Free for academic non-profit institutions. Other users need a Commercial license

Aliases for KRT19 Gene

Aliases for KRT19 Gene

  • Keratin 19 2 3
  • Keratin 19, Type I 2 3 5
  • 40-KDa Keratin Intermediate Filament 2 3
  • Cytokeratin 19 2 3
  • Cytokeratin-19 3 4
  • Keratin-19 3 4
  • CK-19 3 4
  • K19 3 4
  • Type I Cytoskeletal 19 2
  • Keratin, Type I, 40-Kd 3
  • Keratin 2
  • Type I 2
  • 40-Kd 2
  • CK19 3
  • K1CS 3

External Ids for KRT19 Gene

Previous GeneCards Identifiers for KRT19 Gene

  • GC17M039264
  • GC17P041708
  • GC17M039588
  • GC17M040053
  • GC17M036933
  • GC17M039679
  • GC17M035443

Summaries for KRT19 Gene

Entrez Gene Summary for KRT19 Gene

  • The protein encoded by this gene is a member of the keratin family. The keratins are intermediate filament proteins responsible for the structural integrity of epithelial cells and are subdivided into cytokeratins and hair keratins. The type I cytokeratins consist of acidic proteins which are arranged in pairs of heterotypic keratin chains. Unlike its related family members, this smallest known acidic cytokeratin is not paired with a basic cytokeratin in epithelial cells. It is specifically expressed in the periderm, the transiently superficial layer that envelopes the developing epidermis. The type I cytokeratins are clustered in a region of chromosome 17q12-q21. [provided by RefSeq, Jul 2008]

GeneCards Summary for KRT19 Gene

KRT19 (Keratin 19) is a Protein Coding gene. Diseases associated with KRT19 include lung cancer and hepatocellular carcinoma. Among its related pathways are Cytoskeleton remodeling Neurofilaments and Embryonic and Induced Pluripotent Stem Cell Differentiation Pathways and Lineage-specific Markers. GO annotations related to this gene include structural molecule activity and structural constituent of cytoskeleton. An important paralog of this gene is KRT12.

UniProtKB/Swiss-Prot for KRT19 Gene

  • Involved in the organization of myofibers. Together with KRT8, helps to link the contractile apparatus to dystrophin at the costameres of striated muscle.

Gene Wiki entry for KRT19 Gene

No data available for Tocris Summary , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for KRT19 Gene

Genomics for KRT19 Gene

Regulatory Elements for KRT19 Gene

Promoters for KRT19 Gene
Ensembl Regulatory Elements (ENSRs) TSS Distance (bp) Size (bp) Binding Sites for Transcription Factors within promoters

ENSRs around KRT19 on UCSC Golden Path with GeneCards custom track

Genomic Location for KRT19 Gene

Chromosome:
17
Start:
41,523,617 bp from pter
End:
41,528,389 bp from pter
Size:
4,773 bases
Orientation:
Minus strand

Genomic View for KRT19 Gene

Genes around KRT19 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
KRT19 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for KRT19 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for KRT19 Gene

Proteins for KRT19 Gene

  • Protein details for KRT19 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    P08727-K1C19_HUMAN
    Recommended name:
    Keratin, type I cytoskeletal 19
    Protein Accession:
    P08727
    Secondary Accessions:
    • B2R874
    • Q5XG83
    • Q6NW33
    • Q7L5M9
    • Q96A53
    • Q96FV1
    • Q9BYF9
    • Q9P1Y4

    Protein attributes for KRT19 Gene

    Size:
    400 amino acids
    Molecular mass:
    44106 Da
    Quaternary structure:
    • Heterotetramer of two type I and two type II keratins. Interacts with PNN and the actin-binding domain of DMD. Interacts with HCV core protein.
    Miscellaneous:
    • There are two types of cytoskeletal and microfibrillar keratin: I (acidic; 40-55 kDa) and II (neutral to basic; 56-70 kDa).

neXtProt entry for KRT19 Gene

Proteomics data for KRT19 Gene at MOPED

Post-translational modifications for KRT19 Gene

  • Modification sites at PhosphoSitePlus
  • Modification sites at neXtProt

Other Protein References for KRT19 Gene

ENSEMBL proteins:
REFSEQ proteins:

No data available for DME Specific Peptides for KRT19 Gene

Domains & Families for KRT19 Gene

Gene Families for KRT19 Gene

Suggested Antigen Peptide Sequences for KRT19 Gene

GenScript: Design optimal peptide antigens:

Graphical View of Domain Structure for InterPro Entry

P08727

UniProtKB/Swiss-Prot:

K1C19_HUMAN :
  • This keratin differs from all other IF proteins in lacking the C-terminal tail domain.
  • Belongs to the intermediate filament family.
Domain:
  • This keratin differs from all other IF proteins in lacking the C-terminal tail domain.
Family:
  • Belongs to the intermediate filament family.
genes like me logo Genes that share domains with KRT19: view

Function for KRT19 Gene

Molecular function for KRT19 Gene

GENATLAS Biochemistry:
keratin 19,type I (maybe included in KRTI),simple epithelia,hair follicle,nail bed
UniProtKB/Swiss-Prot Function:
Involved in the organization of myofibers. Together with KRT8, helps to link the contractile apparatus to dystrophin at the costameres of striated muscle.
genes like me logo Genes that share phenotypes with KRT19: view

Animal Models for KRT19 Gene

MGI Knock Outs for KRT19:

Animal Model Products

miRNA for KRT19 Gene

miRTarBase miRNAs that target KRT19

Inhibitory RNA Products

In Situ Assay Products

Flow Cytometry Products

No data available for Enzyme Numbers (IUBMB) , Gene Ontology (GO) - Molecular Function , Human Phenotype Ontology , Transcription Factor Targets and HOMER Transcription for KRT19 Gene

Localization for KRT19 Gene

Subcellular locations from

COMPARTMENTS
Jensen Localization Image for KRT19 Gene COMPARTMENTS Subcellular localization image for KRT19 gene
Compartment Confidence
cytoskeleton 5
extracellular 5
plasma membrane 5
cytosol 3
mitochondrion 3
nucleus 2
endoplasmic reticulum 1
peroxisome 1
vacuole 1

Gene Ontology (GO) - Cellular Components for KRT19 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005882 intermediate filament IEA --
GO:0042383 sarcolemma IEA --
GO:0043034 costamere IDA 16000376
GO:0071944 cell periphery IDA 19185580
genes like me logo Genes that share ontologies with KRT19: view

No data available for Subcellular locations from UniProtKB/Swiss-Prot for KRT19 Gene

Pathways & Interactions for KRT19 Gene

genes like me logo Genes that share pathways with KRT19: view

Pathways by source for KRT19 Gene

1 BioSystems pathway for KRT19 Gene
1 GeneGo (Thomson Reuters) pathway for KRT19 Gene

SIGNOR curated interactions for KRT19 Gene

Other effect:

Gene Ontology (GO) - Biological Process for KRT19 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0043627 response to estrogen IEP 10037815
genes like me logo Genes that share ontologies with KRT19: view

Drugs & Compounds for KRT19 Gene

(21) Drugs for KRT19 Gene - From: Novoseek

Name Status Disease Links Group Role Mechanism of Action Clinical Trials

(32) Additional Compounds for KRT19 Gene - From: Novoseek

Name Synonyms Role CAS Number PubChem IDs PubMed IDs
genes like me logo Genes that share compounds with KRT19: view

Transcripts for KRT19 Gene

Unigene Clusters for KRT19 Gene

Keratin 19:
Representative Sequences:

Inhibitory RNA Products

Flow Cytometry Products

Alternative Splicing Database (ASD) splice patterns (SP) for KRT19 Gene

ExUns: 1a · 1b · 1c ^ 2 ^ 3 ^ 4a · 4b ^ 5a · 5b ^ 6a · 6b ^ 7a · 7b · 7c ^ 8a · 8b · 8c · 8d · 8e
SP1: - -
SP2: -
SP3: - - - -
SP4:
SP5: - - - - - - - - - - -
SP6: - - -
SP7:

Relevant External Links for KRT19 Gene

GeneLoc Exon Structure for
KRT19
ECgene alternative splicing isoforms for
KRT19

Expression for KRT19 Gene

mRNA expression in normal human tissues for KRT19 Gene

mRNA expression in embryonic tissues and stem cells from LifeMap Discovery

mRNA differential expression in normal tissues according to GTEx for KRT19 Gene

This gene is overexpressed in Esophagus - Mucosa (x7.4), Minor Salivary Gland (x6.6), Colon - Transverse (x6.3), Small Intestine - Terminal Ileum (x4.8), and Bladder (x4.7).

Protein differential expression in normal tissues from HIPED for KRT19 Gene

This gene is overexpressed in Salivary gland (10.7), Saliva (9.6), and Nasal epithelium (9.4).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, PaxDb, and MOPED for KRT19 Gene



SOURCE GeneReport for Unigene cluster for KRT19 Gene Hs.654568

mRNA Expression by UniProt/SwissProt for KRT19 Gene

P08727-K1C19_HUMAN
Tissue specificity: Expressed in a defined zone of basal keratinocytes in the deep outer root sheath of hair follicles. Also observed in sweat gland and mammary gland ductal and secretory cells, bile ducts, gastrointestinal tract, bladder urothelium, oral epithelia, esophagus, ectocervical epithelium (at protein level). Expressed in epidermal basal cells, in nipple epidermis and a defined region of the hair follicle. Also seen in a subset of vascular wall cells in both the veins and artery of human umbilical cord, and in umbilical cord vascular smooth muscle. Observed in muscle fibers accumulating in the costameres of myoplasm at the sarcolemma in structures that contain dystrophin and spectrin.
genes like me logo Genes that share expression patterns with KRT19: view

Protein tissue co-expression partners for KRT19 Gene

Primer Products

In Situ Assay Products

Orthologs for KRT19 Gene

This gene was present in the common ancestor of chordates.

Orthologs for KRT19 Gene

Organism Taxonomy Gene Similarity Type Details
chimpanzee
(Pan troglodytes)
Mammalia KRT19 36
  • 100 (a)
OneToOne
KRT19 35
  • 99.08 (n)
  • 99.5 (a)
cow
(Bos Taurus)
Mammalia KRT19 36
  • 89 (a)
OneToOne
KRT19 35
  • 88.35 (n)
  • 88.17 (a)
dog
(Canis familiaris)
Mammalia KRT19 35
  • 88.97 (n)
  • 89.22 (a)
KRT19 36
  • 90 (a)
OneToOne
mouse
(Mus musculus)
Mammalia Krt19 16
Krt19 36
  • 82 (a)
OneToOne
Krt19 35
  • 83.17 (n)
  • 82.5 (a)
oppossum
(Monodelphis domestica)
Mammalia KRT19 36
  • 79 (a)
OneToOne
rat
(Rattus norvegicus)
Mammalia Krt19 35
  • 83 (n)
  • 82 (a)
chicken
(Gallus gallus)
Aves KRT19 35
  • 72.57 (n)
  • 77.22 (a)
KRT19 36
  • 72 (a)
OneToOne
lizard
(Anolis carolinensis)
Reptilia KRT19 36
  • 68 (a)
OneToOne
tropical clawed frog
(Silurana tropicalis)
Amphibia krt19 35
  • 71.21 (n)
  • 73.99 (a)
Species with no ortholog for KRT19:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • fruit fly (Drosophila melanogaster)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • platypus (Ornithorhynchus anatinus)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea squirt (Ciona intestinalis)
  • sea squirt (Ciona savignyi)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)
  • worm (Caenorhabditis elegans)
  • zebrafish (Danio rerio)

Evolution for KRT19 Gene

ENSEMBL:
Gene Tree for KRT19 (if available)
TreeFam:
Gene Tree for KRT19 (if available)

Paralogs for KRT19 Gene

genes like me logo Genes that share paralogs with KRT19: view

Variants for KRT19 Gene

Sequence variations from dbSNP and Humsavar for KRT19 Gene

SNP ID Clin Chr 17 pos Sequence Context AA Info Type
rs4602 - 41,528,069(-) GGGGG(A/C/G)CTACG reference, missense
rs4601 -- 41,525,223(-) GACAA(C/T)GCCCG reference, synonymous-codon
rs1869720 -- 41,524,544(+) TCCTG(A/T)AAAGA intron-variant
rs3786142 -- 41,526,792(+) ATCTC(A/G)AACTC intron-variant
rs3837871 -- 41,527,155(+) TGACG(-/CAGATCCGTTCTTTCCC/CAGATCCGTTCTTTCCCCAGATCCGTTCTTT)CAGAT intron-variant

Structural Variations from Database of Genomic Variants (DGV) for KRT19 Gene

Variant ID Type Subtype PubMed ID
dgv961e1 CNV Complex 17122850
dgv962e1 CNV Complex 17122850
nsv510711 CNV Loss 20534489
nsv526466 CNV Gain 19592680
nsv9555 CNV Gain 18304495
nsv827992 CNV Gain 20364138
esv34903 CNV Gain 17911159
dgv963e1 CNV Complex 17122850
nsv442419 CNV CNV 18776908

Variation tolerance for KRT19 Gene

Residual Variation Intolerance Score: 67.5% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 1.87; 35.01% of all genes are more intolerant (likely to be disease-causing)

Relevant External Links for KRT19 Gene

HapMap Linkage Disequilibrium report
KRT19

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for KRT19 Gene

Disorders for KRT19 Gene

MalaCards: The human disease database

(54) MalaCards diseases for KRT19 Gene - From: DISEASES, Novoseek, and GeneCards

Disorder Aliases PubMed IDs
lung cancer
  • lung cancer, protection against
hepatocellular carcinoma
  • hepatocellular carcinoma, somatic
thyroid cancer
  • malignant neoplasm of thyroid gland
follicular adenoma
  • follicular adenoma of the thyroid gland
idiopathic corneal edema
- elite association - COSMIC cancer census association via MalaCards
Search KRT19 in MalaCards View complete list of genes associated with diseases

Relevant External Links for KRT19

Genetic Association Database (GAD)
KRT19
Human Genome Epidemiology (HuGE) Navigator
KRT19
Atlas of Genetics and Cytogenetics in Oncology and Haematology:
KRT19
genes like me logo Genes that share disorders with KRT19: view

No data available for UniProtKB/Swiss-Prot and Genatlas for KRT19 Gene

Publications for KRT19 Gene

  1. Characterization of the major physiologic phosphorylation site of human keratin 19 and its role in filament organization. (PMID: 10212274) Zhou X. … Omary M.B. (J. Biol. Chem. 1999) 3 4 23 67
  2. Universal markers of thyroid malignancies: galectin-3, HBME-1, and cytokeratin-19. (PMID: 20198455) Barut F. … Ozdamar S.O. (Endocr. Pathol. 2010) 3 23
  3. KIT is an independent prognostic marker for pancreatic endocrine tumors: a finding derived from analysis of islet cell differentiation markers. (PMID: 19574886) Zhang L. … Lloyd R.V. (Am. J. Surg. Pathol. 2009) 3 23
  4. Clinical meaning of age-related expression of fecal cytokeratin 19 in colorectal malignancy. (PMID: 19849844) Chang C.C. … Huang C.J. (BMC Cancer 2009) 3 23
  5. Expression of cytokeratin 19 in the diagnosis of thyroid papillary carcinoma by quantitative polymerase chain reaction. (PMID: 18308654) Flanagan J.N. … Braverman L.E. (Endocr Pract 2008) 3 23

Products for KRT19 Gene

Sources for KRT19 Gene

Back to Top

Content