Free for academic non-profit institutions. Other users need a Commercial license

Aliases for KRTAP5-1 Gene

Aliases for KRTAP5-1 Gene

  • Keratin Associated Protein 5-1 2 3 5
  • Ultrahigh Sulfur Keratin-Associated Protein 5.1 3 4
  • Keratin, Cuticle, Ultrahigh Sulphur 1-Like 2 4
  • Keratin-Associated Protein 5.1 3 4
  • KRTAP5.1 3 4
  • KRN1L 3 4
  • Keratin-Associated Protein 5-1 3
  • KAP5.1 4

External Ids for KRTAP5-1 Gene

Previous HGNC Symbols for KRTAP5-1 Gene

  • KRN1L

Previous GeneCards Identifiers for KRTAP5-1 Gene

  • GC00U913937
  • GC11U900626
  • GC11M001562
  • GC11M001605
  • GC11M001398

Summaries for KRTAP5-1 Gene

GeneCards Summary for KRTAP5-1 Gene

KRTAP5-1 (Keratin Associated Protein 5-1) is a Protein Coding gene.

UniProtKB/Swiss-Prot for KRTAP5-1 Gene

  • In the hair cortex, hair keratin intermediate filaments are embedded in an interfilamentous matrix, consisting of hair keratin-associated protein (KRTAP), which are essential for the formation of a rigid and resistant hair shaft through their extensive disulfide bond cross-linking with abundant cysteine residues of hair keratins. The matrix proteins include the high-sulfur and high-glycine-tyrosine keratins.

No data available for Entrez Gene Summary , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for KRTAP5-1 Gene

Genomics for KRTAP5-1 Gene

Regulatory Elements for KRTAP5-1 Gene

Enhancers for KRTAP5-1 Gene
GeneHancer Identifier Enhancer Score Enhancer Sources Gene-Enhancer Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor Binding Sites within enhancer Gene Targets for Enhancer
- Elite enhancer/Elite enhancer-gene association

Enhancers around KRTAP5-1 on UCSC Golden Path with GeneCards custom track

Genomic Location for KRTAP5-1 Gene

1,584,342 bp from pter
1,585,283 bp from pter
942 bases
Minus strand

Genomic View for KRTAP5-1 Gene

Genes around KRTAP5-1 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
KRTAP5-1 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for KRTAP5-1 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for KRTAP5-1 Gene

Proteins for KRTAP5-1 Gene

  • Protein details for KRTAP5-1 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Recommended name:
    Keratin-associated protein 5-1
    Protein Accession:

    Protein attributes for KRTAP5-1 Gene

    278 amino acids
    Molecular mass:
    24194 Da
    Quaternary structure:
    • Interacts with hair keratins.

neXtProt entry for KRTAP5-1 Gene

Post-translational modifications for KRTAP5-1 Gene

  • Modification sites at PhosphoSitePlus
  • Modification sites at neXtProt

Other Protein References for KRTAP5-1 Gene

ENSEMBL proteins:
REFSEQ proteins:

No data available for DME Specific Peptides for KRTAP5-1 Gene

Domains & Families for KRTAP5-1 Gene

Gene Families for KRTAP5-1 Gene

Protein Domains for KRTAP5-1 Gene


Suggested Antigen Peptide Sequences for KRTAP5-1 Gene

GenScript: Design optimal peptide antigens:

Graphical View of Domain Structure for InterPro Entry



  • Belongs to the KRTAP type 5 family.
  • Belongs to the KRTAP type 5 family.
genes like me logo Genes that share domains with KRTAP5-1: view

Function for KRTAP5-1 Gene

Molecular function for KRTAP5-1 Gene

UniProtKB/Swiss-Prot Function:
In the hair cortex, hair keratin intermediate filaments are embedded in an interfilamentous matrix, consisting of hair keratin-associated protein (KRTAP), which are essential for the formation of a rigid and resistant hair shaft through their extensive disulfide bond cross-linking with abundant cysteine residues of hair keratins. The matrix proteins include the high-sulfur and high-glycine-tyrosine keratins.

Phenotypes for KRTAP5-1 Gene

GenomeRNAi human phenotypes for KRTAP5-1:
genes like me logo Genes that share phenotypes with KRTAP5-1: view

Animal Model Products

CRISPR Products

Clone Products

Flow Cytometry Products

No data available for Enzyme Numbers (IUBMB) , Gene Ontology (GO) - Molecular Function , Human Phenotype Ontology , Animal Models , miRNA , Transcription Factor Targets and HOMER Transcription for KRTAP5-1 Gene

Localization for KRTAP5-1 Gene

Subcellular locations from

Jensen Localization Image for KRTAP5-1 Gene COMPARTMENTS Subcellular localization image for KRTAP5-1 gene
Compartment Confidence
nucleus 3
cytoskeleton 2
extracellular 1

Gene Ontology (GO) - Cellular Components for KRTAP5-1 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0045095 keratin filament IEA --
genes like me logo Genes that share ontologies with KRTAP5-1: view

No data available for Subcellular locations from UniProtKB/Swiss-Prot for KRTAP5-1 Gene

Pathways & Interactions for KRTAP5-1 Gene

SuperPathways for KRTAP5-1 Gene

No Data Available

Interacting Proteins for KRTAP5-1 Gene

STRING Interaction Network Preview (showing 1 interactants - click image to see details)
Selected Interacting proteins: ENSP00000371606 for KRTAP5-1 Gene via STRING

Symbol External ID(s) Details

Gene Ontology (GO) - Biological Process for KRTAP5-1 Gene


No data available for Pathways by source and SIGNOR curated interactions for KRTAP5-1 Gene

Drugs & Compounds for KRTAP5-1 Gene

No Compound Related Data Available

Transcripts for KRTAP5-1 Gene

mRNA/cDNA for KRTAP5-1 Gene

(1) REFSEQ mRNAs :
(1) Additional mRNA sequences :
(1) Ensembl transcripts including schematic representations, and UCSC links where relevant :

Unigene Clusters for KRTAP5-1 Gene

Keratin associated protein 5-1:
Representative Sequences:

CRISPR Products

Clone Products

Flow Cytometry Products

Alternative Splicing Database (ASD) splice patterns (SP) for KRTAP5-1 Gene

No ASD Table

Relevant External Links for KRTAP5-1 Gene

GeneLoc Exon Structure for
ECgene alternative splicing isoforms for

Expression for KRTAP5-1 Gene

mRNA expression in normal human tissues for KRTAP5-1 Gene

mRNA differential expression in normal tissues according to GTEx for KRTAP5-1 Gene

This gene is overexpressed in Skin - Not Sun Exposed (Suprapubic) (x10.3), Brain - Cerebellar Hemisphere (x5.8), and Brain - Cerebellum (x5.7).

Protein differential expression in normal tissues from HIPED for KRTAP5-1 Gene

This gene is overexpressed in Brain (69.0).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB and MOPED for KRTAP5-1 Gene

Protein tissue co-expression partners for KRTAP5-1 Gene

- Elite partner

SOURCE GeneReport for Unigene cluster for KRTAP5-1 Gene:


mRNA Expression by UniProt/SwissProt for KRTAP5-1 Gene:

Tissue specificity: Expressed in hair root but not in skin. Expressed also in lung, pancreas, ovary, testis.
genes like me logo Genes that share expression patterns with KRTAP5-1: view

No data available for mRNA expression in embryonic tissues and stem cells from LifeMap Discovery for KRTAP5-1 Gene

Orthologs for KRTAP5-1 Gene

Evolution for KRTAP5-1 Gene

Gene Tree for KRTAP5-1 (if available)
Gene Tree for KRTAP5-1 (if available)

No data available for Orthologs for KRTAP5-1 Gene

Paralogs for KRTAP5-1 Gene

No data available for Paralogs for KRTAP5-1 Gene

Variants for KRTAP5-1 Gene

Sequence variations from dbSNP and Humsavar for KRTAP5-1 Gene

SNP ID Clin Chr 11 pos Sequence Context AA Info Type
rs767063388 -- 1,585,152(+) AGCCA(-/GAGCCACAGCCCCCACAGCCG)GAGCC cds-indel

Structural Variations from Database of Genomic Variants (DGV) for KRTAP5-1 Gene

Variant ID Type Subtype PubMed ID
esv2761643 CNV gain 21179565
nsv1051627 CNV gain 25217958

Variation tolerance for KRTAP5-1 Gene

Residual Variation Intolerance Score: 79% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 1.74; 32.97% of all genes are more intolerant (likely to be disease-causing)

Relevant External Links for KRTAP5-1 Gene

SNPedia medical, phenotypic, and genealogical associations of SNPs for

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for KRTAP5-1 Gene

Disorders for KRTAP5-1 Gene

Relevant External Links for KRTAP5-1

Atlas of Genetics and Cytogenetics in Oncology and Haematology:

No disorders were found for KRTAP5-1 Gene.

No data available for MalaCards , UniProtKB/Swiss-Prot and Genatlas for KRTAP5-1 Gene

Publications for KRTAP5-1 Gene

  1. Identification of two novel clusters of ultrahigh-sulfur keratin- associated protein genes on human chromosome 11. (PMID: 15144888) Yahagi S. … Shimizu N. (Biochem. Biophys. Res. Commun. 2004) 2 3 4 65
  2. Runx1 transcription factor is involved in the regulation of KAP5 gene expression in human hair follicles. (PMID: 16442267) Soma T. … Kishimoto J. (J. Dermatol. Sci. 2006) 3 65
  3. Keratin 1 and keratin 10 mutations causing epidermolytic hyperkeratosis in Chinese patients. (PMID: 12234709) Sun X.K. … Zhu X.J. (J. Dermatol. Sci. 2002) 3 65

Products for KRTAP5-1 Gene

Sources for KRTAP5-1 Gene

Loading form....