Free for academic non-profit institutions. Other users need a Commercial license

Aliases for KRTAP4-8 Gene

Aliases for KRTAP4-8 Gene

  • Keratin Associated Protein 4-8 2 3 5
  • Ultrahigh Sulfur Keratin-Associated Protein 4.8 3 4
  • Keratin-Associated Protein 4.8 3 4
  • KRTAP4.8 3 4
  • KAP4.8 3 4
  • Keratin Associated Protein 4.8 3

External Ids for KRTAP4-8 Gene

Previous GeneCards Identifiers for KRTAP4-8 Gene

  • GC17U990249
  • GC17M039626
  • GC17M036527
  • GC17P036494
  • GC17M036507
  • GC17M039253

Summaries for KRTAP4-8 Gene

GeneCards Summary for KRTAP4-8 Gene

KRTAP4-8 (Keratin Associated Protein 4-8) is a Protein Coding gene. An important paralog of this gene is KRTAP4-9.

UniProtKB/Swiss-Prot for KRTAP4-8 Gene

  • In the hair cortex, hair keratin intermediate filaments are embedded in an interfilamentous matrix, consisting of hair keratin-associated proteins (KRTAP), which are essential for the formation of a rigid and resistant hair shaft through their extensive disulfide bond cross-linking with abundant cysteine residues of hair keratins. The matrix proteins include the high-sulfur and high-glycine-tyrosine keratins.

No data available for Entrez Gene Summary , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for KRTAP4-8 Gene

Genomics for KRTAP4-8 Gene

Regulatory Elements for KRTAP4-8 Gene

Enhancers for KRTAP4-8 Gene
GeneHancer Identifier Score Enhancer Sources TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor Binding Sites within enhancer Other Gene Targets for Enhancer

Enhancers around KRTAP4-8 on UCSC Golden Path with GeneCards custom track

Genomic Location for KRTAP4-8 Gene

41,096,981 bp from pter
41,098,141 bp from pter
1,161 bases
Minus strand

Genomic View for KRTAP4-8 Gene

Genes around KRTAP4-8 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
KRTAP4-8 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for KRTAP4-8 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for KRTAP4-8 Gene

Proteins for KRTAP4-8 Gene

  • Protein details for KRTAP4-8 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Recommended name:
    Keratin-associated protein 4-8
    Protein Accession:
    Secondary Accessions:
    • A8MSH3

    Protein attributes for KRTAP4-8 Gene

    185 amino acids
    Molecular mass:
    19627 Da
    Quaternary structure:
    • Interacts with hair keratins.

neXtProt entry for KRTAP4-8 Gene

Proteomics data for KRTAP4-8 Gene at MOPED

Post-translational modifications for KRTAP4-8 Gene

No Post-translational modifications

Other Protein References for KRTAP4-8 Gene

ENSEMBL proteins:
REFSEQ proteins:

No data available for DME Specific Peptides for KRTAP4-8 Gene

Domains & Families for KRTAP4-8 Gene

Gene Families for KRTAP4-8 Gene

Protein Domains for KRTAP4-8 Gene


Suggested Antigen Peptide Sequences for KRTAP4-8 Gene

GenScript: Design optimal peptide antigens:

Graphical View of Domain Structure for InterPro Entry



  • Belongs to the KRTAP type 4 family.
  • Belongs to the KRTAP type 4 family.
genes like me logo Genes that share domains with KRTAP4-8: view

Function for KRTAP4-8 Gene

Molecular function for KRTAP4-8 Gene

UniProtKB/Swiss-Prot Function:
In the hair cortex, hair keratin intermediate filaments are embedded in an interfilamentous matrix, consisting of hair keratin-associated proteins (KRTAP), which are essential for the formation of a rigid and resistant hair shaft through their extensive disulfide bond cross-linking with abundant cysteine residues of hair keratins. The matrix proteins include the high-sulfur and high-glycine-tyrosine keratins.

Animal Model Products

CRISPR Products

No data available for Enzyme Numbers (IUBMB) , Gene Ontology (GO) - Molecular Function , Phenotypes , Human Phenotype Ontology , Animal Models , miRNA , Transcription Factor Targets and HOMER Transcription for KRTAP4-8 Gene

Localization for KRTAP4-8 Gene

Subcellular locations from

Jensen Localization Image for KRTAP4-8 Gene COMPARTMENTS Subcellular localization image for KRTAP4-8 gene
Compartment Confidence
cytoskeleton 2
cytosol 2
extracellular 2
nucleus 1

No data available for Subcellular locations from UniProtKB/Swiss-Prot and Gene Ontology (GO) - Cellular Components for KRTAP4-8 Gene

Pathways & Interactions for KRTAP4-8 Gene

SuperPathways for KRTAP4-8 Gene

No Data Available

Interacting Proteins for KRTAP4-8 Gene

Gene Ontology (GO) - Biological Process for KRTAP4-8 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0042633 hair cycle IDA 21916889
genes like me logo Genes that share ontologies with KRTAP4-8: view

No data available for Pathways by source and SIGNOR curated interactions for KRTAP4-8 Gene

Drugs & Compounds for KRTAP4-8 Gene

No Compound Related Data Available

Transcripts for KRTAP4-8 Gene

mRNA/cDNA for KRTAP4-8 Gene

(2) REFSEQ mRNAs :
(2) Ensembl transcripts including schematic representations, and UCSC links where relevant :

Alternative Splicing Database (ASD) splice patterns (SP) for KRTAP4-8 Gene

No ASD Table

Relevant External Links for KRTAP4-8 Gene

GeneLoc Exon Structure for
ECgene alternative splicing isoforms for

Expression for KRTAP4-8 Gene

mRNA expression in normal human tissues for KRTAP4-8 Gene

mRNA differential expression in normal tissues according to GTEx for KRTAP4-8 Gene

This gene is overexpressed in Skin - Not Sun Exposed (Suprapubic) (x48.2) and Skin - Sun Exposed (Lower leg) (x4.6).

SOURCE GeneReport for Unigene cluster for KRTAP4-8 Gene Hs.307019

mRNA Expression by UniProt/SwissProt for KRTAP4-8 Gene

Tissue specificity: Expressed in the hair follicles.
genes like me logo Genes that share expression patterns with KRTAP4-8: view

No data available for mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , Protein differential expression in normal tissues , Protein expression and Protein tissue co-expression partners for KRTAP4-8 Gene

Orthologs for KRTAP4-8 Gene

This gene was present in the common ancestor of mammals.

Orthologs for KRTAP4-8 Gene

Organism Taxonomy Gene Similarity Type Details
(Mus musculus)
Mammalia Gm11563 35
  • 83.12 (n)
  • 81.01 (a)
Gm11563 16
Gm11555 36
  • 73 (a)
Gm11563 36
  • 79 (a)
Krtap4-1 36
  • 73 (a)
Krtap4-2 36
  • 73 (a)
Krtap4-7 36
  • 70 (a)
(Pan troglodytes)
Mammalia KRTAP4-9 35
  • 98.02 (n)
  • 96.76 (a)
KRTAP4-8 36
  • 87 (a)
(Rattus norvegicus)
Mammalia LOC100361969 35
  • 79.75 (n)
  • 77.22 (a)
(Bos Taurus)
Mammalia -- 36
  • 66 (a)
-- 36
  • 67 (a)
-- 36
  • 67 (a)
-- 36
  • 67 (a)
-- 36
  • 68 (a)
KRTAP4-7 36
  • 67 (a)
Species with no ortholog for KRTAP4-8:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • chicken (Gallus gallus)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • dog (Canis familiaris)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • fruit fly (Drosophila melanogaster)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • lizard (Anolis carolinensis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • oppossum (Monodelphis domestica)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • platypus (Ornithorhynchus anatinus)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea squirt (Ciona intestinalis)
  • sea squirt (Ciona savignyi)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • tropical clawed frog (Silurana tropicalis)
  • wheat (Triticum aestivum)
  • worm (Caenorhabditis elegans)
  • zebrafish (Danio rerio)

Evolution for KRTAP4-8 Gene

Gene Tree for KRTAP4-8 (if available)
Gene Tree for KRTAP4-8 (if available)

Paralogs for KRTAP4-8 Gene

(11) SIMAP similar genes for KRTAP4-8 Gene using alignment to 1 proteins:

genes like me logo Genes that share paralogs with KRTAP4-8: view

Variants for KRTAP4-8 Gene

Polymorphic Variants from UniProtKB/Swiss-Prot for KRTAP4-8 Gene

Numerous size polymorphism are present in KRTAP4 gene family, which are mainly due to variations in the sequence encoding cysteine-rich repeat segments (PubMed:15955084). The sequence shown corresponds to allele KAP4.8-v1 (PubMed:15955084).

Sequence variations from dbSNP and Humsavar for KRTAP4-8 Gene

SNP ID Clin Chr 17 pos Sequence Context AA Info Type
rs201764113 -- 41,098,083(+) GACCA(-/T)TGGTG reference, frameshift-variant
rs200846549 -- 41,098,814(+) TTATC(C/T)TTTTT upstream-variant-2KB
rs368262777 -- 41,098,814(+) TTATC(-/TT)TTTTT upstream-variant-2KB
rs761473739 -- 41,097,890(+) GGCGA(-/CAGCAGCTGGAGATGCAGCATCTGGGGCGG)CAGCA cds-indel
rs769410394 -- 41,098,815(+) TATCT(-/TT)TTTTT upstream-variant-2KB

Structural Variations from Database of Genomic Variants (DGV) for KRTAP4-8 Gene

Variant ID Type Subtype PubMed ID
nsv9550 CNV Loss 18304495
dgv3167n71 CNV Loss 21882294
nsv908232 CNV Loss 21882294
nsv833446 CNV Gain 17160897
esv2715915 CNV Deletion 23290073
dgv552e199 CNV Deletion 23128226
esv1007843 CNV Deletion 20482838
dgv452e201 CNV Deletion 23290073
esv26633 CNV Loss 19812545

Variation tolerance for KRTAP4-8 Gene

Residual Variation Intolerance Score: 87.9% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 17.09; 98.05% of all genes are more intolerant (likely to be disease-causing)

Relevant External Links for KRTAP4-8 Gene

Human Gene Mutation Database (HGMD)

Disorders for KRTAP4-8 Gene

Relevant External Links for KRTAP4-8

Atlas of Genetics and Cytogenetics in Oncology and Haematology:

No disorders were found for KRTAP4-8 Gene.

No data available for MalaCards , UniProtKB/Swiss-Prot and Genatlas for KRTAP4-8 Gene

Publications for KRTAP4-8 Gene

  1. Characterization of a cluster of human high/ultrahigh sulfur keratin- associated protein genes embedded in the type I keratin gene domain on chromosome 17q12-21. (PMID: 11279113) Rogers M.A. … Schweizer J. (J. Biol. Chem. 2001) 2 3 4 67
  2. Hair greying is associated with active hair growth. (PMID: 21916889) Choi H.I. … Lee Y.H. (Br. J. Dermatol. 2011) 3
  3. DNA sequence of human chromosome 17 and analysis of rearrangement in the human lineage. (PMID: 16625196) Zody M.C. … Nusbaum C. (Nature 2006) 3
  4. The sequence of the human genome. (PMID: 11181995) Venter J.C. … Zhu X. (Science 2001) 3

Products for KRTAP4-8 Gene

Sources for KRTAP4-8 Gene
