Free for academic non-profit institutions. Other users need a Commercial license

Aliases for KLRB1 Gene

Aliases for KLRB1 Gene

  • Killer Cell Lectin Like Receptor B1 2 3 5
  • Natural Killer Cell Surface Protein P1A 2 3 4
  • Killer Cell Lectin-Like Receptor Subfamily B, Member 1 2 3
  • C-Type Lectin Domain Family 5 Member B 3 4
  • HNKR-P1A 3 4
  • NKR-P1A 3 4
  • CLEC5B 3 4
  • NKRP1A 3 4
  • Killer Cell Lectin-Like Receptor Subfamily B Member 1 3
  • CD161 Antigen 4
  • NKR-P1 3
  • CD161 3
  • NKR 3

External Ids for KLRB1 Gene

Previous HGNC Symbols for KLRB1 Gene

  • NKR

Previous GeneCards Identifiers for KLRB1 Gene

  • GC12M009430
  • GC12M009870
  • GC12M009647
  • GC12M009638
  • GC12M009490
  • GC12M009748
  • GC12M009837
  • GC12M010061
  • GC12M010255
  • GC12M010497
  • GC12M009809
  • GC12M010163
  • GC12M010758
  • GC12M010990

Summaries for KLRB1 Gene

Entrez Gene Summary for KLRB1 Gene

  • Natural killer (NK) cells are lymphocytes that mediate cytotoxicity and secrete cytokines after immune stimulation. Several genes of the C-type lectin superfamily, including the rodent NKRP1 family of glycoproteins, are expressed by NK cells and may be involved in the regulation of NK cell function. The KLRB1 protein contains an extracellular domain with several motifs characteristic of C-type lectins, a transmembrane domain, and a cytoplasmic domain. The KLRB1 protein is classified as a type II membrane protein because it has an external C terminus. [provided by RefSeq, Jul 2008]

GeneCards Summary for KLRB1 Gene

KLRB1 (Killer Cell Lectin Like Receptor B1) is a Protein Coding gene. Diseases associated with KLRB1 include Cytomegalovirus Infection. Among its related pathways are Immunoregulatory interactions between a Lymphoid and a non-Lymphoid cell and Immune System. GO annotations related to this gene include transmembrane signaling receptor activity and carbohydrate binding. An important paralog of this gene is KLRF1.

UniProtKB/Swiss-Prot for KLRB1 Gene

  • Plays an inhibitory role on natural killer (NK) cells cytotoxicity. Activation results in specific acid sphingomyelinase/SMPD1 stimulation with subsequent marked elevation of intracellular ceramide. Activation also leads to AKT1/PKB and RPS6KA1/RSK1 kinases stimulation as well as markedly enhanced T-cell proliferation induced by anti-CD3. Acts as a lectin that binds to the terminal carbohydrate Gal-alpha(1,3)Gal epitope as well as to the N-acetyllactosamine epitope. Binds also to CLEC2D/LLT1 as a ligand and inhibits NK cell-mediated cytotoxicity as well as interferon-gamma secretion in target cells.

Gene Wiki entry for KLRB1 Gene

No data available for Tocris Summary , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for KLRB1 Gene

Genomics for KLRB1 Gene

Regulatory Elements for KLRB1 Gene

Enhancers for KLRB1 Gene
GeneHancer Identifier Enhancer Score Enhancer Sources Gene-Enhancer Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor Binding Sites within enhancer Gene Targets for Enhancer
GH12F009646 1.5 FANTOM5 ENCODE 17.7 -43.8 -43833 10.0 HDGF PKNOX1 MLX ARID4B SIN3A DMAP1 SLC30A9 CBX5 SP3 SP5 CLEC2D LOC374443 KLRB1 CLECL1 CLEC12A ENSG00000214776 PHC1 CD69 CLEC7A DDX12P
GH12F009614 1.1 FANTOM5 Ensembl ENCODE 23 -8.6 -8608 3.3 PKNOX1 MTA2 SCRT2 NBN TBX21 MAFK SPI1 CLEC2D KLRB1 KLRF1 ENSG00000214776 ENSG00000257027 CD69 CLECL1 LOC374443 CLEC2B
GH12F009736 1.6 FANTOM5 Ensembl ENCODE 15.4 -132.1 -132122 7.6 PKNOX1 GATA2 CBX5 ZNF143 JUNB TBX21 MEF2D SMARCA4 HMBOX1 STAT3 CLECL1 CLEC2D KLRB1 ENSG00000213443 ENSG00000214776 CD69 CLEC7A ENSG00000257027 CLEC2B KLRF1
GH12F009720 1.5 FANTOM5 Ensembl ENCODE 13.4 -119.3 -119278 13.2 TBP PKNOX1 BMI1 CBX5 FOS SMAD5 CEBPB JUNB TBX21 PBX2 CLECL1 KLRB1 ENSG00000213443 ENSG00000257027 OLR1 CLEC12A CD69 CLEC7A LOC101930452 LOC374443
GH12F009701 1.1 FANTOM5 Ensembl ENCODE 14.4 -94.6 -94630 2.3 ZFHX2 ZFP64 ZNF781 ZNF518A EGR2 CLECL1 CLEC2D KLRB1 ENSG00000213443 PHC1 ENSG00000257027 LOC374443 DDX12P CD69 CLEC2B
- Elite enhancer and/or Elite enhancer-gene association Download GeneHancer data dump

Enhancers around KLRB1 on UCSC Golden Path with GeneCards custom track

Genomic Location for KLRB1 Gene

Chromosome:
12
Start:
9,594,551 bp from pter
End:
9,607,901 bp from pter
Size:
13,351 bases
Orientation:
Minus strand

Genomic View for KLRB1 Gene

Genes around KLRB1 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
KLRB1 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for KLRB1 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for KLRB1 Gene

Proteins for KLRB1 Gene

  • Protein details for KLRB1 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Q12918-KLRB1_HUMAN
    Recommended name:
    Killer cell lectin-like receptor subfamily B member 1
    Protein Accession:
    Q12918
    Secondary Accessions:
    • Q24K24

    Protein attributes for KLRB1 Gene

    Size:
    225 amino acids
    Molecular mass:
    25415 Da
    Quaternary structure:
    • Homodimer; disulfide-linked. Interacts with acid sphingomyelinase/SMPD1.

neXtProt entry for KLRB1 Gene

Post-translational modifications for KLRB1 Gene

Other Protein References for KLRB1 Gene

ENSEMBL proteins:
REFSEQ proteins:

Antibody Products

  • Cloud-Clone Corp. Antibodies for KLRB1

No data available for DME Specific Peptides for KLRB1 Gene

Domains & Families for KLRB1 Gene

Protein Domains for KLRB1 Gene

Suggested Antigen Peptide Sequences for KLRB1 Gene

GenScript: Design optimal peptide antigens:

Graphical View of Domain Structure for InterPro Entry

Q12918

UniProtKB/Swiss-Prot:

KLRB1_HUMAN :
  • Contains 1 C-type lectin domain.
Domain:
  • Contains 1 C-type lectin domain.
genes like me logo Genes that share domains with KLRB1: view

Function for KLRB1 Gene

Molecular function for KLRB1 Gene

GENATLAS Biochemistry:
natural killer cell lectin-like receptor subfamily B,member 1
UniProtKB/Swiss-Prot Function:
Plays an inhibitory role on natural killer (NK) cells cytotoxicity. Activation results in specific acid sphingomyelinase/SMPD1 stimulation with subsequent marked elevation of intracellular ceramide. Activation also leads to AKT1/PKB and RPS6KA1/RSK1 kinases stimulation as well as markedly enhanced T-cell proliferation induced by anti-CD3. Acts as a lectin that binds to the terminal carbohydrate Gal-alpha(1,3)Gal epitope as well as to the N-acetyllactosamine epitope. Binds also to CLEC2D/LLT1 as a ligand and inhibits NK cell-mediated cytotoxicity as well as interferon-gamma secretion in target cells.
UniProtKB/Swiss-Prot Induction:
By IL12/interleukin-12 in NK cells.

Gene Ontology (GO) - Molecular Function for KLRB1 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0004888 transmembrane signaling receptor activity TAS 8077657
GO:0030246 carbohydrate binding IEA,TAS --
genes like me logo Genes that share ontologies with KLRB1: view
genes like me logo Genes that share phenotypes with KLRB1: view

Animal Models for KLRB1 Gene

MGI Knock Outs for KLRB1:

Animal Model Products

  • Taconic Biosciences Mouse Models for KLRB1

miRNA for KLRB1 Gene

miRTarBase miRNAs that target KLRB1

Inhibitory RNA Products

Clone Products

Flow Cytometry Products

No data available for Enzyme Numbers (IUBMB) , Human Phenotype Ontology , Transcription Factor Targets and HOMER Transcription for KLRB1 Gene

Localization for KLRB1 Gene

Subcellular locations from UniProtKB/Swiss-Prot for KLRB1 Gene

Membrane; Single-pass type II membrane protein.

Subcellular locations from

COMPARTMENTS
Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for KLRB1 gene
Compartment Confidence
plasma membrane 5
extracellular 2
nucleus 2
cytosol 2

Gene Ontology (GO) - Cellular Components for KLRB1 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005886 plasma membrane TAS --
GO:0016020 membrane IEA --
GO:0016021 integral component of membrane IEA --
genes like me logo Genes that share ontologies with KLRB1: view

Pathways & Interactions for KLRB1 Gene

genes like me logo Genes that share pathways with KLRB1: view

Interacting Proteins for KLRB1 Gene

Gene Ontology (GO) - Biological Process for KLRB1 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0007166 cell surface receptor signaling pathway TAS 8077657
GO:0050776 regulation of immune response TAS --
genes like me logo Genes that share ontologies with KLRB1: view

No data available for SIGNOR curated interactions for KLRB1 Gene

Drugs & Compounds for KLRB1 Gene

(2) Drugs for KLRB1 Gene - From: Novoseek

Name Status Disease Links Group Role Mechanism of Action Clinical Trials

(83) Additional Compounds for KLRB1 Gene - From: HMDB and Novoseek

Name Synonyms Role CAS Number PubChem IDs PubMed IDs
3-O-Sulfogalactosylceramide (d18:1/12:0)
  • 3'-O-Sulphogalactosylceramide
  • 3-O-Sulfo-beta-D-galactosylceramide
  • 3-O-Sulfo-beta-delta-galactosylceramide
  • 3-O-Sulfogalactosylceramide
  • Cerebroside 3-sulfate
852100-88-0
3-O-Sulfogalactosylceramide (d18:1/14:0)
  • 3'-O-Sulphogalactosylceramide
  • 3-O-Sulfo-beta-D-galactosylceramide
  • 3-O-Sulfo-beta-delta-galactosylceramide
  • 3-O-Sulfogalactosylceramide
  • Cerebroside 3-sulfate
3-O-Sulfogalactosylceramide (d18:1/16:0)
  • 3'-O-Sulphogalactosylceramide
  • 3-O-Sulfo-beta-D-galactosylceramide
  • 3-O-Sulfo-beta-delta-galactosylceramide
  • 3-O-Sulfogalactosylceramide
  • Cerebroside 3-sulfate
862509-48-6
3-O-Sulfogalactosylceramide (d18:1/18:0)
  • 3'-O-Sulphogalactosylceramide
  • 3-O-Sulfo-beta-D-galactosylceramide
  • 3-O-Sulfo-beta-delta-galactosylceramide
  • 3-O-Sulfogalactosylceramide
  • Cerebroside 3-sulfate
244215-65-4
3-O-Sulfogalactosylceramide (d18:1/18:1(9Z))
  • 3'-O-Sulphogalactosylceramide
  • 3-O-Sulfo-beta-D-galactosylceramide
  • 3-O-Sulfo-beta-delta-galactosylceramide
  • 3-O-Sulfogalactosylceramide
  • Cerebroside 3-sulfate
genes like me logo Genes that share compounds with KLRB1: view

Transcripts for KLRB1 Gene

mRNA/cDNA for KLRB1 Gene

(1) REFSEQ mRNAs :
(5) Additional mRNA sequences :
(32) Selected AceView cDNA sequences:
(1) Ensembl transcripts including schematic representations, and UCSC links where relevant :

Unigene Clusters for KLRB1 Gene

Killer cell lectin-like receptor subfamily B, member 1:
Representative Sequences:

Inhibitory RNA Products

Clone Products

Flow Cytometry Products

Alternative Splicing Database (ASD) splice patterns (SP) for KLRB1 Gene

No ASD Table

Relevant External Links for KLRB1 Gene

GeneLoc Exon Structure for
KLRB1
ECgene alternative splicing isoforms for
KLRB1

Expression for KLRB1 Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and SAGE for KLRB1 Gene

mRNA expression in embryonic tissues and stem cells from LifeMap Discovery

mRNA differential expression in normal tissues according to GTEx for KLRB1 Gene

This gene is overexpressed in Whole Blood (x23.4), Spleen (x8.3), and Small Intestine - Terminal Ileum (x4.0).

Protein differential expression in normal tissues from HIPED for KLRB1 Gene

This gene is overexpressed in NK cells (47.2) and Spleen (21.8).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, PaxDb, and MOPED for KLRB1 Gene



Protein tissue co-expression partners for KLRB1 Gene

- Elite partner

NURSA nuclear receptor signaling pathways regulating expression of KLRB1 Gene:

KLRB1

SOURCE GeneReport for Unigene cluster for KLRB1 Gene:

Hs.169824

mRNA Expression by UniProt/SwissProt for KLRB1 Gene:

Q12918-KLRB1_HUMAN
Tissue specificity: Expressed in a subset of NK cells predominantly in intestinal epithelium and liver. Detected in peripheral blood T-cells and preferentially in adult T-cells with a memory antigenic phenotype.
genes like me logo Genes that share expression patterns with KLRB1: view

Primer Products

Orthologs for KLRB1 Gene

This gene was present in the common ancestor of chordates.

Orthologs for KLRB1 Gene

Organism Taxonomy Gene Similarity Type Details
chimpanzee
(Pan troglodytes)
Mammalia KLRB1 34 35
  • 99.26 (n)
dog
(Canis familiaris)
Mammalia KLRB1 34 35
  • 76.92 (n)
cow
(Bos Taurus)
Mammalia KLRB1 34 35
  • 76.47 (n)
rat
(Rattus norvegicus)
Mammalia Klrb1a 34
  • 67.57 (n)
mouse
(Mus musculus)
Mammalia Klrb1a 34 35
  • 66.36 (n)
Klrb1 35
  • 49 (a)
OneToMany
Klrb1f 35
  • 46 (a)
OneToMany
Klrb1b 35
  • 44 (a)
OneToMany
Klrb1c 16 35
  • 38 (a)
lizard
(Anolis carolinensis)
Reptilia -- 35
  • 26 (a)
OneToMany
-- 35
  • 26 (a)
OneToMany
-- 35
  • 25 (a)
OneToMany
Species where no ortholog for KLRB1 was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • chicken (Gallus gallus)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • fruit fly (Drosophila melanogaster)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • oppossum (Monodelphis domestica)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • platypus (Ornithorhynchus anatinus)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea squirt (Ciona intestinalis)
  • sea squirt (Ciona savignyi)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • tropical clawed frog (Silurana tropicalis)
  • wheat (Triticum aestivum)
  • worm (Caenorhabditis elegans)
  • zebrafish (Danio rerio)

Evolution for KLRB1 Gene

ENSEMBL:
Gene Tree for KLRB1 (if available)
TreeFam:
Gene Tree for KLRB1 (if available)

Paralogs for KLRB1 Gene

Paralogs for KLRB1 Gene

(1) SIMAP similar genes for KLRB1 Gene using alignment to 1 proteins:

genes like me logo Genes that share paralogs with KLRB1: view

Variants for KLRB1 Gene

Sequence variations from dbSNP and Humsavar for KLRB1 Gene

SNP ID Clin Chr 12 pos Sequence Context AA Info Type
rs10581166 -- 9,606,762(+) TATAT(A/T)TTTTT intron-variant
rs10667765 -- 9,606,648(+) ATATA(-/TA/TATATATATATATATAAAATATATAAAATATATGTATAAAAAGTA)AAATA intron-variant
rs10732550 -- 9,600,061(+) CACAG(C/G)CATTA intron-variant
rs10734802 -- 9,598,369(+) ATCCA(C/T)GTAGT intron-variant
rs10743785 -- 9,603,581(+) CACCA(C/T)GCCCG intron-variant, upstream-variant-2KB

Structural Variations from Database of Genomic Variants (DGV) for KLRB1 Gene

Variant ID Type Subtype PubMed ID
nsv8909 CNV gain 18304495
nsv603 CNV insertion 18451855
nsv602 CNV deletion 18451855
nsv428271 CNV gain 18775914
nsv1051530 CNV gain 25217958
esv3628511 CNV gain 21293372
esv3628510 CNV loss 21293372
esv3628509 CNV loss 21293372
esv3303085 CNV tandem duplication 20981092
esv2759878 CNV gain+loss 17122850

Variation tolerance for KLRB1 Gene

Residual Variation Intolerance Score: 79% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 13.01; 94.99% of all genes are more intolerant (likely to be disease-causing)

Relevant External Links for KLRB1 Gene

Human Gene Mutation Database (HGMD)
KLRB1
SNPedia medical, phenotypic, and genealogical associations of SNPs for
KLRB1

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for KLRB1 Gene

Disorders for KLRB1 Gene

MalaCards: The human disease database

(1) MalaCards diseases for KLRB1 Gene - From: GeneCards

Disorder Aliases PubMed IDs
cytomegalovirus infection
  • cytomegalovirus infections
- elite association - COSMIC cancer census association via MalaCards
Search KLRB1 in MalaCards View complete list of genes associated with diseases

Relevant External Links for KLRB1

Genetic Association Database (GAD)
KLRB1
Human Genome Epidemiology (HuGE) Navigator
KLRB1
Atlas of Genetics and Cytogenetics in Oncology and Haematology:
KLRB1
genes like me logo Genes that share disorders with KLRB1: view

No data available for UniProtKB/Swiss-Prot and Genatlas for KLRB1 Gene

Publications for KLRB1 Gene

  1. Human NKR-P1A: a disulfide-linked homodimer of the C-type lectin superfamily expressed by a subset of NK and T lymphocytes. (PMID: 8077657) Lanier L.L. … Phillips J.H. (J. Immunol. 1994) 2 3 4 22 64
  2. Recognition of a carbohydrate xenoepitope by human NKRP1A (CD161). (PMID: 16925668) Christiansen D. … Sandrin M.S. (Xenotransplantation 2006) 3 4 22 64
  3. Lectin-like transcript 1 is a ligand for the CD161 receptor. (PMID: 16339512) Aldemir H. … Braud V.M. (J. Immunol. 2005) 3 4 22 64
  4. IL-12-induced up-regulation of NKRP1A expression in human NK cells and consequent NKRP1A-mediated down-regulation of NK cell activation. (PMID: 9603467) Poggi A. … Moretta L. (Eur. J. Immunol. 1998) 3 4 22 64
  5. Risk alleles for multiple sclerosis in multiplex families. (PMID: 19506219) D'Netto M.J. … Ebers G.C. (Neurology 2009) 3 46 64

Products for KLRB1 Gene

Sources for KLRB1 Gene

Content
Loading form....