Free for academic non-profit institutions. Other users need a Commercial license

Aliases for KRTAP4-7 Gene

Aliases for KRTAP4-7 Gene

  • Keratin Associated Protein 4-7 2 3 5
  • Ultrahigh Sulfur Keratin-Associated Protein 4.7 3 4
  • KRTAP4.7 3 4
  • KAP4.7 3 4
  • Putative Keratin-Associated Protein 4-X 3
  • Keratin-Associated Protein 4.7 4

External Ids for KRTAP4-7 Gene

Previous GeneCards Identifiers for KRTAP4-7 Gene

  • GC17P038740
  • GC00M9J0113
  • GC17P039149
  • GC17P039614
  • GC17P039602
  • GC17M036536
  • GC17M9W0044
  • GC17M8H0043
  • GC17P036496
  • GC17P039240
  • GC17P035035

Summaries for KRTAP4-7 Gene

Entrez Gene Summary for KRTAP4-7 Gene

  • This protein is a member of the keratin-associated protein (KAP) family. The KAP proteins form a matrix of keratin intermediate filaments which contribute to the structure of hair fibers. KAP family members appear to have unique, family-specific amino- and carboxyl-terminal regions and are subdivided into three multi-gene families according to amino acid composition: the high sulfur, the ultrahigh sulfur, and the high tyrosine/glycine KAPs. This protein is a member of the ultrahigh sulfur KAP family and the gene is localized to a cluster of KAPs at 17q12-q21. [provided by RefSeq, Mar 2009]

GeneCards Summary for KRTAP4-7 Gene

KRTAP4-7 (Keratin Associated Protein 4-7) is a Protein Coding gene. Among its related pathways are Keratinization and Developmental Biology. An important paralog of this gene is KRTAP4-9.

UniProtKB/Swiss-Prot for KRTAP4-7 Gene

  • In the hair cortex, hair keratin intermediate filaments are embedded in an interfilamentous matrix, consisting of hair keratin-associated proteins (KRTAP), which are essential for the formation of a rigid and resistant hair shaft through their extensive disulfide bond cross-linking with abundant cysteine residues of hair keratins. The matrix proteins include the high-sulfur and high-glycine-tyrosine keratins.

Additional gene information for KRTAP4-7 Gene

No data available for CIViC summary , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for KRTAP4-7 Gene

Genomics for KRTAP4-7 Gene

GeneHancer (GH) Regulatory Elements for KRTAP4-7 Gene

Promoters and enhancers for KRTAP4-7 Gene
GeneHancer (GH) Identifier GH Type GH
GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites
Gene Targets
GH17I041084 Promoter 0.7 EPDnew 550.8 0.0 -19 0.1 SCRT1 SCRT2 REST KRTAP4-7 KRTAP1-5 KRTAP1-1 KRTAP1-3 KRTAP1-4 KRTAP2-3 KRTAP4-4 KRTAP4-3 KRTAP4-5 KRT37
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data dump

GeneHancers around KRTAP4-7 on UCSC Golden Path with GeneCards custom track

Top Transcription factor binding sites by QIAGEN in the KRTAP4-7 gene promoter:

Genomic Locations for KRTAP4-7 Gene

Genomic Locations for KRTAP4-7 Gene
995 bases
Plus strand

Genomic View for KRTAP4-7 Gene

Genes around KRTAP4-7 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
KRTAP4-7 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for KRTAP4-7 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for KRTAP4-7 Gene

Proteins for KRTAP4-7 Gene

  • Protein details for KRTAP4-7 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Recommended name:
    Keratin-associated protein 4-7
    Protein Accession:
    Secondary Accessions:
    • A0AVM6
    • A8MQ08
    • A8MTL4

    Protein attributes for KRTAP4-7 Gene

    210 amino acids
    Molecular mass:
    22535 Da
    Quaternary structure:
    • Interacts with hair keratins.

neXtProt entry for KRTAP4-7 Gene

Post-translational modifications for KRTAP4-7 Gene

No Post-translational modifications

Other Protein References for KRTAP4-7 Gene

ENSEMBL proteins:
REFSEQ proteins:

No data available for DME Specific Peptides for KRTAP4-7 Gene

Domains & Families for KRTAP4-7 Gene

Gene Families for KRTAP4-7 Gene

Human Protein Atlas (HPA):
  • Predicted intracellular proteins

Protein Domains for KRTAP4-7 Gene


Suggested Antigen Peptide Sequences for KRTAP4-7 Gene

GenScript: Design optimal peptide antigens:

Graphical View of Domain Structure for InterPro Entry



  • Belongs to the KRTAP type 4 family.
  • Belongs to the KRTAP type 4 family.
genes like me logo Genes that share domains with KRTAP4-7: view

Function for KRTAP4-7 Gene

Molecular function for KRTAP4-7 Gene

UniProtKB/Swiss-Prot Function:
In the hair cortex, hair keratin intermediate filaments are embedded in an interfilamentous matrix, consisting of hair keratin-associated proteins (KRTAP), which are essential for the formation of a rigid and resistant hair shaft through their extensive disulfide bond cross-linking with abundant cysteine residues of hair keratins. The matrix proteins include the high-sulfur and high-glycine-tyrosine keratins.

Phenotypes From GWAS Catalog for KRTAP4-7 Gene

Phenotypes for KRTAP4-7 Gene

genes like me logo Genes that share phenotypes with KRTAP4-7: view

miRNA for KRTAP4-7 Gene

miRTarBase miRNAs that target KRTAP4-7

No data available for Enzyme Numbers (IUBMB) , Gene Ontology (GO) - Molecular Function , Human Phenotype Ontology , Animal Models , Transcription Factor Targets and HOMER Transcription for KRTAP4-7 Gene

Localization for KRTAP4-7 Gene

Subcellular locations from

Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for KRTAP4-7 gene
Compartment Confidence
cytosol 4
cytoskeleton 2

Gene Ontology (GO) - Cellular Components for KRTAP4-7 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005829 cytosol TAS --
GO:0005882 intermediate filament IEA --
GO:0045095 keratin filament IEA --
genes like me logo Genes that share ontologies with KRTAP4-7: view

No data available for Subcellular locations from UniProtKB/Swiss-Prot and Subcellular locations from the Human Protein Atlas (HPA) for KRTAP4-7 Gene

Pathways & Interactions for KRTAP4-7 Gene

SuperPathways for KRTAP4-7 Gene

SuperPathway Contained pathways
1 Developmental Biology
2 Keratinization
genes like me logo Genes that share pathways with KRTAP4-7: view

Pathways by source for KRTAP4-7 Gene

2 Reactome pathways for KRTAP4-7 Gene

Gene Ontology (GO) - Biological Process for KRTAP4-7 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0007568 aging IDA --
GO:0031424 keratinization TAS --
GO:0042633 hair cycle IDA --
genes like me logo Genes that share ontologies with KRTAP4-7: view

No data available for SIGNOR curated interactions for KRTAP4-7 Gene

Drugs & Compounds for KRTAP4-7 Gene

No Compound Related Data Available

Transcripts for KRTAP4-7 Gene

mRNA/cDNA for KRTAP4-7 Gene

(1) REFSEQ mRNAs :
(3) Additional mRNA sequences :
(2) Ensembl transcripts including schematic representations, and UCSC links where relevant :

Unigene Clusters for KRTAP4-7 Gene

Keratin associated protein 4-7:
Representative Sequences:

CRISPR Products

Alternative Splicing Database (ASD) splice patterns (SP) for KRTAP4-7 Gene

No ASD Table

Relevant External Links for KRTAP4-7 Gene

GeneLoc Exon Structure for
ECgene alternative splicing isoforms for

Expression for KRTAP4-7 Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for KRTAP4-7 Gene

mRNA differential expression in normal tissues according to GTEx for KRTAP4-7 Gene

This gene is overexpressed in Skin - Not Sun Exposed (Suprapubic) (x48.9) and Skin - Sun Exposed (Lower leg) (x4.0).

SOURCE GeneReport for Unigene cluster for KRTAP4-7 Gene:


mRNA Expression by UniProt/SwissProt for KRTAP4-7 Gene:

Tissue specificity: Expressed in the hair follicles.

Evidence on tissue expression from TISSUES for KRTAP4-7 Gene

  • Skin(4)
genes like me logo Genes that share expression patterns with KRTAP4-7: view

No data available for mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , Protein differential expression in normal tissues , Protein expression , Protein tissue co-expression partners and Phenotype-based relationships between genes and organs from Gene ORGANizer for KRTAP4-7 Gene

Orthologs for KRTAP4-7 Gene

This gene was present in the common ancestor of mammals.

Orthologs for KRTAP4-7 Gene

Organism Taxonomy Gene Similarity Type Details
(Pan troglodytes)
Mammalia -- 34
  • 82 (a)
(Mus musculus)
Mammalia Gm11563 34
  • 66 (a)
Krtap4-2 34
  • 64 (a)
Krtap4-7 34
  • 64 (a)
Krtap4-1 34
  • 63 (a)
Gm11555 34
  • 58 (a)
(Bos Taurus)
Mammalia -- 34
  • 59 (a)
-- 34
  • 58 (a)
-- 34
  • 58 (a)
-- 34
  • 58 (a)
KRTAP4-7 34
  • 58 (a)
-- 34
  • 57 (a)
Species where no ortholog for KRTAP4-7 was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • chicken (Gallus gallus)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • dog (Canis familiaris)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • fruit fly (Drosophila melanogaster)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • lizard (Anolis carolinensis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • oppossum (Monodelphis domestica)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • platypus (Ornithorhynchus anatinus)
  • rainbow trout (Oncorhynchus mykiss)
  • rat (Rattus norvegicus)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea squirt (Ciona intestinalis)
  • sea squirt (Ciona savignyi)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • tropical clawed frog (Silurana tropicalis)
  • wheat (Triticum aestivum)
  • worm (Caenorhabditis elegans)
  • zebrafish (Danio rerio)

Evolution for KRTAP4-7 Gene

Gene Tree for KRTAP4-7 (if available)
Gene Tree for KRTAP4-7 (if available)

Paralogs for KRTAP4-7 Gene

(10) SIMAP similar genes for KRTAP4-7 Gene using alignment to 1 proteins:

genes like me logo Genes that share paralogs with KRTAP4-7: view

Variants for KRTAP4-7 Gene

Polymorphic Variants from UniProtKB/Swiss-Prot for KRTAP4-7 Gene

Numerous size polymorphism are present in KRTAP4 gene family, which are mainly due to variations in the sequence encoding cysteine-rich repeat segments (PubMed:15955084).

Sequence variations from dbSNP and Humsavar for KRTAP4-7 Gene

SNP ID Clin Chr 17 pos Variation AA Info Type
rs1001642836 -- 41,082,422(+) C/T upstream_transcript_variant
rs1003678505 -- 41,084,760(+) G/A 3_prime_UTR_variant
rs1004061086 -- 41,082,839(+) G/T upstream_transcript_variant
rs1005768202 -- 41,084,610(+) A/G coding_sequence_variant, missense_variant
rs1007222440 -- 41,084,451(+) CCAGCTGCTGCCGCCCCAGCTGCTG/CCAGCTGCTG coding_sequence_variant, inframe_deletion

Structural Variations from Database of Genomic Variants (DGV) for KRTAP4-7 Gene

Variant ID Type Subtype PubMed ID
dgv552e199 CNV deletion 23128226
dgv574e214 CNV loss 21293372
esv1007843 CNV deletion 20482838
esv2715915 CNV deletion 23290073
esv3640559 CNV gain 21293372
nsv112586 CNV insertion 16902084
nsv1129330 OTHER inversion 24896259
nsv1146669 OTHER inversion 26484159
nsv833446 CNV gain 17160897
nsv9550 CNV loss 18304495
nsv960485 CNV duplication 23825009

Variation tolerance for KRTAP4-7 Gene

Residual Variation Intolerance Score: 93.8% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 10.57; 91.24% of all genes are more intolerant (likely to be disease-causing)

Additional Variant Information for KRTAP4-7 Gene

SNPedia medical, phenotypic, and genealogical associations of SNPs for

Disorders for KRTAP4-7 Gene

Additional Disease Information for KRTAP4-7

No disorders were found for KRTAP4-7 Gene.

No data available for MalaCards , UniProtKB/Swiss-Prot and Genatlas for KRTAP4-7 Gene

Publications for KRTAP4-7 Gene

  1. Characterization of a cluster of human high/ultrahigh sulfur keratin-associated protein genes embedded in the type I keratin gene domain on chromosome 17q12-21. (PMID: 11279113) Rogers MA … Schweizer J (The Journal of biological chemistry 2001) 2 3 4 58
  2. DNA sequence of human chromosome 17 and analysis of rearrangement in the human lineage. (PMID: 16625196) Zody MC … Nusbaum C (Nature 2006) 3 4 58
  3. Size polymorphisms in the human ultrahigh sulfur hair keratin-associated protein 4, KAP4, gene family. (PMID: 15955084) Kariya N … Ito M (The Journal of investigative dermatology 2005) 3 4 58
  4. The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). (PMID: 15489334) Gerhard DS … MGC Project Team (Genome research 2004) 3 4 58
  5. A proteome-scale map of the human interactome network. (PMID: 25416956) Rolland T … Vidal M (Cell 2014) 3 58

Products for KRTAP4-7 Gene

Sources for KRTAP4-7 Gene

Loading form....