Free for academic non-profit institutions. Other users need a Commercial license

Aliases for KREMEN2 Gene

Aliases for KREMEN2 Gene

  • Kringle Containing Transmembrane Protein 2 2 3 5
  • Kringle-Containing Protein Marking The Eye And The Nose 3 4
  • Kringle Domain-Containing Transmembrane Protein 2 3 4
  • Dickkopf Receptor 2 3 4
  • KRM2 3 4
  • Kremen Protein 2 3

External Ids for KREMEN2 Gene

Previous GeneCards Identifiers for KREMEN2 Gene

  • GC16P003034
  • GC16P003014
  • GC16P002954
  • GC16P002986

Summaries for KREMEN2 Gene

Entrez Gene Summary for KREMEN2 Gene

  • This gene encodes a high-affinity dickkopf homolog 1 (DKK1) transmembrane receptor. A similar protein in mouse functions interacts with with DKK1 to block wingless (WNT)/beta-catenin signaling. The encoded protein forms a ternary membrane complex with DKK1 and the WNT receptor lipoprotein receptor-related protein 6 (LRP6), and induces rapid endocytosis and removal of LRP6 from the plasma membrane. It contains extracellular kringle, WSC, and CUB domains. Alternatively spliced transcript variants encoding distinct isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]

GeneCards Summary for KREMEN2 Gene

KREMEN2 (Kringle Containing Transmembrane Protein 2) is a Protein Coding gene. Among its related pathways are Negative regulation of TCF-dependent signaling by WNT ligand antagonists and Presenilin action in Notch and Wnt signaling. An important paralog of this gene is KREMEN1.

UniProtKB/Swiss-Prot for KREMEN2 Gene

  • Receptor for Dickkopf proteins. Cooperates with DKK1/2 to inhibit Wnt/beta-catenin signaling by promoting the endocytosis of Wnt receptors LRP5 and LRP6. Plays a role in limb development; attenuates Wnt signaling in the developing limb to allow normal limb patterning and can also negatively regulate bone formation.

Additional gene information for KREMEN2 Gene

No data available for CIViC summary , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for KREMEN2 Gene

Genomics for KREMEN2 Gene

GeneHancer (GH) Regulatory Elements for KREMEN2 Gene

Promoters and enhancers for KREMEN2 Gene
GeneHancer (GH) Identifier GH Type GH
GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites
Gene Targets
GH16I002963 Promoter/Enhancer 2.4 EPDnew FANTOM5 Ensembl ENCODE dbSUPER 553 0.0 0 2.5 PKNOX1 SMAD1 ARID4B SIN3A DMAP1 ZNF2 ZNF48 GLIS2 SP3 SP5 KREMEN2 ENSG00000270168 MMP25 GC16M002964 LOC105371055
GH16I002962 Enhancer 1 ENCODE dbSUPER 550.8 -1.9 -1939 0 HDGF PKNOX1 KLF17 SIN3A RAD21 ZNF48 ZNF213 ARID2 ZNF143 ZNF391 KREMEN2 SRRM2 ZNF263 ENSG00000255513 SNORA64 LOC105371055 CREBBP THOC6 ENSG00000261938 SNORD60
GH16I002964 Enhancer 1 ENCODE dbSUPER 550.8 -1.8 -1839 0.1 HDGF PKNOX1 KLF17 SIN3A ZNF48 ZNF213 ZNF391 SMARCA5 SMARCC1 REST KREMEN2 SRRM2 ZNF263 ENSG00000255513 SNORA64 LOC105371055 CREBBP THOC6 ENSG00000261938 SNORD60
GH16I002965 Enhancer 0.8 ENCODE dbSUPER 550.8 +1.4 1431 0.2 OSR2 PKNOX1 IKZF1 VEZF1 NBN ZBTB33 IKZF2 SPI1 GC16M002964 KREMEN2
GH16I002774 Promoter/Enhancer 2.2 EPDnew Ensembl ENCODE dbSUPER 10.6 -186.7 -186663 4.6 CLOCK SMAD1 ZFP64 ARID4B SIN3A DMAP1 ZBTB7B YY1 POLR2B ZNF766 ELOB GC16P002987 PIR54527 ENSG00000276791 MTCO1P28 SRRM2 SRRM2-AS1 TIGD7 PRSS27 CLUAP1
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data dump

GeneHancers around KREMEN2 on UCSC Golden Path with GeneCards custom track

Top Transcription factor binding sites by QIAGEN in the KREMEN2 gene promoter:

Genomic Locations for KREMEN2 Gene

Genomic Locations for KREMEN2 Gene
4,440 bases
Plus strand

Genomic View for KREMEN2 Gene

Genes around KREMEN2 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
KREMEN2 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for KREMEN2 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for KREMEN2 Gene

Proteins for KREMEN2 Gene

  • Protein details for KREMEN2 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Recommended name:
    Kremen protein 2
    Protein Accession:
    Secondary Accessions:
    • B4DXF6
    • I3L2S2
    • Q8N2J4
    • Q8NCW1
    • Q96GL8
    • Q9BTP9

    Protein attributes for KREMEN2 Gene

    462 amino acids
    Molecular mass:
    48849 Da
    Quaternary structure:
    • Interacts with ERLEC1. Forms a ternary complex with DKK1 and LRP6.

    Alternative splice isoforms for KREMEN2 Gene

neXtProt entry for KREMEN2 Gene

Post-translational modifications for KREMEN2 Gene

  • Glycosylation at posLast=4949, isoforms=2, 3, 4, 5, 6222, posLast=244244, and posLast=351351

No data available for DME Specific Peptides for KREMEN2 Gene

Domains & Families for KREMEN2 Gene

Gene Families for KREMEN2 Gene

Human Protein Atlas (HPA):
  • Predicted membrane proteins
  • Predicted secreted proteins

Suggested Antigen Peptide Sequences for KREMEN2 Gene

GenScript: Design optimal peptide antigens:

Graphical View of Domain Structure for InterPro Entry



  • Binding to ERLEC1 is mediated by the oligosaccharides linked to the kringle domain.
  • Binding to ERLEC1 is mediated by the oligosaccharides linked to the kringle domain.
genes like me logo Genes that share domains with KREMEN2: view

Function for KREMEN2 Gene

Molecular function for KREMEN2 Gene

UniProtKB/Swiss-Prot Function:
Receptor for Dickkopf proteins. Cooperates with DKK1/2 to inhibit Wnt/beta-catenin signaling by promoting the endocytosis of Wnt receptors LRP5 and LRP6. Plays a role in limb development; attenuates Wnt signaling in the developing limb to allow normal limb patterning and can also negatively regulate bone formation.

Phenotypes From GWAS Catalog for KREMEN2 Gene

genes like me logo Genes that share phenotypes with KREMEN2: view

Animal Models for KREMEN2 Gene

MGI Knock Outs for KREMEN2:

Animal Model Products

miRNA for KREMEN2 Gene

miRTarBase miRNAs that target KREMEN2

Clone Products

No data available for Enzyme Numbers (IUBMB) , Gene Ontology (GO) - Molecular Function , Human Phenotype Ontology , Transcription Factor Targets and HOMER Transcription for KREMEN2 Gene

Localization for KREMEN2 Gene

Subcellular locations from UniProtKB/Swiss-Prot for KREMEN2 Gene

Membrane; Single-pass type I membrane protein.

Subcellular locations from

Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for KREMEN2 gene
Compartment Confidence
plasma membrane 5
endosome 4
extracellular 3
nucleus 2
cytosol 1

Subcellular locations from the

Human Protein Atlas (HPA)

Gene Ontology (GO) - Cellular Components for KREMEN2 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005886 plasma membrane TAS --
GO:0016020 membrane IBA --
GO:0016021 integral component of membrane IEA --
GO:0031901 early endosome membrane TAS --
genes like me logo Genes that share ontologies with KREMEN2: view

Pathways & Interactions for KREMEN2 Gene

genes like me logo Genes that share pathways with KREMEN2: view

SIGNOR curated interactions for KREMEN2 Gene

Is activated by:

Gene Ontology (GO) - Biological Process for KREMEN2 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0007154 cell communication IBA --
GO:0016055 Wnt signaling pathway IEA --
GO:0030279 negative regulation of ossification ISS --
GO:0060173 limb development ISS --
GO:0090090 negative regulation of canonical Wnt signaling pathway TAS --
genes like me logo Genes that share ontologies with KREMEN2: view

Drugs & Compounds for KREMEN2 Gene

No Compound Related Data Available

Transcripts for KREMEN2 Gene

Unigene Clusters for KREMEN2 Gene

Kringle containing transmembrane protein 2:
Representative Sequences:

Clone Products

Alternative Splicing Database (ASD) splice patterns (SP) for KREMEN2 Gene

ExUns: 1a · 1b · 1c · 1d ^ 2 ^ 3 ^ 4 ^ 5a · 5b ^ 6 ^ 7 ^ 8a · 8b ^ 9
SP1: - - -
SP2: - -

Relevant External Links for KREMEN2 Gene

GeneLoc Exon Structure for
ECgene alternative splicing isoforms for

Expression for KREMEN2 Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for KREMEN2 Gene

mRNA expression in embryonic tissues and stem cells from LifeMap Discovery

mRNA differential expression in normal tissues according to GTEx for KREMEN2 Gene

This gene is overexpressed in Skin - Not Sun Exposed (Suprapubic) (x9.4), Skin - Sun Exposed (Lower leg) (x7.5), and Esophagus - Mucosa (x4.1).

Protein differential expression in normal tissues from HIPED for KREMEN2 Gene

This gene is overexpressed in Peripheral blood mononuclear cells (69.0).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, PaxDb, and MOPED for KREMEN2 Gene

Protein tissue co-expression partners for KREMEN2 Gene

NURSA nuclear receptor signaling pathways regulating expression of KREMEN2 Gene:


SOURCE GeneReport for Unigene cluster for KREMEN2 Gene:


Evidence on tissue expression from TISSUES for KREMEN2 Gene

  • Nervous system(4.1)
genes like me logo Genes that share expression patterns with KREMEN2: view

No data available for mRNA Expression by UniProt/SwissProt and Phenotype-based relationships between genes and organs from Gene ORGANizer for KREMEN2 Gene

Orthologs for KREMEN2 Gene

This gene was present in the common ancestor of chordates.

Orthologs for KREMEN2 Gene

Organism Taxonomy Gene Similarity Type Details
(Pan troglodytes)
Mammalia KREMEN2 34
  • 99 (a)
(Canis familiaris)
Mammalia KREMEN2 33 34
  • 90.15 (n)
(Rattus norvegicus)
Mammalia Kremen2 33
  • 84.27 (n)
(Mus musculus)
Mammalia Kremen2 33 16 34
  • 84.12 (n)
(Ornithorhynchus anatinus)
Mammalia KREMEN2 34
  • 76 (a)
(Bos Taurus)
Mammalia KREMEN2 34
  • 72 (a)
(Anolis carolinensis)
Reptilia KREMEN2 34
  • 47 (a)
Species where no ortholog for KREMEN2 was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • chicken (Gallus gallus)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • fruit fly (Drosophila melanogaster)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • oppossum (Monodelphis domestica)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea squirt (Ciona intestinalis)
  • sea squirt (Ciona savignyi)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • tropical clawed frog (Silurana tropicalis)
  • wheat (Triticum aestivum)
  • worm (Caenorhabditis elegans)
  • zebrafish (Danio rerio)

Evolution for KREMEN2 Gene

Gene Tree for KREMEN2 (if available)
Gene Tree for KREMEN2 (if available)

Paralogs for KREMEN2 Gene

Paralogs for KREMEN2 Gene

(3) SIMAP similar genes for KREMEN2 Gene using alignment to 1 proteins:

genes like me logo Genes that share paralogs with KREMEN2: view

Variants for KREMEN2 Gene

Sequence variations from dbSNP and Humsavar for KREMEN2 Gene

SNP ID Clin Chr 16 pos Variation AA Info Type
rs1000264883 -- 2,964,731(+) C/A intron_variant
rs1000291600 -- 2,964,296(+) G/A 5_prime_UTR_variant
rs1000556724 -- 2,968,821(+) CGCCTTCAGAGGCCTGGGTACCGTGGAGCGCCTT/CGCCTT downstream_transcript_variant
rs1000870267 -- 2,965,983(+) C/T intron_variant
rs1001247656 -- 2,964,818(+) C/T intron_variant

Structural Variations from Database of Genomic Variants (DGV) for KREMEN2 Gene

Variant ID Type Subtype PubMed ID
nsv433167 CNV loss 18776910
nsv509588 CNV insertion 20534489
nsv510673 CNV deletion 20534489
nsv571246 CNV loss 21841781
nsv827525 CNV gain 20364138
nsv952906 CNV deletion 24416366

Variation tolerance for KREMEN2 Gene

Gene Damage Index Score: 11.58; 93.06% of all genes are more intolerant (likely to be disease-causing)

Additional Variant Information for KREMEN2 Gene

SNPedia medical, phenotypic, and genealogical associations of SNPs for

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for KREMEN2 Gene

Disorders for KREMEN2 Gene

Additional Disease Information for KREMEN2

No disorders were found for KREMEN2 Gene.

No data available for MalaCards , UniProtKB/Swiss-Prot and Genatlas for KREMEN2 Gene

Publications for KREMEN2 Gene

  1. Complete sequencing and characterization of 21,243 full-length human cDNAs. (PMID: 14702039) Ota T … Sugano S (Nature genetics 2004) 3 4 58
  2. The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). (PMID: 15489334) Gerhard DS … MGC Project Team (Genome research 2004) 3 4 58
  3. Kremen proteins are Dickkopf receptors that regulate Wnt/beta-catenin signalling. (PMID: 12050670) Mao B … Niehrs C (Nature 2002) 2 3 58
  4. Differential expression of DKK-1 binding receptors on stromal cells and myeloma cells results in their distinct response to secreted DKK-1 in myeloma. (PMID: 20846389) Dun X … Hou J (Molecular cancer 2010) 3 58
  5. A cell-based Dkk1 binding assay reveals roles for extracellular domains of LRP5 in Dkk1 interaction and highlights differences between wild-type and the high bone mass mutant LRP5(G171V). (PMID: 19746449) Murrills RJ … Bodine PV (Journal of cellular biochemistry 2009) 22 58

Products for KREMEN2 Gene

Sources for KREMEN2 Gene

Loading form....