Free for academic non-profit institutions. Other users need a Commercial license

Aliases for LINCMD1 Gene

Subcategory (RNA class) for LINCMD1 Gene

non-coding RNA

Quality Score for this RNA gene is


Aliases for LINCMD1 Gene

  • Long Intergenic Non-Protein Coding RNA, Muscle Differentiation 1 2 3 5
  • MIR133B Host Gene (Non-Protein Coding) 2 3
  • Long Noncoding RNA, Muscle Differentiation 1 3
  • MIR133BHG 3
  • LINC-MD1 3

External Ids for LINCMD1 Gene

Previous HGNC Symbols for LINCMD1 Gene

  • MIR133BHG
  • LINC-MD1

Previous GeneCards Identifiers for LINCMD1 Gene

  • GC06U902314

Summaries for LINCMD1 Gene

GeneCards Summary for LINCMD1 Gene

LINCMD1 (Long Intergenic Non-Protein Coding RNA, Muscle Differentiation 1) is an RNA Gene, and is affiliated with the non-coding RNA class.

No data available for Entrez Gene Summary , UniProtKB/Swiss-Prot , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for LINCMD1 Gene

Genomics for LINCMD1 Gene

Genomic Location for LINCMD1 Gene

52,146,814 bp from pter
52,151,119 bp from pter
4,306 bases
Minus strand

Genomic View for LINCMD1 Gene

Genes around LINCMD1 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
LINCMD1 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for LINCMD1 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

No data available for Regulatory Elements and RefSeq DNA sequence for LINCMD1 Gene

Proteins for LINCMD1 Gene

Post-translational modifications for LINCMD1 Gene

No Post-translational modifications

No data available for DME Specific Peptides for LINCMD1 Gene

Domains & Families for LINCMD1 Gene

Gene Families for LINCMD1 Gene

Graphical View of Domain Structure for InterPro Entry

genes like me logo Genes that share domains with LINCMD1: view

No data available for Protein Domains , Suggested Antigen Peptide Sequences and UniProtKB/Swiss-Prot for LINCMD1 Gene

Function for LINCMD1 Gene

No data available for Molecular function , Enzyme Numbers (IUBMB) , Gene Ontology (GO) - Molecular Function , Phenotypes , Human Phenotype Ontology , Animal Models , miRNA , Transcription Factor Targets and HOMER Transcription for LINCMD1 Gene

Localization for LINCMD1 Gene

No data available for Subcellular locations from UniProtKB/Swiss-Prot , Subcellular locations from COMPARTMENTS and Gene Ontology (GO) - Cellular Components for LINCMD1 Gene

Pathways & Interactions for LINCMD1 Gene

SuperPathways for LINCMD1 Gene

No Data Available

Interacting Proteins for LINCMD1 Gene

Gene Ontology (GO) - Biological Process for LINCMD1 Gene


No data available for Pathways by source and SIGNOR curated interactions for LINCMD1 Gene

Drugs & Compounds for LINCMD1 Gene

No Compound Related Data Available

Transcripts for LINCMD1 Gene

mRNA/cDNA for LINCMD1 Gene

(1) Ensembl transcripts including schematic representations, and UCSC links where relevant :

Alternative Splicing Database (ASD) splice patterns (SP) for LINCMD1 Gene

No ASD Table

Relevant External Links for LINCMD1 Gene

GeneLoc Exon Structure for
ECgene alternative splicing isoforms for

Expression for LINCMD1 Gene

mRNA expression in normal human tissues for LINCMD1 Gene

genes like me logo Genes that share expression patterns with LINCMD1: view

No data available for mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , mRNA differential expression in normal tissues , Protein differential expression in normal tissues , Protein expression , mRNA Expression by UniProt/SwissProt and Protein tissue co-expression partners for LINCMD1 Gene

Orthologs for LINCMD1 Gene

Evolution for LINCMD1 Gene

Gene Tree for LINCMD1 (if available)
Gene Tree for LINCMD1 (if available)

No data available for Orthologs for LINCMD1 Gene

Paralogs for LINCMD1 Gene

No data available for Paralogs for LINCMD1 Gene

Variants for LINCMD1 Gene

Sequence variations from dbSNP and Humsavar for LINCMD1 Gene

SNP ID Clin Chr 06 pos Sequence Context AA Info Type
rs2184461 -- 52,149,951(-) AATTT(A/T)AAACC intron-variant
rs3838323 -- 52,150,084(-) CCAGG(-/AAGGGGCAGCATTCAACCCCAGG)TCTTC intron-variant
rs3789778 -- 52,150,249(-) TATAT(C/T)TGGCT intron-variant
rs3789779 -- 52,150,245(-) TTTGG(C/T)TCTTT intron-variant
rs9474162 -- 52,151,170(+) CATGA(A/G)AATAC upstream-variant-2KB

Relevant External Links for LINCMD1 Gene

HapMap Linkage Disequilibrium report

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot , Structural Variations from Database of Genomic Variants (DGV) and Variation tolerance for LINCMD1 Gene

Disorders for LINCMD1 Gene

Relevant External Links for LINCMD1

Atlas of Genetics and Cytogenetics in Oncology and Haematology:

No disorders were found for LINCMD1 Gene.

No data available for MalaCards , UniProtKB/Swiss-Prot and Genatlas for LINCMD1 Gene

Publications for LINCMD1 Gene

  1. Genome-wide profiling of long noncoding ribonucleic acid expression patterns in ovarian endometriosis by microarray. (PMID: 24502888) Sun P.R. … Lang J.H. (Fertil. Steril. 2014) 3 67
  2. Genome-wide analysis of long noncoding RNA expression in peripheral blood mononuclear cells of uremia patients. (PMID: 23100179) Sui W. … Dai Y. (J. Nephrol. 2013) 3
  3. A long noncoding RNA controls muscle differentiation by functioning as a competing endogenous RNA. (PMID: 22000014) Cesana M. … Bozzoni I. (Cell 2011) 3
  4. Creation of genome-wide protein expression libraries using random activation of gene expression. (PMID: 11329013) Harrington J.J. … Ducar M. (Nat. Biotechnol. 2001) 3

Products for LINCMD1 Gene

Sources for LINCMD1 Gene

Back to Top
