Free for academic non-profit institutions. Other users need a Commercial license

Aliases for KRTAP19-7 Gene

Aliases for KRTAP19-7 Gene

  • Keratin Associated Protein 19-7 2 3 5
  • KAP19.7 3 4

External Ids for KRTAP19-7 Gene

Previous GeneCards Identifiers for KRTAP19-7 Gene

  • GC21U900024
  • GC21M030853
  • GC21M030855
  • GC21M031933
  • GC21M017342

Summaries for KRTAP19-7 Gene

GeneCards Summary for KRTAP19-7 Gene

KRTAP19-7 (Keratin Associated Protein 19-7) is a Protein Coding gene.

UniProtKB/Swiss-Prot for KRTAP19-7 Gene

  • In the hair cortex, hair keratin intermediate filaments are embedded in an interfilamentous matrix, consisting of hair keratin-associated proteins (KRTAP), which are essential for the formation of a rigid and resistant hair shaft through their extensive disulfide bond cross-linking with abundant cysteine residues of hair keratins. The matrix proteins include the high-sulfur and high-glycine-tyrosine keratins.

No data available for Entrez Gene Summary , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for KRTAP19-7 Gene

Genomics for KRTAP19-7 Gene

Regulatory Elements for KRTAP19-7 Gene

Genomic Location for KRTAP19-7 Gene

Chromosome:
21
Start:
30,541,660 bp from pter
End:
30,561,314 bp from pter
Size:
19,655 bases
Orientation:
Minus strand

Genomic View for KRTAP19-7 Gene

Genes around KRTAP19-7 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
KRTAP19-7 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for KRTAP19-7 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for KRTAP19-7 Gene

Proteins for KRTAP19-7 Gene

  • Protein details for KRTAP19-7 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Q3SYF9-KR197_HUMAN
    Recommended name:
    Keratin-associated protein 19-7
    Protein Accession:
    Q3SYF9
    Secondary Accessions:
    • Q08EP7

    Protein attributes for KRTAP19-7 Gene

    Size:
    63 amino acids
    Molecular mass:
    6644 Da
    Quaternary structure:
    • Interacts with hair keratins.

neXtProt entry for KRTAP19-7 Gene

Proteomics data for KRTAP19-7 Gene at MOPED

Post-translational modifications for KRTAP19-7 Gene

  • Modification sites at PhosphoSitePlus
  • Modification sites at neXtProt

Other Protein References for KRTAP19-7 Gene

ENSEMBL proteins:
REFSEQ proteins:

No data available for DME Specific Peptides for KRTAP19-7 Gene

Domains & Families for KRTAP19-7 Gene

Gene Families for KRTAP19-7 Gene

Protein Domains for KRTAP19-7 Gene

InterPro:
ProtoNet:

Suggested Antigen Peptide Sequences for KRTAP19-7 Gene

GenScript: Design optimal peptide antigens:

Graphical View of Domain Structure for InterPro Entry

Q3SYF9

UniProtKB/Swiss-Prot:

KR197_HUMAN :
  • Belongs to the KRTAP type 19 family.
Family:
  • Belongs to the KRTAP type 19 family.
genes like me logo Genes that share domains with KRTAP19-7: view

Function for KRTAP19-7 Gene

Molecular function for KRTAP19-7 Gene

UniProtKB/Swiss-Prot Function:
In the hair cortex, hair keratin intermediate filaments are embedded in an interfilamentous matrix, consisting of hair keratin-associated proteins (KRTAP), which are essential for the formation of a rigid and resistant hair shaft through their extensive disulfide bond cross-linking with abundant cysteine residues of hair keratins. The matrix proteins include the high-sulfur and high-glycine-tyrosine keratins.

Phenotypes for KRTAP19-7 Gene

genes like me logo Genes that share phenotypes with KRTAP19-7: view

Animal Model Products

CRISPR Products

No data available for Enzyme Numbers (IUBMB) , Gene Ontology (GO) - Molecular Function , Human Phenotype Ontology , Animal Models , miRNA , Transcription Factor Targets and HOMER Transcription for KRTAP19-7 Gene

Localization for KRTAP19-7 Gene

Subcellular locations from

COMPARTMENTS
Jensen Localization Image for KRTAP19-7 Gene COMPARTMENTS Subcellular localization image for KRTAP19-7 gene
Compartment Confidence
cytoskeleton 3
extracellular 3
cytosol 1
nucleus 1

No data available for Subcellular locations from UniProtKB/Swiss-Prot and Gene Ontology (GO) - Cellular Components for KRTAP19-7 Gene

Pathways & Interactions for KRTAP19-7 Gene

SuperPathways for KRTAP19-7 Gene

No Data Available

Gene Ontology (GO) - Biological Process for KRTAP19-7 Gene

None

No data available for Pathways by source and SIGNOR curated interactions for KRTAP19-7 Gene

Drugs & Compounds for KRTAP19-7 Gene

No Compound Related Data Available

Transcripts for KRTAP19-7 Gene

mRNA/cDNA for KRTAP19-7 Gene

(1) REFSEQ mRNAs :
(1) Selected AceView cDNA sequences:
(2) Ensembl transcripts including schematic representations, and UCSC links where relevant :

Alternative Splicing Database (ASD) splice patterns (SP) for KRTAP19-7 Gene

No ASD Table

Relevant External Links for KRTAP19-7 Gene

GeneLoc Exon Structure for
KRTAP19-7
ECgene alternative splicing isoforms for
KRTAP19-7

Expression for KRTAP19-7 Gene

mRNA expression in normal human tissues for KRTAP19-7 Gene

mRNA differential expression in normal tissues according to GTEx for KRTAP19-7 Gene

This gene is overexpressed in Skin - Not Sun Exposed (Suprapubic) (x47.6) and Skin - Sun Exposed (Lower leg) (x4.3).

SOURCE GeneReport for Unigene cluster for KRTAP19-7 Gene Hs.553696

genes like me logo Genes that share expression patterns with KRTAP19-7: view

In Situ Assay Products

No data available for mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , Protein differential expression in normal tissues , Protein expression , mRNA Expression by UniProt/SwissProt and Protein tissue co-expression partners for KRTAP19-7 Gene

Orthologs for KRTAP19-7 Gene

Evolution for KRTAP19-7 Gene

ENSEMBL:
Gene Tree for KRTAP19-7 (if available)
TreeFam:
Gene Tree for KRTAP19-7 (if available)

No data available for Orthologs for KRTAP19-7 Gene

Paralogs for KRTAP19-7 Gene

No data available for Paralogs for KRTAP19-7 Gene

Variants for KRTAP19-7 Gene

Sequence variations from dbSNP and Humsavar for KRTAP19-7 Gene

SNP ID Clin Chr 21 pos Sequence Context AA Info Type
rs5843454 -- 30,562,701(+) GGTGG(-/T)TTCCA upstream-variant-2KB
rs2849987 -- 30,562,549(+) ATGCT(A/G)TCCCT upstream-variant-2KB
rs72219655 -- 30,562,380(+) ATATA(-/TATATATATATGTATATATATATATATACATG)TATGT upstream-variant-2KB
rs112849533 -- 30,561,843(+) TCAGC(C/T)GGGAA upstream-variant-2KB
rs77008862 -- 30,562,392(+) ATATG(C/T)ATATA upstream-variant-2KB

Structural Variations from Database of Genomic Variants (DGV) for KRTAP19-7 Gene

Variant ID Type Subtype PubMed ID
nsv913677 CNV Loss 21882294

Variation tolerance for KRTAP19-7 Gene

Residual Variation Intolerance Score: 84.3% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 0.60; 12.94% of all genes are more intolerant (likely to be disease-causing)

Relevant External Links for KRTAP19-7 Gene

HapMap Linkage Disequilibrium report
KRTAP19-7

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for KRTAP19-7 Gene

Disorders for KRTAP19-7 Gene

Relevant External Links for KRTAP19-7

Atlas of Genetics and Cytogenetics in Oncology and Haematology:
KRTAP19-7

No disorders were found for KRTAP19-7 Gene.

No data available for MalaCards , UniProtKB/Swiss-Prot and Genatlas for KRTAP19-7 Gene

Publications for KRTAP19-7 Gene

  1. The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). (PMID: 15489334) Gerhard D.S. … Malek J. (Genome Res. 2004) 3 4 67
  2. Characterization of a first domain of human high glycine-tyrosine and high sulfur keratin-associated protein (KAP) genes on chromosome 21q22.1. (PMID: 12359730) Rogers M.A. … Schweizer J. (J. Biol. Chem. 2002) 2 3
  3. A proteome-scale map of the human interactome network. (PMID: 25416956) Rolland T. … Vidal M. (Cell 2014) 3
  4. Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences. (PMID: 12477932) Strausberg R.L. … Marra M.A. (Proc. Natl. Acad. Sci. U.S.A. 2002) 3

Products for KRTAP19-7 Gene

Sources for KRTAP19-7 Gene

Back to Top

Content