Free for academic non-profit institutions. Other users need a Commercial license

Aliases for LARP1 Gene

Aliases for LARP1 Gene

  • La Ribonucleoprotein Domain Family Member 1 2 3 4 5
  • LARP 3 4
  • La Ribonucleoprotein Domain Family, Member 1 2
  • La-Related Protein 1 3
  • KIAA0731 4

External Ids for LARP1 Gene

Previous GeneCards Identifiers for LARP1 Gene

  • GC05P154073
  • GC05P154092
  • GC05P149234

Summaries for LARP1 Gene

GeneCards Summary for LARP1 Gene

LARP1 (La Ribonucleoprotein Domain Family Member 1) is a Protein Coding gene. Among its related pathways are Translational Control. Gene Ontology (GO) annotations related to this gene include translation initiation factor binding. An important paralog of this gene is LARP1B.

UniProtKB/Swiss-Prot for LARP1 Gene

  • RNA-binding protein that promotes translation of specific classes of mRNAs downstream of the mTORC1 complex (PubMed:24532714, PubMed:25940091). Associates with the mRNA 5cap in an MTOR-dependent manner and associates with mRNAs containing a 5 terminal oligopyrimidine (5TOP) motif, which is present in mRNAs encoding for ribosomal proteins and several components of the translation machinery (PubMed:24532714, PubMed:25940091, PubMed:26206669). Associates with actively translating ribosomes via interaction with PABPC1/PABP and stimulates translation of mRNAs containing a 5TOP, thereby regulating cell growth and proliferation (PubMed:20430826, PubMed:25940091). Positively regulates the replication of dengue virus (DENV) (PubMed:26735137).

Gene Wiki entry for LARP1 Gene

Additional gene information for LARP1 Gene

No data available for Entrez Gene Summary , CIViC summary , Tocris Summary , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for LARP1 Gene

Genomics for LARP1 Gene

GeneHancer (GH) Regulatory Elements for LARP1 Gene

Promoters and enhancers for LARP1 Gene
GeneHancer (GH) Identifier GH Type GH
GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites
Gene Targets
GH05I154711 Promoter/Enhancer 1.5 EPDnew Ensembl ENCODE 578.3 +31.0 30971 3.5 FOXA2 SIN3A THRB ZNF48 RAD21 RFX5 YY1 ETS1 ZSCAN5C SCRT2 LARP1 CNOT8 RN7SL803P ENSG00000274472
GH05I154682 Enhancer 1.5 FANTOM5 Ensembl ENCODE 560.5 +0.5 476 2.3 HDGF FOXA2 PKNOX1 CLOCK MLX ARNT ZFP64 ARID4B SIN3A DMAP1 LARP1 GC05P154683 GEMIN5 SAP30L-AS1 CNOT8 MIR1303
GH05I154834 Enhancer 1.5 Ensembl ENCODE dbSUPER 29.4 +152.4 152419 1.7 PKNOX1 FOXA2 MLX ARNT ARID4B FEZF1 ZNF2 YY1 ZNF766 ZNF213 CNOT8 SAP30L-AS1 LARP1 MFAP3 GEMIN5 FAM114A2 FAXDC2 MIR378H
GH05I154752 Promoter/Enhancer 2 Ensembl ENCODE dbSUPER 18.5 +74.8 74820 9.1 CLOCK MLX DMAP1 YY1 E2F8 ZNF143 ZNF263 SP3 MEF2D ZNF610 SAP30L-AS1 CNOT8 GEMIN5 LARP1 MIR1303 FAM114A2 GC05M154784 GC05P154730
GH05I154723 Enhancer 1 Ensembl ENCODE 26.6 +41.5 41467 1.8 TEAD4 TAL1 ZFP64 E4F1 TCF12 GATA3 ZNF316 FOXK2 NCOR1 ZBTB48 LARP1 CNOT8 RPL21P57 RN7SL803P
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data dump

GeneHancers around LARP1 on UCSC Golden Path with GeneCards custom track

Top Transcription factor binding sites by QIAGEN in the LARP1 gene promoter:

Genomic Locations for LARP1 Gene

Genomic Locations for LARP1 Gene
134,945 bases
Plus strand

Genomic View for LARP1 Gene

Genes around LARP1 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
LARP1 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for LARP1 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for LARP1 Gene

Proteins for LARP1 Gene

  • Protein details for LARP1 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Recommended name:
    La-related protein 1
    Protein Accession:
    Secondary Accessions:
    • O94836
    • Q8N4M2
    • Q8NB73
    • Q9UFD7

    Protein attributes for LARP1 Gene

    1096 amino acids
    Molecular mass:
    123510 Da
    Quaternary structure:
    • Interacts with PABPC1/PABP (PubMed:20430826, PubMed:24532714, PubMed:25940091). Associates with the mTORC1 complex via interaction with RPTOR (PubMed:25940091). Interacts with EIF4E (PubMed:20430826). Found in a complex with PABPC1 and RYDEN (PubMed:26735137).
    • Sequence=AAH33856.1; Type=Erroneous initiation; Evidence={ECO:0000305}; Sequence=BAA34451.1; Type=Miscellaneous discrepancy; Note=Aberrant splicing.; Evidence={ECO:0000305};

    Three dimensional structures from OCA and Proteopedia for LARP1 Gene

    Alternative splice isoforms for LARP1 Gene


neXtProt entry for LARP1 Gene

Post-translational modifications for LARP1 Gene

  • Ubiquitination at isoforms=3539, posLast=753753, posLast=792792, isoforms=3805, isoforms=3881, isoforms=3944, posLast=972972, and posLast=10171017

No data available for DME Specific Peptides for LARP1 Gene

Domains & Families for LARP1 Gene

Gene Families for LARP1 Gene

Human Protein Atlas (HPA):
  • Plasma proteins
  • Predicted intracellular proteins

Protein Domains for LARP1 Gene

Suggested Antigen Peptide Sequences for LARP1 Gene

GenScript: Design optimal peptide antigens:

Graphical View of Domain Structure for InterPro Entry



  • Belongs to the LARP family.
  • Belongs to the LARP family.
genes like me logo Genes that share domains with LARP1: view

Function for LARP1 Gene

Molecular function for LARP1 Gene

UniProtKB/Swiss-Prot Function:
RNA-binding protein that promotes translation of specific classes of mRNAs downstream of the mTORC1 complex (PubMed:24532714, PubMed:25940091). Associates with the mRNA 5cap in an MTOR-dependent manner and associates with mRNAs containing a 5 terminal oligopyrimidine (5TOP) motif, which is present in mRNAs encoding for ribosomal proteins and several components of the translation machinery (PubMed:24532714, PubMed:25940091, PubMed:26206669). Associates with actively translating ribosomes via interaction with PABPC1/PABP and stimulates translation of mRNAs containing a 5TOP, thereby regulating cell growth and proliferation (PubMed:20430826, PubMed:25940091). Positively regulates the replication of dengue virus (DENV) (PubMed:26735137).
UniProtKB/Swiss-Prot Induction:
Up-regulated in a number of hepatocellular carcinoma cell lines and liver cancer lesions, as well as in patients with hepatocellular carcinoma with a lower survival rate (at protein level).

Phenotypes From GWAS Catalog for LARP1 Gene

Gene Ontology (GO) - Molecular Function for LARP1 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0000339 RNA cap binding IDA 24532714
GO:0003723 RNA binding HDA,IEA 22658674
GO:0003730 mRNA 3-UTR binding IDA 23711370
GO:0005515 protein binding IPI 20430826
GO:0008190 eukaryotic initiation factor 4E binding IPI 20430826
genes like me logo Genes that share ontologies with LARP1: view
genes like me logo Genes that share phenotypes with LARP1: view

miRNA for LARP1 Gene

miRTarBase miRNAs that target LARP1

Clone Products

No data available for Enzyme Numbers (IUBMB) , Human Phenotype Ontology , Animal Models , Transcription Factor Targets and HOMER Transcription for LARP1 Gene

Localization for LARP1 Gene

Subcellular locations from UniProtKB/Swiss-Prot for LARP1 Gene

Cytoplasm. Cytoplasmic granule. Note=Colocalizes with RPTOR and PABPC1 in cytoplasmic granules that resemble stress granules. {ECO:0000269 PubMed:25940091}.

Subcellular locations from

Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for LARP1 gene
Compartment Confidence
nucleus 4
cytosol 4

Subcellular locations from the

Human Protein Atlas (HPA)
  • Cytosol (3)
  • Endoplasmic reticulum (2)
  • Nucleus (2)
See all subcellular structures

Gene Ontology (GO) - Cellular Components for LARP1 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005737 cytoplasm IDA,IEA 20430826
GO:0005844 colocalizes_with polysome IDA 25940091
GO:0010494 cytoplasmic stress granule IDA 25940091
GO:0016020 membrane HDA,IDA 19946888
GO:0031931 colocalizes_with TORC1 complex IDA 24532714
genes like me logo Genes that share ontologies with LARP1: view

Pathways & Interactions for LARP1 Gene

SuperPathways for LARP1 Gene

SuperPathway Contained pathways
1 Translational Control
genes like me logo Genes that share pathways with LARP1: view

Pathways by source for LARP1 Gene

1 Cell Signaling Technology pathway for LARP1 Gene

Gene Ontology (GO) - Biological Process for LARP1 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0006412 translation IEA --
GO:0006413 translational initiation IMP 20430826
GO:0006417 regulation of translation IEA --
GO:0008283 cell proliferation IMP 24532714
GO:0016239 positive regulation of macroautophagy IMP 22354037
genes like me logo Genes that share ontologies with LARP1: view

No data available for SIGNOR curated interactions for LARP1 Gene

Drugs & Compounds for LARP1 Gene

No Compound Related Data Available

Transcripts for LARP1 Gene

Unigene Clusters for LARP1 Gene

La ribonucleoprotein domain family, member 1:
Representative Sequences:

Clone Products

Alternative Splicing Database (ASD) splice patterns (SP) for LARP1 Gene

No ASD Table

Relevant External Links for LARP1 Gene

GeneLoc Exon Structure for
ECgene alternative splicing isoforms for

Expression for LARP1 Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for LARP1 Gene

Protein differential expression in normal tissues from HIPED for LARP1 Gene

This gene is overexpressed in Lung (31.0) and Pancreas (6.6).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, PaxDb, MaxQB, and MOPED for LARP1 Gene

Protein tissue co-expression partners for LARP1 Gene

- Elite partner

NURSA nuclear receptor signaling pathways regulating expression of LARP1 Gene:


SOURCE GeneReport for Unigene cluster for LARP1 Gene:


Evidence on tissue expression from TISSUES for LARP1 Gene

  • Nervous system(4.9)
  • Liver(4.4)
  • Lung(3.3)
  • Skin(3.2)
  • Eye(2.8)
  • Intestine(2.7)
  • Muscle(2)
genes like me logo Genes that share expression patterns with LARP1: view

No data available for mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , mRNA differential expression in normal tissues , mRNA Expression by UniProt/SwissProt and Phenotype-based relationships between genes and organs from Gene ORGANizer for LARP1 Gene

Orthologs for LARP1 Gene

This gene was present in the common ancestor of eukaryotes.

Orthologs for LARP1 Gene

Organism Taxonomy Gene Similarity Type Details
(Pan troglodytes)
Mammalia LARP1 33 34
  • 99.61 (n)
(Canis familiaris)
Mammalia LARP1 33 34
  • 93.73 (n)
(Bos Taurus)
Mammalia LARP1 33 34
  • 91.15 (n)
(Mus musculus)
Mammalia Larp1 33 16 34
  • 90.19 (n)
(Rattus norvegicus)
Mammalia Larp1 33
  • 89.68 (n)
(Monodelphis domestica)
Mammalia LARP1 34
  • 83 (a)
(Ornithorhynchus anatinus)
Mammalia LARP1 34
  • 81 (a)
(Gallus gallus)
Aves LARP1 33 34
  • 78.15 (n)
(Anolis carolinensis)
Reptilia LARP1 34
  • 79 (a)
tropical clawed frog
(Silurana tropicalis)
Amphibia larp1 33
  • 72.91 (n)
(Danio rerio)
Actinopterygii larp1 33 34
  • 69.46 (n)
fruit fly
(Drosophila melanogaster)
Insecta larp 34
  • 17 (a)
(Caenorhabditis elegans)
Secernentea larp-1 34
  • 20 (a)
(Zea mays)
Liliopsida Zm.4402 33
sea squirt
(Ciona savignyi)
Ascidiacea -- 34
  • 52 (a)
-- 34
  • 24 (a)
Species where no ortholog for LARP1 was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)

Evolution for LARP1 Gene

Gene Tree for LARP1 (if available)
Gene Tree for LARP1 (if available)

Paralogs for LARP1 Gene

Paralogs for LARP1 Gene Pseudogenes for LARP1 Gene

genes like me logo Genes that share paralogs with LARP1: view

Variants for LARP1 Gene

Sequence variations from dbSNP and Humsavar for LARP1 Gene

SNP ID Clin Chr 05 pos Variation AA Info Type
rs1000014446 -- 154,735,642(+) C/T genic_upstream_transcript_variant, intron_variant
rs1000037353 -- 154,812,377(+) A/C/G intron_variant
rs1000057443 -- 154,726,508(+) T/C genic_upstream_transcript_variant, intron_variant
rs1000059239 -- 154,771,795(+) A/C/G genic_upstream_transcript_variant, intron_variant
rs1000071129 -- 154,694,035(+) ACAAAGAAGCAATCAGACAAAG/ACAAAG genic_upstream_transcript_variant, intron_variant

Structural Variations from Database of Genomic Variants (DGV) for LARP1 Gene

Variant ID Type Subtype PubMed ID
dgv3198n106 CNV deletion 24896259
esv2730937 CNV deletion 23290073
esv3566846 CNV deletion 23714750
nsv1021153 CNV gain 25217958
nsv1074339 CNV deletion 25765185
nsv1123999 CNV deletion 24896259
nsv1140583 CNV deletion 24896259
nsv830521 CNV gain 17160897
nsv964965 CNV duplication 23825009

Variation tolerance for LARP1 Gene

Residual Variation Intolerance Score: 12% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 1.53; 29.68% of all genes are more intolerant (likely to be disease-causing)

Additional Variant Information for LARP1 Gene

SNPedia medical, phenotypic, and genealogical associations of SNPs for

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for LARP1 Gene

Disorders for LARP1 Gene

Additional Disease Information for LARP1

No disorders were found for LARP1 Gene.

No data available for MalaCards , UniProtKB/Swiss-Prot and Genatlas for LARP1 Gene

Publications for LARP1 Gene

  1. Prediction of the coding sequences of unidentified human genes. XI. The complete sequences of 100 new cDNA clones from brain which code for large proteins in vitro. (PMID: 9872452) Nagase T … Ohara O (DNA research : an international journal for rapid publication of reports on genes and genomes 1998) 2 3 4 58
  2. Characterization of RyDEN (C19orf66) as an Interferon-Stimulated Cellular Inhibitor against Dengue Virus Replication. (PMID: 26735137) Suzuki Y … Yamamoto N (PLoS pathogens 2016) 3 4 58
  3. La-related Protein 1 (LARP1) Represses Terminal Oligopyrimidine (TOP) mRNA Translation Downstream of mTOR Complex 1 (mTORC1). (PMID: 25940091) Fonseca BD … Damgaard CK (The Journal of biological chemistry 2015) 3 4 58
  4. The La-related protein 1-specific domain repurposes HEAT-like repeats to directly bind a 5'TOP sequence. (PMID: 26206669) Lahr RM … Berman AJ (Nucleic acids research 2015) 3 4 58
  5. Proteomic analysis of cap-dependent translation identifies LARP1 as a key regulator of 5'TOP mRNA translation. (PMID: 24532714) Tcherkezian J … Roux PP (Genes & development 2014) 3 4 58

Products for LARP1 Gene

Sources for LARP1 Gene

Loading form....