Free for academic non-profit institutions. Other users need a Commercial license

Aliases for KRTAP9-1 Gene

Aliases for KRTAP9-1 Gene

  • Keratin Associated Protein 9-1 2 3 5
  • Keratin Associated Protein 9-Like 3 2 3
  • KAP9.1 3 4
  • Putative Keratin-Associated Protein 9-2-Like 3 3
  • KRTAP9L3 3
  • KRTAP9.1 4

External Ids for KRTAP9-1 Gene

Previous HGNC Symbols for KRTAP9-1 Gene

  • KRTAP9L3

Previous GeneCards Identifiers for KRTAP9-1 Gene

  • GC17U900021
  • GC17P036598
  • GC17P039346
  • GC17P035121
  • GC17P039344

Summaries for KRTAP9-1 Gene

GeneCards Summary for KRTAP9-1 Gene

KRTAP9-1 (Keratin Associated Protein 9-1) is a Protein Coding gene. An important paralog of this gene is KRTAP9-8.

UniProtKB/Swiss-Prot for KRTAP9-1 Gene

  • In the hair cortex, hair keratin intermediate filaments are embedded in an interfilamentous matrix, consisting of hair keratin-associated proteins (KRTAP), which are essential for the formation of a rigid and resistant hair shaft through their extensive disulfide bond cross-linking with abundant cysteine residues of hair keratins. The matrix proteins include the high-sulfur and high-glycine-tyrosine keratins (By similarity).

No data available for Entrez Gene Summary , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for KRTAP9-1 Gene

Genomics for KRTAP9-1 Gene

Genomic Location for KRTAP9-1 Gene

41,189,887 bp from pter
41,190,639 bp from pter
753 bases
Plus strand

Genomic View for KRTAP9-1 Gene

Genes around KRTAP9-1 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
KRTAP9-1 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for KRTAP9-1 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for KRTAP9-1 Gene

No data available for Regulatory Elements for KRTAP9-1 Gene

Proteins for KRTAP9-1 Gene

  • Protein details for KRTAP9-1 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Recommended name:
    Keratin-associated protein 9-1
    Protein Accession:

    Protein attributes for KRTAP9-1 Gene

    250 amino acids
    Molecular mass:
    26333 Da
    Quaternary structure:
    • Interacts with hair keratins.

neXtProt entry for KRTAP9-1 Gene

Proteomics data for KRTAP9-1 Gene at MOPED

Post-translational modifications for KRTAP9-1 Gene

  • Modification sites at PhosphoSitePlus
  • Modification sites at neXtProt

Other Protein References for KRTAP9-1 Gene

No data available for DME Specific Peptides for KRTAP9-1 Gene

Domains & Families for KRTAP9-1 Gene

Gene Families for KRTAP9-1 Gene

Protein Domains for KRTAP9-1 Gene


Suggested Antigen Peptide Sequences for KRTAP9-1 Gene

GenScript: Design optimal peptide antigens:

Graphical View of Domain Structure for InterPro Entry



  • Belongs to the KRTAP type 9 family.
  • Belongs to the KRTAP type 9 family.
genes like me logo Genes that share domains with KRTAP9-1: view

Function for KRTAP9-1 Gene

Molecular function for KRTAP9-1 Gene

UniProtKB/Swiss-Prot Function:
In the hair cortex, hair keratin intermediate filaments are embedded in an interfilamentous matrix, consisting of hair keratin-associated proteins (KRTAP), which are essential for the formation of a rigid and resistant hair shaft through their extensive disulfide bond cross-linking with abundant cysteine residues of hair keratins. The matrix proteins include the high-sulfur and high-glycine-tyrosine keratins (By similarity).

Phenotypes for KRTAP9-1 Gene

genes like me logo Genes that share phenotypes with KRTAP9-1: view

Animal Model Products

CRISPR Products

No data available for Enzyme Numbers (IUBMB) , Gene Ontology (GO) - Molecular Function , Human Phenotype Ontology , Animal Models , miRNA , Transcription Factor Targets and HOMER Transcription for KRTAP9-1 Gene

Localization for KRTAP9-1 Gene

Subcellular locations from

Jensen Localization Image for KRTAP9-1 Gene COMPARTMENTS Subcellular localization image for KRTAP9-1 gene
Compartment Confidence
cytoskeleton 2
cytosol 2
extracellular 2
nucleus 1
peroxisome 1

No data available for Subcellular locations from UniProtKB/Swiss-Prot and Gene Ontology (GO) - Cellular Components for KRTAP9-1 Gene

Pathways & Interactions for KRTAP9-1 Gene

SuperPathways for KRTAP9-1 Gene

No Data Available

Interacting Proteins for KRTAP9-1 Gene

Gene Ontology (GO) - Biological Process for KRTAP9-1 Gene


No data available for Pathways by source and SIGNOR curated interactions for KRTAP9-1 Gene

Drugs & Compounds for KRTAP9-1 Gene

No Compound Related Data Available

Transcripts for KRTAP9-1 Gene

mRNA/cDNA for KRTAP9-1 Gene

(2) REFSEQ mRNAs :
(4) Ensembl transcripts including schematic representations, and UCSC links where relevant :

Alternative Splicing Database (ASD) splice patterns (SP) for KRTAP9-1 Gene

No ASD Table

Relevant External Links for KRTAP9-1 Gene

GeneLoc Exon Structure for
ECgene alternative splicing isoforms for

Expression for KRTAP9-1 Gene

mRNA expression in normal human tissues for KRTAP9-1 Gene

mRNA differential expression in normal tissues according to GTEx for KRTAP9-1 Gene

This gene is overexpressed in Skin - Not Sun Exposed (Suprapubic) (x37.5), Colon - Transverse (x7.8), and Skin - Sun Exposed (Lower leg) (x7.7).

SOURCE GeneReport for Unigene cluster for KRTAP9-1 Gene Hs.727478

genes like me logo Genes that share expression patterns with KRTAP9-1: view

In Situ Assay Products

No data available for mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , Protein differential expression in normal tissues , Protein expression , mRNA Expression by UniProt/SwissProt and Protein tissue co-expression partners for KRTAP9-1 Gene

Orthologs for KRTAP9-1 Gene

This gene was present in the common ancestor of mammals.

Orthologs for KRTAP9-1 Gene

Organism Taxonomy Gene Similarity Type Details
(Pan troglodytes)
Mammalia LOC100613989 35
  • 98.83 (n)
  • 97.37 (a)
KRTAP9-1 36
  • 98 (a)
(Bos Taurus)
Mammalia -- 36
  • 48 (a)
KRTAP9-1 36
  • 43 (a)
(Mus musculus)
Mammalia Gm11559 36
  • 57 (a)
Gm11567 36
  • 55 (a)
Gm11568 36
  • 52 (a)
Krtap9-1 36
  • 59 (a)
Krtap9-5 35
  • 68.71 (n)
  • 57.65 (a)
Krtap9-5 16
(Rattus norvegicus)
Mammalia LOC100364862 35
  • 71.09 (n)
  • 61.06 (a)
Species with no ortholog for KRTAP9-1:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • chicken (Gallus gallus)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • dog (Canis familiaris)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • fruit fly (Drosophila melanogaster)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • lizard (Anolis carolinensis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • oppossum (Monodelphis domestica)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • platypus (Ornithorhynchus anatinus)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea squirt (Ciona intestinalis)
  • sea squirt (Ciona savignyi)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • tropical clawed frog (Silurana tropicalis)
  • wheat (Triticum aestivum)
  • worm (Caenorhabditis elegans)
  • zebrafish (Danio rerio)

Evolution for KRTAP9-1 Gene

Gene Tree for KRTAP9-1 (if available)
Gene Tree for KRTAP9-1 (if available)

Paralogs for KRTAP9-1 Gene

Paralogs for KRTAP9-1 Gene

(10) SIMAP similar genes for KRTAP9-1 Gene using alignment to 3 proteins:

genes like me logo Genes that share paralogs with KRTAP9-1: view

Variants for KRTAP9-1 Gene

Sequence variations from dbSNP and Humsavar for KRTAP9-1 Gene

SNP ID Clin Chr 17 pos Sequence Context AA Info Type
rs976092 -- 41,189,154(-) TAATT(C/T)TAATA upstream-variant-2KB
rs976093 -- 41,188,910(-) TGTGT(G/T)TTTTT upstream-variant-2KB
rs1639124 -- 41,190,300(-) TGGCA(A/G)CAGGT reference, synonymous-codon
rs33927480 -- 41,190,344(+) ACCTG(-/GCTGTGGGTCCAGCTGCTGCCAGCCTA)CTGTG intron-variant, cds-indel

Structural Variations from Database of Genomic Variants (DGV) for KRTAP9-1 Gene

Variant ID Type Subtype PubMed ID
nsv908232 CNV Loss 21882294
nsv833446 CNV Gain 17160897
dgv961e1 CNV Complex 17122850

Variation tolerance for KRTAP9-1 Gene

Residual Variation Intolerance Score: 91.5% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 6.75; 78.85% of all genes are more intolerant (likely to be disease-causing)

Relevant External Links for KRTAP9-1 Gene

HapMap Linkage Disequilibrium report

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for KRTAP9-1 Gene

Disorders for KRTAP9-1 Gene

Relevant External Links for KRTAP9-1

Atlas of Genetics and Cytogenetics in Oncology and Haematology:

No disorders were found for KRTAP9-1 Gene.

No data available for MalaCards , UniProtKB/Swiss-Prot and Genatlas for KRTAP9-1 Gene

Publications for KRTAP9-1 Gene

  1. DNA sequence of human chromosome 17 and analysis of rearrangement in the human lineage. (PMID: 16625196) Zody M.C. … Nusbaum C. (Nature 2006) 3 4 67
  2. Characterization of a cluster of human high/ultrahigh sulfur keratin- associated protein genes embedded in the type I keratin gene domain on chromosome 17q12-21. (PMID: 11279113) Rogers M.A. … Schweizer J. (J. Biol. Chem. 2001) 3

Products for KRTAP9-1 Gene

Sources for KRTAP9-1 Gene

Back to Top
