuntested1162609375(+) GGCAGC/TTTCGG 6 S syn10--------
    rs1134362081,2
    Cuntested1162609436(+) CCCAGA/C/GTGAGT 3 -- spd11CSA 1
    rs802642441,2
    C,Funtested1162609461(+) CTCCAA/GATCCT 3 -- int14Minor allele frequency- G:0.01CSA WA EU 1393
    rs2676076821,2
    Cuntested1162609811(+) GTGGGA/GGTGGA 3 -- ut31 int10--------
    rs73391,2
    C,F,Auntested1162609863(-) CATGAC/GGTGCA 3 -- int1 ut31 ese310Minor allele frequency- G:0.14MN NA WA CSA EA 555
    rs20707541,2
    Cuntested1162609931(+) TTTTCT/AAAAAA 3 -- int1 ut31 trp31Minor allele frequency- A:0.00NA 2
    rs7086051,2
    Cuntested1162609976(+) AAAACA/CCAAGC 3 -- int1 ut311Minor allele frequency- C:0.00NA 2
    rs115496651,2
    Cuntested1162610125(+) TTATAG/TAGGCT 3 -- int1 ut31 ese30--------
    rs32045641,2
    Cuntested1162610523(+) CTTTAG/AACCCT 3 -- ut31 ese31Minor allele frequency- A:0.00MN 184
    rs152921,2
    C,Funtested1162610699(+) CTTGCC/TTCCCC 3 -- ut31 ese30--------
    rs5700701,2
    C,Funtested1162610806(+) GTGTAC/TTGAGG 3 -- ds5001 int11Minor allele frequency- T:0.11WA 118
    rs1939227241,2
    Cunknown1162601273(+) ATCTAC/TTCTCC 6 -- int10--------
    rs2015839071,2
    Cunknown1162607869(+) GCTGCA/GGGAAC 10 R G mis10--------
    rs1420009631,2
    C,Funknown1162609397(+) TCACCA/C/TGCTCC 9 S R C mis12NA EU 5603
    VAR_0397734
    ----see VAR_0397732 K N mis40--------
    VAR_0397924
    ----see VAR_0397922 R C mis40--------
    VAR_0397864
    ----see VAR_0397862 R C mis40--------
    VAR_0397904
    ----see VAR_0397902 E V mis40--------
    rs749658331,2
    C--156054119(+) AAGGTT/CGGGGG 1 -- int12Minor allele frequency- C:0.25NA 4
    rs113139041,2
    C,F--156054126(+) GGGGGC/G/TGGTGG 1 -- int12NA 4
    rs2005482761,2
    --156054128(+) GGGTG-/GTGGGGG 1 -- int10--------
    rs113139031,2
    C--156054129(+) GGTGGG/TGGGGG 1 -- int11Minor allele frequency- T:0.00NA 2
    rs2016308131,2
    C--156054129(+) GGTGG-/TGGGGG 1 -- int10--------
    rs1510316941,2
    C--156059392(+) AAAAA-/AAAG  
            
    AAAAG
    1 -- int10--------
    rs590658671,2
    C--156065299(+) TTTTT-/TCTTTT 1 -- int10--------
    rs3703492501,2
    C--156067744(+) CGTGC-/GT/TG 
            
    GTGTG
    1 -- int10--------
    rs681488641,2
    C--156075193(+) TCCCT-/CTACTCT 1 -- int10--------
    rs760424631,2
    C--156075194(+) ATCCCCT/-TACTC 1 -- int11Minor allele frequency- -:0.00CSA 2
    rs40203561,2
    C--156076231(+) CACAG-/AGACACA 1 -- int10--------
    rs1997305251,2
    --156076409(+) CCCCA-/CCCACGCCTC
    TGTCCCCACCCC
    CCCAC
    1 -- int10--------
    rs112684141,2
    C--156076436(+) CCCAC-/GCCTCTGTCC
    CCACCCCCCCAC
    CGCCC
    1 -- int11Minor allele frequency- GCCTCTGTCCCCACCCCCCCAC:0.00NA 2
    rs597292721,2
    C--156080441(+) CCAACC/-TTGGC 1 -- int11Minor allele frequency- -:0.00CSA 2
    rs57779731,2
    C--156081241(+) GTCTC-/AAAAAA 1 -- int1 trp31Minor allele frequency- A:0.50CSA 2
    rs283658581,2
    C,F--156083859(+) CCCCC-/CAAACT 1 -- int12Minor allele frequency- C:0.01MN EA 1252
    rs608807501,2
    C--156092931(+) GCAAG-/AAGGACAG 4 -- int10--------
    rs5446271,2
    C,F--156095413(-) AACCTC/TCACCT 6 -- int1 us2k12Minor allele frequency- T:0.50WA CSA 4
    rs344814891,2
    C--156097478(+) TTTTT-/TGAGAT 6 -- int11Minor allele frequency- T:0.00NA 2
    rs1134488311,2
    C,F--156097564(+) TCTCCG/ACCTCC 6 -- int13Minor allele frequency- A:0.21WA CSA 122
    rs730049991,2
    C,F--156097622(+) ATGGAC/AGTGCA 6 -- int11Minor allele frequency- A:0.50WA 2
    rs5737391,2
    C,F--156097633(-) ggggaA/Tggtgg 6 -- int15Minor allele frequency- T:0.23NA CSA WA 244
    rs101582191,2
    C,A--156102628(+) TCTCtC/Tttttt 6 -- int1 trp31Minor allele frequency- T:0.50CSA 2
    rs1138354641,2
    C,F--156102935(+) AAGACA/GTGTTC 6 -- int10--------
    rs24856661,2
    C--156103192(-) tagagA/Gcaggg 6 -- int10--------
    rs24304141,2
    C,F--156103235(-) ACAGAT/CATGGG 6 -- int12Minor allele frequency- C:0.25WA CSA 4
    rs1130444421,2
    C,F--156103254(+) CTACTC/TGGGAG 6 -- int11Minor allele frequency- T:0.50CSA 2
    rs1929765481,2
    --162551302(+) CCCACC/TCAGGG 1 -- us2k10--------
    rs1846465951,2
    --162551415(+) GTGAAG/TGTTTC 1 -- us2k10--------
    rs1884595901,2
    --162551493(+) TCTGGC/TCCAAG 1 -- us2k10--------
    rs1913813731,2
    --162551531(+) GAGAGA/GGAAGA 1 -- us2k10--------
    rs1496909311,2
    --162551965(+) TGCGAA/GGATAT 1 -- us2k10--------
    rs1836182471,2
    --162552037(+) GTAACA/GGGGAA 1 -- us2k10--------
    rs2018005971,2
    C--162552183(+) AGTGGT/CCCCGG 1 -- us2k11Minor allele frequency- C:0.00EU 419
    rs1471209451,2
    C--162552732(+) AGAGG-/GAGAGAG 1 -- us2k10--------
    rs741164771,2
    C,F--162553058(+) TCTAGC/ACCCCG 1 -- us2k12Minor allele frequency- A:0.12WA 120
    rs120221321,2
    C--162553197(+) GCATGG/AAACTG 1 -- us2k18Minor allele frequency- A:0.00NA WA CSA EA 250
    rs1895579581,2
    --162553418(+) GGAAAC/TAGAGC 1 -- int10--------
    rs67039831,2
    C,A,H--162553567(+) CCGCTC/GGCTCA 1 -- int14Minor allele frequency- G:0.28NA WA 242
    rs1818262261,2
    --162553739(+) CTGCGC/TGTTGT 1 -- nc-transcript-variant0--------
    rs115782301,2
    C,H--162553846(+) CCCCCC/GCCCCC 1 -- nc-transcript-variantese30--------
    rs1148871081,2
    F--162553938(+) CGGTGG/AAGTGA 1 -- int11Minor allele frequency- A:0.03WA 118
    rs1114632621,2
    C,F--162554041(+) TAACCG/ATTTGG 1 -- int11Minor allele frequency- A:0.50WA 2
    rs1854362011,2
    --162554083(+) AGGGAA/GGAGAG 1 -- int10--------
    rs1899034391,2
    --162554364(+) GCCGAG/TCATGG 1 -- int10--------
    rs1391936351,2
    C--162554501(+) AAACA-/AAAC  
            
    AAACA
    1 -- int10--------
    rs1159672001,2
    C,F--162554542(+) GACTCC/TGGAAA 1 -- int11Minor allele frequency- T:0.02WA 118
    rs1469732341,2
    --162554621(+) GAGTGA/TAATGC 1 -- int10--------
    rs1815982991,2
    --162554890(+) AACAGA/TTGAAT 1 -- int10--------
    rs1863204261,2
    --162554912(+) ACTTAC/GCAATG 1 -- int10--------
    rs1381305361,2
    --162554946(+) TTAGTA/CCAGTT 1 -- int10--------
    rs1422433901,2
    --162554966(+) GTTTCG/TTGGAA 1 -- int10--------
    rs1996418441,2
    --162555028(+) GAAGG-/TTCGGG 1 -- int10--------
    rs1425163591,2
    C--162555035(+) GGGGG-/GTGGTGG 1 -- int10--------
    rs1899439651,2
    C--162555213(+) CTACTC/GCCACC 1 -- int10--------
    rs1462143621,2
    --162555694(+) GTGGGC/TGAGGC 1 -- int10--------
    rs1480826251,2
    --162555746(+) AGAATC/GAATCA 1 -- int10--------
    rs567081151,2
    C,F--162555979(+) TCTCAG/AAGTGT 1 -- int11Minor allele frequency- A:0.50WA 2
    rs769090241,2
    --162556001(+) CCTTCG/TCTCTC 1 -- int10--------
    rs120767001,2
    C,F--162556008(+) TCTCTC/GCCGGA 1 -- int18Minor allele frequency- G:0.42NA WA EA 368
    rs120635641,2
    C,F,A,H--162556094(+) TTCCCT/CGCTTG 1 -- int1 trp327Minor allele frequency- C:0.47NS EA NA WA CSA 2776
    rs1387546911,2
    --162556159(+) CCACTC/TTCTGC 1 -- int10--------
    rs120356151,2
    C,F,A,H--162556253(+) TGGTCC/TCCAAC 1 -- int125Minor allele frequency- T:0.11NS EA NA CSA WA 2768
    rs120356541,2
    C,F,A--162556291(+) CCCTGC/TCCAGA 1 -- int18Minor allele frequency- T:0.14NA CSA WA EA 368
    rs1420476271,2
    --162556317(+) GGGTAG/TGTTGA 1 -- int10--------
    rs1463518481,2
    --162556370(+) AGCAGA/GTCTCC 1 -- int10--------
    rs1397214661,2
    --162556756(+) AAAAAA/GTAAAA 1 -- int10--------
    rs1808480261,2
    --162557010(+) AGACTC/TGCTGA 1 -- int10--------
    rs665776491,2
    C--162557094(+) TCTGA-/CT/CT 
    CTCTCTCT
    CTCTC
    1 -- int10--------
    rs1444929561,2
    C--162557443(+) AAGCTA/GTTCTC 1 -- int10--------
    rs1444137931,2
    --162557678(+) CTGGGC/TACCTG 1 -- int10--------
    rs1486117661,2
    --162557749(+) CCTTAA/GCCCTA 1 -- int10--------
    rs115786961,2
    C,F,H--162557876(+) TCTCTA/GTCTGT 1 -- int114Minor allele frequency- G:0.06NS EA NA 1352
    rs1849688011,2
    --162558012(+) ATCTCA/GGCTCA 1 -- int10--------
    rs112644341,2
    C,F--162558235(+) GCGCCC/TGGCTC 1 -- int17Minor allele frequency- T:0.46NA WA CSA EA 366
    rs1909531381,2
    --162558313(+) AGTGGC/TTTGAT 1 -- int10--------
    rs1129412171,2
    C,F--162558325(+) ATGGCT/CCACTG 1 -- int13Minor allele frequency- C:0.05CSA WA 121
    rs1837993941,2
    --162558372(+) CTCAGC/TCTCTC 1 -- int10--------
    rs1420366371,2
    --162558534(+) GGAATC/GAGCCA 1 -- int10--------
    rs1511458501,2
    --162558602(+) TGTCTC/TGCTCG 1 -- int10--------
    rs1887602951,2
    --162558697(+) TCCTGA/GGTAGC 1 -- int10--------
    rs1915597951,2
    --162558812(+) GATCCA/GCCCGC 1 -- int10--------
    rs1451523661,2
    --162558925(+) CTAACC/TACCGT 1 -- int10--------
    rs1834226791,2
    --162559232(+) AGCACG/TGTGGC 1 -- int10--------
    rs1476088831,2
    --162559273(+) AAGGTA/GGAAGG 1 -- int10--------
    rs1422009611,2
    C--162559372(+) GAGACA/GGAGTC 1 -- int10--------
    rs727082551,2
    C,F--162559762(+) ACTTCG/AAACTC 1 -- int11Minor allele frequency- A:0.03NA 120
    rs1871927241,2
    --162559918(+) TGATCC/TGCCTA 1 -- int10--------
    rs1173326231,2
    C,F--162559954(+) TGCAGG/ACATGT 1 -- int11Minor allele frequency- A:0.08EA 120
    rs1407123921,2
    C--162559979(+) CCTTG-/TTTA  
            
    TTTAT
    1 -- int10--------
    rs1501637801,2
    C--162560097(+) TCAAGC/TGATTC 1 -- int10--------
    rs1916878471,2
    --162560140(+) CAGGCA/GCGCAC 1 -- int10--------
    rs112644351,2
    C,F,A,H--162560184(+) GAGACA/GGGGTT 1 -- int14Minor allele frequency- G:0.38NA 8
    rs1489037351,2
    C--162560252(+) CCTCCA/GTTGCA 1 -- int10--------
    rs727082561,2
    C,F--162560303(+) AAAAAG/AAAAGA 1 -- int13Minor allele frequency- A:0.40WA CSA 5
    rs1158601741,2
    C,F--162560394(+) TTGTTG/TTGGAT 1 -- int11Minor allele frequency- T:0.01NA 120
    rs1838633601,2
    --162560413(+) CAAGGA/GCTTTG 1 -- int10--------
    rs1867425731,2
    --162560606(+) GGCTGA/GACCCA 1 -- int10--------
    rs1932819641,2
    --162560687(+) CTCTGA/GTTTCG 1 -- int10--------
    rs46611461,2
    C,F,A,H--162561062(+) GATCTG/CTCATG 1 -- int126Minor allele frequency- C:0.42EA NS NA WA 2934
    rs1855439981,2
    --162561231(+) TTCACA/GTGAAG 1 -- nc-transcript-variant0--------
    rs1904052341,2
    --162561350(+) AGAGGC/TAGACA 1 -- int10--------
    rs101578031,2
    H--162561400(+) GGGAGT/GGGTTC 1 -- int14Minor allele frequency- G:0.00NS EA 392
    rs1432161661,2
    C--162561507(+) TTGCTC/GGTTGA 1 -- int10--------
    rs286534801,2
    C,F--162561569(+) AACACA/GTCTTT 1 -- int110Minor allele frequency- G:0.49NA WA CSA EA 371
    rs560513421,2
    F--162561611(+) AATTCC/GTAGAA 1 -- int10--------
    rs1483027401,2
    --162561697(+) GCTTCC/TTCAGG 1 -- int10--------
    rs1420206061,2
    C--162561852(+) TCACCC/TGGAGA 1 -- int10--------
    rs1850904731,2
    --162561898(+) CGCCCC/TTCTGA 1 -- int10--------
    rs75421861,2
    C,F,A--162562134(+) AACCCC/GGTCTC 1 -- int17Minor allele frequency- G:0.23NA WA CSA 13
    rs1886259271,2
    --162562135(+) ACCCGA/GTCTCT 1 -- int10--------
    rs587136981,2
    F--162562173(+) GGTGGC/TGCATA 1 -- int10--------
    rs75319421,2
    C,F,A--162562198(+) TACTCA/GGGAGG 1 -- int15Minor allele frequency- G:0.33NA WA CSA 9
    rs1430061481,2
    --162562223(+) TCTCTC/TGAACC 1 -- int10--------
    rs1852035901,2
    --162562300(+) AACTCC/TGTCTC 1 -- int10--------
    rs1896188261,2
    --162562301(+) ACTCCA/GTCTCA 1 -- int10--------
    rs1825807321,2
    --162562598(+) AACATA/CGTGAG 1 -- int10--------
    rs1506685631,2
    --162562706(+) ACCTCC/TGCCTC 1 -- int10--------
    rs1871485491,2
    --162562974(+) TCTTAA/GCTACT 1 -- int10--------
    rs1921152121,2
    --162563003(+) GGAGCA/GCTTGA 1 -- int10--------
    rs1399469051,2
    --162563062(+) GTGACA/CGAGCG 1 -- int10--------
    rs1835336011,2
    --162563209(+) AAACCC/TCGTCT 1 -- int10--------
    rs1498565541,2
    --162563351(+) CACTCC/TGGCTC 1 -- int10--------
    rs99192561,2
    C,F,A,H--162563444(+) TCCCCG/ATTGCC 1 -- int122Minor allele frequency- A:0.50NS EA NA WA CSA 2345
    rs1444283801,2
    --162563509(+) CCTGCA/CCACCT 1 -- int10--------
    rs1874067461,2
    --162563597(+) TCTTTC/TTTTTT 1 -- int10--------
    rs1903939091,2
    --162563660(+) GATCTC/TGGCTC 1 -- int10--------
    rs1826036531,2