Aliases for KREMEN2 Gene
Aliases for KREMEN2 Gene
External Ids for KREMEN2 Gene
- HGNC: 18797
- Entrez Gene: 79412
- Ensembl: ENSG00000131650
- OMIM: 609899
- UniProtKB: Q8NCW0
Previous GeneCards Identifiers for KREMEN2 Gene
- GC16P003034
- GC16P003014
- GC16P002954
- GC16P002986
Summaries for KREMEN2 Gene
-
This gene encodes a high-affinity dickkopf homolog 1 (DKK1) transmembrane receptor. A similar protein in mouse functions interacts with with DKK1 to block wingless (WNT)/beta-catenin signaling. The encoded protein forms a ternary membrane complex with DKK1 and the WNT receptor lipoprotein receptor-related protein 6 (LRP6), and induces rapid endocytosis and removal of LRP6 from the plasma membrane. It contains extracellular kringle, WSC, and CUB domains. Alternatively spliced transcript variants encoding distinct isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]
GeneCards Summary for KREMEN2 Gene
KREMEN2 (Kringle Containing Transmembrane Protein 2) is a Protein Coding gene. Among its related pathways are Signaling by Wnt and HIV Life Cycle. An important paralog of this gene is KREMEN1.
UniProtKB/Swiss-Prot for KREMEN2 Gene
-
Receptor for Dickkopf protein. Cooperates with Dickkopf to block Wnt/beta-catenin signaling. Forms a ternary complex with Dkk1 and LRP6 and induces rapid endocytosis and removal of the Wnt receptor LRP6 from the plasma membrane (By similarity).
No data available for CIViC summary , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for KREMEN2 Gene
Genomics for KREMEN2 Gene
Regulatory Elements for KREMEN2 Gene
Enhancers for KREMEN2 Gene
- Elite enhancer and/or Elite enhancer-gene association
Download GeneHancer data dump
Enhancers around KREMEN2 on UCSC Golden Path with GeneCards custom track
- Transcription factor binding sites by QIAGEN in the KREMEN2 gene promoter:
Regulatory Element Products
Genomic Location for KREMEN2 Gene
- Chromosome:
- 16
- Start:
- 2,963,944 bp from pter
- End:
- 2,968,383 bp from pter
- Size:
- 4,440 bases
- Orientation:
- Plus strand
Genomic View for KREMEN2 Gene
Genes around KREMEN2 on UCSC Golden Path with GeneCards custom track
- Cytogenetic band:
-
- 16p13.3 by Ensembl
- 16p13.3 by Entrez Gene
- 16p13.3 by HGNC
KREMEN2 Gene in genomic location: bands according to
Ensembl, locations according to GeneLoc
(and/or Entrez Gene and/or Ensembl if different)
Genomic Neighborhood
• Exon Structure
• Gene Density
RefSeq DNA sequence for KREMEN2 Gene
Proteins for KREMEN2 Gene
-
Protein details for KREMEN2 Gene (UniProtKB/Swiss-Prot)
- Protein Symbol:
- Q8NCW0-KREM2_HUMAN
- Recommended name:
- Kremen protein 2
- Protein Accession:
- Q8NCW0
- B4DXF6
- I3L2S2
- Q8N2J4
- Q8NCW1
- Q96GL8
- Q9BTP9
Protein attributes for KREMEN2 Gene
- Size:
- 462 amino acids
- Molecular mass:
- 48849 Da
- Quaternary structure:
-
- Interacts with ERLEC1.
Protein Expression for KREMEN2 Gene
Post-translational modifications for KREMEN2 Gene
Other Protein References for KREMEN2 Gene
- ENSEMBL proteins:
- REFSEQ proteins:
Antibody Products
- R&D Systems Antibodies for KREMEN2 (Kremen-2)
-
Custom Antibody ServicesOriGene Antibodies for KREMEN2
- Novus Biologicals Antibodies for KREMEN2
- Invitrogen Antibodies for KREMEN2
- antibodies-online Antibodies for KREMEN2: See all 30
- GeneTex KREMEN2 antibody for KREMEN2
-
Custom Antibody ServicesProSci Antibodies for KREMEN2
Protein Products
- R&D Systems Proteins and Enzymes for KREMEN2 (Kremen-2)
-
OriGene Purified Proteins for KREMEN2
- Search Origene for MassSpec and Protein Over-expression Lysates for KREMEN2
- Origene Custom Protein Services for KREMEN2
- antibodies-online Proteins for KREMEN2: See all 7
- Search antibodies-online for peptides
- Search GeneTex for Proteins for KREMEN2
No data available for DME Specific Peptides for KREMEN2 Gene
Domains & Families for KREMEN2 Gene
Protein Domains for KREMEN2 Gene
- InterPro:
- Blocks:
- ProtoNet:
Suggested Antigen Peptide Sequences for KREMEN2 Gene
- GenScript: Design optimal peptide antigens:
Graphical View of Domain Structure for InterPro Entry
Q8NCW0UniProtKB/Swiss-Prot:
KREM2_HUMAN :- Binding to ERLEC1 is mediated by the oligosaccharides linked to the kringle domain.
- Domain:
-
- Binding to ERLEC1 is mediated by the oligosaccharides linked to the kringle domain.
No data available for Gene Families for KREMEN2 Gene
Function for KREMEN2 Gene
Molecular function for KREMEN2 Gene
- UniProtKB/Swiss-Prot Function:
- Receptor for Dickkopf protein. Cooperates with Dickkopf to block Wnt/beta-catenin signaling. Forms a ternary complex with Dkk1 and LRP6 and induces rapid endocytosis and removal of the Wnt receptor LRP6 from the plasma membrane (By similarity).
Phenotypes for KREMEN2 Gene
- MGI mutant phenotypes for KREMEN2:
- inferred from 1 alleles
- GenomeRNAi human phenotypes for KREMEN2:
Animal Models for KREMEN2 Gene
- MGI Knock Outs for KREMEN2:
-
- Kremen2 tm1Cni
Animal Model Products
-
Taconic Biosciences Mouse Models for KREMEN2
- Cyagen custom Knockout/knockin (KOKI) mouse models for KREMEN2
-
-
ViGene Biosciences lentiviral particle packaged cDNA for KREMEN2 gene
-
ViGene Biosciences ready-to-package AAV shRNAs for KREMEN2 gene
- Search ViGene Biosciences for KREMEN2
CRISPR Products
-
OriGene CRISPR knockouts for KREMEN2
-
Santa Cruz Biotechnology (SCBT) CRISPR for KREMEN2
- GenScript: Design CRISPR guide RNA sequences for KREMEN2
miRNA for KREMEN2 Gene
- miRTarBase miRNAs that target KREMEN2
miRNA Products
- Search ViGene Biosciences for KREMEN2
Inhibitory RNA Products
- Origene shRNA, siRNA, and RNAi products in human, mouse, rat for KREMEN2
- Browse OriGene Inhibitory RNA Products For KREMEN2
-
ViGene Biosciences ready-to-package AAV shRNAs for KREMEN2 gene
Clone Products
- Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat
- VectorBuilder custom plasmid, inducible vectors for KREMEN2
- VectorBuilder custom lentivirus, adenovirus, AAV vector/virus packaging for KREMEN2
-
VectorBuilder Other custom vectors
- Mammalian expression: PiggyBac
- Mammalian Tet-on expression: plasmid
- Mammalian conditional (Cre-Lox): plasmid and PiggyBac
- Mammalian shRNA knockdown: lentiviral, adenoviral, AAV, and PiggyBac
- CRISPR: plasmid gRNA, lentiviral gRNA, and donor plasmid
- Bacterial expression: pET, pBAD, and pCS
- Yeast expression
Cell Line Products
-
Horizon Cell Lines for KREMEN2
-
ViGene Biosciences adenoviral particle packaged cDNA for KREMEN2 gene
-
ViGene Biosciences lentiviral particle packaged cDNA for KREMEN2 gene
-
ViGene Biosciences ready-to-package AAV shRNAs for KREMEN2 gene
No data available for Enzyme Numbers (IUBMB) , Gene Ontology (GO) - Molecular Function , Human Phenotype Ontology , Transcription Factor Targets and HOMER Transcription for KREMEN2 Gene
Localization for KREMEN2 Gene
Subcellular locations from UniProtKB/Swiss-Prot for KREMEN2 Gene
- Membrane; Single-pass type I membrane protein.
| Compartment | Confidence |
|---|---|
| plasma membrane | 5 |
| endosome | 4 |
| extracellular | 3 |
| nucleus | 2 |
| cytosol | 1 |
| GO ID | Qualified GO term | Evidence | PubMed IDs |
|---|---|---|---|
| GO:0005886 | plasma membrane | TAS | -- |
| GO:0016020 | membrane | IBA,IEA | -- |
| GO:0016021 | integral component of membrane | IEA | -- |
| GO:0031901 | early endosome membrane | TAS | -- |
Pathways & Interactions for KREMEN2 Gene
| SuperPathway | Contained pathways | ||
|---|---|---|---|
| 1 | HIV Life Cycle |
.45
|
|
| 2 | Negative regulation of TCF-dependent signaling by WNT ligand antagonists | ||
| 3 | Signaling by Wnt |
.71
|
|
| 4 | WNT Signaling | ||
| 5 | Signaling by GPCR | ||
Pathways by source for KREMEN2 Gene
2 BioSystems pathways for KREMEN2 Gene
1 Qiagen pathway for KREMEN2 Gene
Interacting Proteins for KREMEN2 Gene
| GO ID | Qualified GO term | Evidence | PubMed IDs |
|---|---|---|---|
| GO:0007154 | cell communication | IBA | -- |
| GO:0016055 | Wnt signaling pathway | IEA | -- |
| GO:0030279 | negative regulation of ossification | ISS | -- |
| GO:0060173 | limb development | ISS | -- |
| GO:0090090 | negative regulation of canonical Wnt signaling pathway | TAS | -- |
Transcripts for KREMEN2 Gene
mRNA/cDNA for KREMEN2 Gene
- (6) REFSEQ mRNAs :
- (10) Additional mRNA sequences :
- (87) Selected AceView cDNA sequences:
- (6) Ensembl transcripts including schematic representations, and UCSC links where relevant :
Unigene Clusters for KREMEN2 Gene
CRISPR Products
-
OriGene CRISPR knockouts for KREMEN2
-
Santa Cruz Biotechnology (SCBT) CRISPR for KREMEN2
- GenScript: Design CRISPR guide RNA sequences for KREMEN2
miRNA Products
- Search ViGene Biosciences for KREMEN2
Inhibitory RNA Products
- Origene shRNA, siRNA, and RNAi products in human, mouse, rat for KREMEN2
- Browse OriGene Inhibitory RNA Products For KREMEN2
-
ViGene Biosciences ready-to-package AAV shRNAs for KREMEN2 gene
Clone Products
- Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat
- VectorBuilder custom plasmid, inducible vectors for KREMEN2
- VectorBuilder custom lentivirus, adenovirus, AAV vector/virus packaging for KREMEN2
-
VectorBuilder Other custom vectors
- Mammalian expression: PiggyBac
- Mammalian Tet-on expression: plasmid
- Mammalian conditional (Cre-Lox): plasmid and PiggyBac
- Mammalian shRNA knockdown: lentiviral, adenoviral, AAV, and PiggyBac
- CRISPR: plasmid gRNA, lentiviral gRNA, and donor plasmid
- Bacterial expression: pET, pBAD, and pCS
- Yeast expression
| ExUns: | 1a | · | 1b | · | 1c | · | 1d | ^ | 2 | ^ | 3 | ^ | 4 | ^ | 5a | · | 5b | ^ | 6 | ^ | 7 | ^ | 8a | · | 8b | ^ | 9 |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| SP1: | - | - | - | ||||||||||||||||||||||||
| SP2: | - | - | |||||||||||||||||||||||||
| SP3: | |||||||||||||||||||||||||||
| SP4: |
Expression for KREMEN2 Gene
mRNA expression in embryonic tissues and stem cells from LifeMap Discovery
-
Tooth (Integumentary System)
- Dental Placode Cells Dental Placode
-
Epithelial Cells
- Dental Placode Cells Dental Placode
mRNA differential expression in normal tissues according to GTEx for KREMEN2 Gene
This gene is overexpressed in Skin - Not Sun Exposed (Suprapubic) (x9.4), Skin - Sun Exposed (Lower leg) (x7.5), and Esophagus - Mucosa (x4.1).
This gene is overexpressed in Peripheral blood mononuclear cells (69.0).
Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, PaxDb, and MOPED for KREMEN2 Gene
NURSA nuclear receptor signaling pathways regulating expression of KREMEN2 Gene:
KREMEN2SOURCE GeneReport for Unigene cluster for KREMEN2 Gene:
Hs.661128Evidence on tissue expression from TISSUES for KREMEN2 Gene
- Nervous system(4.1)
Primer Products
-
OriGene qPCR primer pairs for KREMEN2
No data available for mRNA Expression by UniProt/SwissProt and Phenotype-based relationships between genes and organs from Gene ORGANizer for KREMEN2 Gene
Orthologs for KREMEN2 Gene
This gene was present in the common ancestor of chordates.
| Organism | Taxonomy | Gene | Similarity | Type | Details |
|---|---|---|---|---|---|
| chimpanzee (Pan troglodytes) |
Mammalia | KREMEN2 35 |
|
OneToOne | |
| dog (Canis familiaris) |
Mammalia | KREMEN2 34 35 |
|
||
| rat (Rattus norvegicus) |
Mammalia | Kremen2 34 |
|
||
| mouse (Mus musculus) |
Mammalia | Kremen2 34 16 35 |
|
||
| platypus (Ornithorhynchus anatinus) |
Mammalia | KREMEN2 35 |
|
OneToOne | |
| cow (Bos Taurus) |
Mammalia | KREMEN2 35 |
|
OneToOne | |
| lizard (Anolis carolinensis) |
Reptilia | KREMEN2 35 |
|
OneToOne |
- Species where no ortholog for KREMEN2 was found in the sources mined by GeneCards:
-
- A. gosspyii yeast (Ashbya gossypii)
- Actinobacteria (Mycobacterium tuberculosis)
- African clawed frog (Xenopus laevis)
- African malaria mosquito (Anopheles gambiae)
- Alicante grape (Vitis vinifera)
- alpha proteobacteria (Wolbachia pipientis)
- amoeba (Dictyostelium discoideum)
- Archea (Pyrococcus horikoshii)
- baker's yeast (Saccharomyces cerevisiae)
- barley (Hordeum vulgare)
- beta proteobacteria (Neisseria meningitidis)
- bread mold (Neurospora crassa)
- chicken (Gallus gallus)
- Chromalveolata (Phytophthora infestans)
- common water flea (Daphnia pulex)
- corn (Zea mays)
- E. coli (Escherichia coli)
- filamentous fungi (Aspergillus nidulans)
- Firmicute bacteria (Streptococcus pneumoniae)
- fission yeast (Schizosaccharomyces pombe)
- fruit fly (Drosophila melanogaster)
- green algae (Chlamydomonas reinhardtii)
- honey bee (Apis mellifera)
- K. lactis yeast (Kluyveromyces lactis)
- loblloly pine (Pinus taeda)
- malaria parasite (Plasmodium falciparum)
- medicago trunc (Medicago Truncatula)
- moss (Physcomitrella patens)
- oppossum (Monodelphis domestica)
- orangutan (Pongo pygmaeus)
- pig (Sus scrofa)
- rainbow trout (Oncorhynchus mykiss)
- rice (Oryza sativa)
- rice blast fungus (Magnaporthe grisea)
- schistosome parasite (Schistosoma mansoni)
- sea anemone (Nematostella vectensis)
- sea squirt (Ciona intestinalis)
- sea squirt (Ciona savignyi)
- sea urchin (Strongylocentrotus purpuratus)
- sorghum (Sorghum bicolor)
- soybean (Glycine max)
- stem rust fungus (Puccinia graminis)
- sugarcane (Saccharum officinarum)
- thale cress (Arabidopsis thaliana)
- tomato (Lycopersicon esculentum)
- toxoplasmosis (Toxoplasma gondii)
- Trichoplax (Trichoplax adhaerens)
- tropical clawed frog (Silurana tropicalis)
- wheat (Triticum aestivum)
- worm (Caenorhabditis elegans)
- zebrafish (Danio rerio)
Paralogs for KREMEN2 Gene
Variants for KREMEN2 Gene
| SNP ID | Clin | Chr 16 pos | Sequence Context | AA Info | Type |
|---|---|---|---|---|---|
| rs1000264883 | -- | 2,964,731(+) | CTGAG(A/C)AGCCC | intron-variant | |
| rs1000291600 | -- | 2,964,296(+) | GACCC(A/G)GGTAG | utr-variant-5-prime | |
| rs1000556724 | -- | 2,968,821(+) | AGGCA(-/CGCCTTCAGAGGCCTGGGTACCGTGGAG)CGCCT | downstream-variant-500B, upstream-variant-2KB | |
| rs1000870267 | -- | 2,965,983(+) | TTCTG(C/T)GTAGA | intron-variant | |
| rs1001247656 | -- | 2,964,818(+) | CCCGG(C/T)GTGGG | intron-variant |
Gene Damage Index Score:
11.58;
93.06% of all genes are more intolerant (likely to be disease-causing)
Relevant External Links for KREMEN2 Gene
- SNPedia medical, phenotypic, and genealogical associations of SNPs for
- KREMEN2
No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for KREMEN2 Gene
Disorders for KREMEN2 Gene
Relevant External Links for KREMEN2
- Atlas of Genetics and Cytogenetics in Oncology and Haematology:
- KREMEN2
No disorders were found for KREMEN2 Gene.
No data available for MalaCards , UniProtKB/Swiss-Prot and Genatlas for KREMEN2 Gene
Publications for KREMEN2 Gene
- Complete sequencing and characterization of 21,243 full-length human cDNAs. (PMID: 14702039) Ota T. … Sugano S. (Nat. Genet. 2004) 3 4 64
- The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). (PMID: 15489334) Gerhard D.S. … Malek J. (Genome Res. 2004) 3 4 64
- Kremen proteins are Dickkopf receptors that regulate Wnt/beta-catenin signalling. (PMID: 12050670) Mao B. … Niehrs C. (Nature 2002) 2 3 64
- Differential expression of DKK-1 binding receptors on stromal cells and myeloma cells results in their distinct response to secreted DKK-1 in myeloma. (PMID: 20846389) Dun X. … Hou J. (Mol. Cancer 2010) 3 64
- A cell-based Dkk1 binding assay reveals roles for extracellular domains of LRP5 in Dkk1 interaction and highlights differences between wild-type and the high bone mass mutant LRP5(G171V). (PMID: 19746449) Murrills R.J. … Bodine P.V. (J. Cell. Biochem. 2009) 22 64
Products for KREMEN2 Gene
- R&D Systems Antibodies for KREMEN2 (Kremen-2)
- R&D Systems Proteins and Enzymes for KREMEN2 (Kremen-2)
- Browse R&D Systems for biochemical assays
- Browse Primary Antibodies
- Browse Proteins and Enzymes
- Browse ELISAs
- Browse Activity Assays
- Browse cDNA Clones
- Browse Cell Culture Products
- Browse Cell Selection and Detection Kits
- Browse DNA Damage and Repair Kits
- Browse ELISpot/FluoroSpot Kits and Development Modules
- Browse Flow Cytometry Kits
- Browse Immunoprecipitation Assays
- Browse Luminex Assays
- Browse Peptides
- Browse Proteome Profiler Antibody Arrays
- Browse Small Molecules
- Custom Antibody ServicesOriGene Antibodies for KREMEN2
- Browse OriGene ELISA Kits
- Custom Assay Services
- OriGene Purified Proteins for KREMEN2
- Search Origene for MassSpec and Protein Over-expression Lysates for KREMEN2
- Origene Custom Protein Services for KREMEN2
- Origene shRNA, siRNA, and RNAi products in human, mouse, rat for KREMEN2
- Browse OriGene Inhibitory RNA Products For KREMEN2
- OriGene qPCR primer pairs for KREMEN2
- OriGene CRISPR knockouts for KREMEN2
- OriGene ORF clones in human for KREMEN2
- Custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
- Browse OriGene miRNA Products For KREMEN2
- GenScript: Next-day shipping cDNA ORF clone for KREMEN2 in any vector
- GenScript Custom Purified and Recombinant Proteins Services for KREMEN2
- GenScript Custom Assay Services for KREMEN2
- GenScript Custom overexpressing Cell Line Services for KREMEN2
- GenScript: Design CRISPR guide RNA sequences for KREMEN2
- Design optimal peptide antigens
- CloneReady with Over 120,000 Genes
- Gene Synthesis: Any Gene in Any Vector
- Vector-based siRNA and miRNA, Ready for Transfection
- Gene Mutant Library, Variants up to 10^11
- Plasmid Preparation
- GenScript Custom Peptide Services for KREMEN2
- Browse Sino Biological cDNA Clones
- Browse Sino Biological Cell Lysates
- Browse Sino Biological Proteins
- Sino Biological Antibodies
- Sino Biological ELISA Kits and Pair Sets
- Sino Biological Cell Lysates
- Sino Biological qPCR Primers
- Sino Biological CRO Services for Proteins, Antibodies and Genes
- Sino Biological Transfection Reagents
- Novus Biologicals Antibodies for KREMEN2
- Novus Biologicals proteins and lysates for KREMEN2
- Novus Biologicals
- Novus Biologicals Tissue Microarrays
- Taconic Biosciences Mouse Models for KREMEN2
- Find your next knockout model in the Taconic Knockout Repository
- Genetically Engineered Models Available Immediately
- Humanized Mice
- Invitrogen Antibodies for KREMEN2
- Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat
- antibodies-online Antibodies for KREMEN2: See all 30
- Search antibodies-online for kits
- antibodies-online Proteins for KREMEN2: See all 7
- Search antibodies-online for peptides
- GeneTex KREMEN2 antibody for KREMEN2
- Search GeneTex for Proteins for KREMEN2
- ViGene Biosciences adenoviral particle packaged cDNA for KREMEN2 gene
- ViGene Biosciences lentiviral particle packaged cDNA for KREMEN2 gene
- ViGene Biosciences ready-to-package AAV shRNAs for KREMEN2 gene
- Search ViGene Biosciences for KREMEN2
- Custom Antibody ServicesProSci Antibodies for KREMEN2
- Search for KREMEN2 Proteins at ProSci
- Horizon Cell Lines for KREMEN2
- Cyagen custom Knockout/knockin (KOKI) mouse models for KREMEN2
- VectorBuilder custom plasmid, inducible vectors for KREMEN2
- VectorBuilder custom lentivirus, adenovirus, AAV vector/virus packaging for KREMEN2
- VectorBuilder Other custom vectors
- Mammalian expression: PiggyBac
- Mammalian Tet-on expression: plasmid
- Mammalian conditional (Cre-Lox): plasmid and PiggyBac
- Mammalian shRNA knockdown: lentiviral, adenoviral, AAV, and PiggyBac
- CRISPR: plasmid gRNA, lentiviral gRNA, and donor plasmid
- Bacterial expression: pET, pBAD, and pCS
- Yeast expression
Sources for KREMEN2 Gene
- (1) GeneCards
- (2) HGNC
- (3) EntrezGene
- (4) Swiss-Prot
- (5) Ensembl
- (6) OMIM
- (7) GeneLoc
- (8) Gene Wiki
- (9) UCSC
- (10) PhosphoSitePlus
- (11) GO
- (12) TrEMBL
- (13) InterPro
- (14) ProtoNet
- (15) Blocks
- (16) MGI
- (17) IUBMB
- (18) KEGG
- (19) MINT
- (20) STRING
- (21) IntAct
- (22) Novoseek
- (23) PharmGKB
- (24) DrugBank
- (25) HMDB
- (26) UniGene
- (27) AceView
- (28) RNAdb
- (29) ASD
- (30) ECgene
- (31) GeneAnnot
- (32) CGAP SAGE
- (33) SOURCE
- (34) HomoloGene
- (35) PanEnsembl
- (36) euGenes
- (37) SGD
- (38) FlyBase
- (39) WormBase
- (40) Pseudogene
- (41) DGV
- (42) dbSNP
- (43) GenAtlas
- (44) GeneTests
- (45) HGMD
- (46) GAD
- (47) LSDB
- (48) BGMUT
- (49) HuGE
- (50) eBioscience
- (51) Atlas
- (52) Cell Signaling Technology
- (53) GenBank
- (54) H-invDB
- (55) HORDE
- (56) HUGE
- (57) IMGT
- (58) Leiden
- (59) MILLIPORE
- (60) miRBase
- (61) DME
- (62) NCBI
- (63) OriGene
- (64) PubMed
- (65) R&D Systems
- (66) TGDB
- (67) Tocris
- (68) Abcam
- (69) Novus
- (70) ProSpec
- (71) Sino Biological
- (72) GenScript
- (73) Qiagen
- (74) Cloud-Clone Corp.
- (75) Enzo Life Sciences
- (76) OCA
- (77) Proteopedia
- (78) MOPED
- (79) SPIRE
- (80) neXtProt
- (81) Reactome
- (82) GeneGo (Thomson Reuters)
- (83) fRNAdb
- (84) DISEASES
- (85) SIMAP
- (86) GenomeRNAi
- (87) LifeMap
- (88) miRTarBase
- (89) MalaCards
- (90) Invitrogen
- (91) BitterDB
- (92) Vector BioLabs
- (93) ESI-BIO
- (94) RefSeq
- (95) BioSystems
- (96) MaxQB
- (97) IUPHAR
- (98) BioGPS
- (99) Illumina
- (100) COMPARTMENTS
- (101) HOMER
- (102) PaxDb
- (103) ApexBio
- (104) Addgene
- (105) antibodies-online
- (106) CYP
- (107) NONCODE
- (108) SwitchGear Genomics
- (109) TreeFam
- (110) PathCards
- (111) GeneReviews
- (112) GeneTex
- (113) Taconic Biosciences
- (114) GTEx
- (115) ProteomicsDB
- (116) SCBT
- (117) DGIdb
- (118) ClinicalTrials
- (119) FDA Approved Drugs
- (120) RVIS
- (121) SIGNOR
- (122) diseasecard
- (123) NIH Rare Diseases
- (124) Orphanet
- (125) UMLS
- (126) GTR
- (127) Disease Ontology
- (128) Genetics Home Reference
- (129) MeSH
- (130) MedlinePlus
- (131) CDC
- (132) NINDS
- (133) NCBI Bookshelf
- (134) ClinVar
- (135) Gene Damage Index
- (136) ViGene Biosciences
- (137) HPO
- (138) UDN
- (139) VISTA
- (140) FANTOM5
- (141) ENCODE
- (142) ProSci
- (143) Horizon
- (144) NURSA
- (145) IID
- (146) Cyagen
- (147) VectorBuilder
- (148) SNPedia
- (149) BRCA Exchange
- (150) St John's Lab
- (151) CIViC
- (152) ProteoGenix
- (153) dbSUPER
- (154) TISSUES
- (155) Gene ORGANizer