Free for academic non-profit institutions. Other users need a Commercial license

Aliases for KREMEN2 Gene

Aliases for KREMEN2 Gene

  • Kringle Containing Transmembrane Protein 2 2 3 5
  • Kringle-Containing Protein Marking The Eye And The Nose 3 4
  • Kringle Domain-Containing Transmembrane Protein 2 3 4
  • Dickkopf Receptor 2 3 4
  • KRM2 3 4
  • Kremen Protein 2 3

External Ids for KREMEN2 Gene

Previous GeneCards Identifiers for KREMEN2 Gene

  • GC16P003034
  • GC16P003014
  • GC16P002954
  • GC16P002986

Summaries for KREMEN2 Gene

Entrez Gene Summary for KREMEN2 Gene

  • This gene encodes a high-affinity dickkopf homolog 1 (DKK1) transmembrane receptor. A similar protein in mouse functions interacts with with DKK1 to block wingless (WNT)/beta-catenin signaling. The encoded protein forms a ternary membrane complex with DKK1 and the WNT receptor lipoprotein receptor-related protein 6 (LRP6), and induces rapid endocytosis and removal of LRP6 from the plasma membrane. It contains extracellular kringle, WSC, and CUB domains. Alternatively spliced transcript variants encoding distinct isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]

GeneCards Summary for KREMEN2 Gene

KREMEN2 (Kringle Containing Transmembrane Protein 2) is a Protein Coding gene. Among its related pathways are Signaling by Wnt and HIV Life Cycle. An important paralog of this gene is KREMEN1.

UniProtKB/Swiss-Prot for KREMEN2 Gene

  • Receptor for Dickkopf protein. Cooperates with Dickkopf to block Wnt/beta-catenin signaling. Forms a ternary complex with Dkk1 and LRP6 and induces rapid endocytosis and removal of the Wnt receptor LRP6 from the plasma membrane (By similarity).

No data available for CIViC summary , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for KREMEN2 Gene

Genomics for KREMEN2 Gene

Regulatory Elements for KREMEN2 Gene

Enhancers for KREMEN2 Gene
GeneHancer Identifier Enhancer Score Enhancer Sources Gene-Enhancer Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor Binding Sites within enhancer Gene Targets for Enhancer
GH16G002926 1.2 Ensembl ENCODE 12.6 -36.6 -36564 1.7 ATF1 CREB3L1 ARNT WRNIP1 ARID4B BRCA1 ZNF2 YY1 ZNF143 KLF7 FLYWCH1 KREMEN2 PAQR4 PKMYT1 SRRM2-AS1 PRSS27 ENSG00000255513 LOC107984895 GC16P002923 GC16P002955
GH16G002919 1.2 Ensembl ENCODE 11.5 -44.2 -44231 0.4 ATF1 ARNT AGO1 ARID4B SIN3A ZNF121 ZNF143 REST ZNF785 SP7 KREMEN2 PAQR4 PKMYT1 PRSS22 SNORD60 PRSS27 SNHG19 PRSS30P RPS2 SRRM2
GH16G002774 1.3 ENCODE dbSUPER 10.6 -186.7 -186664 4.6 CREB3L1 AGO1 ZFP64 ARID4B SIN3A DMAP1 ZBTB7B YY1 ZNF766 ZNF207 SRRM2 SRRM2-AS1 PRSS27 KREMEN2 PAQR4 ENSG00000260095 PRSS33 PRSS41 ELOB PIR54527
GH16G002689 1.3 FANTOM5 ENCODE dbSUPER 10 -272.1 -272078 4.0 DRAP1 SAP130 ARID4B DMAP1 ZIC2 KMT2B ZNF48 ZNF335 POLR2A HSF1 KCTD5 PRSS27 SRRM2-AS1 SRRM2 PAQR4 KREMEN2 ABCA3 ABCA17P ENSG00000269937 GC16P002839
GH16G002924 1 Ensembl ENCODE 12.6 -38.6 -38628 1.8 ZNF263 KLF1 SMAD5 AGO1 RBBP5 ZIC2 HIC1 GLIS2 SMARCA4 POLR2A FLYWCH1 KREMEN2 PAQR4 PKMYT1 SRRM2-AS1 PRSS27 ENSG00000263235 GC16P002923 GC16P002955
- Elite enhancer and/or Elite enhancer-gene association Download GeneHancer data dump

Enhancers around KREMEN2 on UCSC Golden Path with GeneCards custom track

Promoters for KREMEN2 Gene
Ensembl Regulatory Elements (ENSRs) TSS Distance (bp) Size (bp) Binding Sites for Transcription Factors within promoters
ENSR00000082569 1156 201 PKNOX1 RB1 FUS AGO1 ARID4B SIN3A KLF17 ZNF2 ZNF48 GLIS2

Genomic Location for KREMEN2 Gene

2,963,944 bp from pter
2,968,383 bp from pter
4,440 bases
Plus strand

Genomic View for KREMEN2 Gene

Genes around KREMEN2 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
KREMEN2 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for KREMEN2 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for KREMEN2 Gene

Proteins for KREMEN2 Gene

  • Protein details for KREMEN2 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Recommended name:
    Kremen protein 2
    Protein Accession:
    Secondary Accessions:
    • B4DXF6
    • I3L2S2
    • Q8N2J4
    • Q8NCW1
    • Q96GL8
    • Q9BTP9

    Protein attributes for KREMEN2 Gene

    462 amino acids
    Molecular mass:
    48849 Da
    Quaternary structure:
    • Interacts with ERLEC1.

    Alternative splice isoforms for KREMEN2 Gene

neXtProt entry for KREMEN2 Gene

Post-translational modifications for KREMEN2 Gene

  • Glycosylation at posLast=4949, posLast=222222, posLast=244244, and isoforms=2, 3, 4, 5, 6351
  • Modification sites at PhosphoSitePlus

No data available for DME Specific Peptides for KREMEN2 Gene

Domains & Families for KREMEN2 Gene

Suggested Antigen Peptide Sequences for KREMEN2 Gene

GenScript: Design optimal peptide antigens:

Graphical View of Domain Structure for InterPro Entry



  • Binding to ERLEC1 is mediated by the oligosaccharides linked to the kringle domain.
  • Binding to ERLEC1 is mediated by the oligosaccharides linked to the kringle domain.
genes like me logo Genes that share domains with KREMEN2: view

No data available for Gene Families for KREMEN2 Gene

Function for KREMEN2 Gene

Molecular function for KREMEN2 Gene

UniProtKB/Swiss-Prot Function:
Receptor for Dickkopf protein. Cooperates with Dickkopf to block Wnt/beta-catenin signaling. Forms a ternary complex with Dkk1 and LRP6 and induces rapid endocytosis and removal of the Wnt receptor LRP6 from the plasma membrane (By similarity).
genes like me logo Genes that share phenotypes with KREMEN2: view

Animal Models for KREMEN2 Gene

MGI Knock Outs for KREMEN2:

Animal Model Products

  • Taconic Biosciences Mouse Models for KREMEN2

CRISPR Products

miRNA for KREMEN2 Gene

miRTarBase miRNAs that target KREMEN2

Inhibitory RNA Products

No data available for Enzyme Numbers (IUBMB) , Gene Ontology (GO) - Molecular Function , Human Phenotype Ontology , Transcription Factor Targets and HOMER Transcription for KREMEN2 Gene

Localization for KREMEN2 Gene

Subcellular locations from UniProtKB/Swiss-Prot for KREMEN2 Gene

Membrane; Single-pass type I membrane protein.

Subcellular locations from

Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for KREMEN2 gene
Compartment Confidence
plasma membrane 5
endosome 4
extracellular 3
nucleus 2
cytosol 1

Gene Ontology (GO) - Cellular Components for KREMEN2 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005886 plasma membrane TAS --
GO:0016020 membrane IBA,IEA --
GO:0016021 integral component of membrane IEA --
GO:0031901 early endosome membrane TAS --
genes like me logo Genes that share ontologies with KREMEN2: view

Pathways & Interactions for KREMEN2 Gene

genes like me logo Genes that share pathways with KREMEN2: view

SIGNOR curated interactions for KREMEN2 Gene

Is activated by:

Gene Ontology (GO) - Biological Process for KREMEN2 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0007154 cell communication IBA --
GO:0016055 Wnt signaling pathway IEA --
GO:0030279 negative regulation of ossification ISS --
GO:0060173 limb development ISS --
GO:0090090 negative regulation of canonical Wnt signaling pathway TAS --
genes like me logo Genes that share ontologies with KREMEN2: view

Drugs & Compounds for KREMEN2 Gene

No Compound Related Data Available

Transcripts for KREMEN2 Gene

Unigene Clusters for KREMEN2 Gene

Kringle containing transmembrane protein 2:
Representative Sequences:

CRISPR Products

Inhibitory RNA Products

Alternative Splicing Database (ASD) splice patterns (SP) for KREMEN2 Gene

ExUns: 1a · 1b · 1c · 1d ^ 2 ^ 3 ^ 4 ^ 5a · 5b ^ 6 ^ 7 ^ 8a · 8b ^ 9
SP1: - - -
SP2: - -

Relevant External Links for KREMEN2 Gene

GeneLoc Exon Structure for
ECgene alternative splicing isoforms for

Expression for KREMEN2 Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for KREMEN2 Gene

mRNA expression in embryonic tissues and stem cells from LifeMap Discovery

mRNA differential expression in normal tissues according to GTEx for KREMEN2 Gene

This gene is overexpressed in Skin - Not Sun Exposed (Suprapubic) (x9.4), Skin - Sun Exposed (Lower leg) (x7.5), and Esophagus - Mucosa (x4.1).

Protein differential expression in normal tissues from HIPED for KREMEN2 Gene

This gene is overexpressed in Peripheral blood mononuclear cells (69.0).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, PaxDb, and MOPED for KREMEN2 Gene

Protein tissue co-expression partners for KREMEN2 Gene

NURSA nuclear receptor signaling pathways regulating expression of KREMEN2 Gene:


SOURCE GeneReport for Unigene cluster for KREMEN2 Gene:


Evidence on tissue expression from TISSUES for KREMEN2 Gene

  • Nervous system(4.1)
genes like me logo Genes that share expression patterns with KREMEN2: view

Primer Products

No data available for mRNA Expression by UniProt/SwissProt and Phenotype-based relationships between genes and organs from Gene ORGANizer for KREMEN2 Gene

Orthologs for KREMEN2 Gene

This gene was present in the common ancestor of chordates.

Orthologs for KREMEN2 Gene

Organism Taxonomy Gene Similarity Type Details
(Pan troglodytes)
Mammalia KREMEN2 35
  • 99 (a)
(Canis familiaris)
Mammalia KREMEN2 34 35
  • 90.15 (n)
(Rattus norvegicus)
Mammalia Kremen2 34
  • 84.27 (n)
(Mus musculus)
Mammalia Kremen2 34 16 35
  • 84.12 (n)
(Ornithorhynchus anatinus)
Mammalia KREMEN2 35
  • 76 (a)
(Bos Taurus)
Mammalia KREMEN2 35
  • 72 (a)
(Anolis carolinensis)
Reptilia KREMEN2 35
  • 47 (a)
Species where no ortholog for KREMEN2 was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • chicken (Gallus gallus)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • fruit fly (Drosophila melanogaster)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • oppossum (Monodelphis domestica)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea squirt (Ciona intestinalis)
  • sea squirt (Ciona savignyi)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • tropical clawed frog (Silurana tropicalis)
  • wheat (Triticum aestivum)
  • worm (Caenorhabditis elegans)
  • zebrafish (Danio rerio)

Evolution for KREMEN2 Gene

Gene Tree for KREMEN2 (if available)
Gene Tree for KREMEN2 (if available)

Paralogs for KREMEN2 Gene

Paralogs for KREMEN2 Gene

(3) SIMAP similar genes for KREMEN2 Gene using alignment to 1 proteins:

genes like me logo Genes that share paralogs with KREMEN2: view

Variants for KREMEN2 Gene

Sequence variations from dbSNP and Humsavar for KREMEN2 Gene

SNP ID Clin Chr 16 pos Sequence Context AA Info Type
rs1000264883 -- 2,964,731(+) CTGAG(A/C)AGCCC intron-variant
rs1000291600 -- 2,964,296(+) GACCC(A/G)GGTAG utr-variant-5-prime
rs1000556724 -- 2,968,821(+) AGGCA(-/CGCCTTCAGAGGCCTGGGTACCGTGGAG)CGCCT downstream-variant-500B, upstream-variant-2KB
rs1000870267 -- 2,965,983(+) TTCTG(C/T)GTAGA intron-variant
rs1001247656 -- 2,964,818(+) CCCGG(C/T)GTGGG intron-variant

Structural Variations from Database of Genomic Variants (DGV) for KREMEN2 Gene

Variant ID Type Subtype PubMed ID
nsv433167 CNV loss 18776910
nsv509588 CNV insertion 20534489
nsv510673 CNV deletion 20534489
nsv571246 CNV loss 21841781
nsv827525 CNV gain 20364138
nsv952906 CNV deletion 24416366

Variation tolerance for KREMEN2 Gene

Gene Damage Index Score: 11.58; 93.06% of all genes are more intolerant (likely to be disease-causing)

Relevant External Links for KREMEN2 Gene

SNPedia medical, phenotypic, and genealogical associations of SNPs for

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for KREMEN2 Gene

Disorders for KREMEN2 Gene

Relevant External Links for KREMEN2

Atlas of Genetics and Cytogenetics in Oncology and Haematology:

No disorders were found for KREMEN2 Gene.

No data available for MalaCards , UniProtKB/Swiss-Prot and Genatlas for KREMEN2 Gene

Publications for KREMEN2 Gene

  1. Complete sequencing and characterization of 21,243 full-length human cDNAs. (PMID: 14702039) Ota T. … Sugano S. (Nat. Genet. 2004) 3 4 64
  2. The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). (PMID: 15489334) Gerhard D.S. … Malek J. (Genome Res. 2004) 3 4 64
  3. Kremen proteins are Dickkopf receptors that regulate Wnt/beta-catenin signalling. (PMID: 12050670) Mao B. … Niehrs C. (Nature 2002) 2 3 64
  4. Differential expression of DKK-1 binding receptors on stromal cells and myeloma cells results in their distinct response to secreted DKK-1 in myeloma. (PMID: 20846389) Dun X. … Hou J. (Mol. Cancer 2010) 3 64
  5. A cell-based Dkk1 binding assay reveals roles for extracellular domains of LRP5 in Dkk1 interaction and highlights differences between wild-type and the high bone mass mutant LRP5(G171V). (PMID: 19746449) Murrills R.J. … Bodine P.V. (J. Cell. Biochem. 2009) 22 64

Products for KREMEN2 Gene

Sources for KREMEN2 Gene

Loading form....