Free for academic non-profit institutions. Other users need a Commercial license

Aliases for KIR3DX1 Gene

Aliases for KIR3DX1 Gene

  • Killer Cell Immunoglobulin-Like Receptor, Three Domains, X1 2 3
  • Leukocyte Receptor Cluster (LRC) Member 12 2 3
  • KIR3DL0 3 4
  • LENG12 3 4
  • Immunoglobulin-Like Receptor KIR3DL0 3
  • Leukocyte Receptor Cluster Member 12 4

External Ids for KIR3DX1 Gene

Previous HGNC Symbols for KIR3DX1 Gene

  • LENG12

Previous GeneCards Identifiers for KIR3DX1 Gene

  • GC19P059740
  • GC19P055044
  • GC19P051367

Summaries for KIR3DX1 Gene

GeneCards Summary for KIR3DX1 Gene

KIR3DX1 (Killer Cell Immunoglobulin-Like Receptor, Three Domains, X1) is a Pseudogene. An important paralog of this gene is KIR2DL4.

No data available for Entrez Gene Summary , UniProtKB/Swiss-Prot , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for KIR3DX1 Gene

Genomics for KIR3DX1 Gene

Regulatory Elements for KIR3DX1 Gene

Genomic Location for KIR3DX1 Gene

54,532,692 bp from pter
54,545,771 bp from pter
13,080 bases
Plus strand

Genomic View for KIR3DX1 Gene

UCSC Golden Path with GeneCards custom track
Cytogenetic band:
Genomic Location for KIR3DX1 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for KIR3DX1 Gene

Proteins for KIR3DX1 Gene

  • Protein details for KIR3DX1 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Recommended name:
    Putative killer cell immunoglobulin-like receptor-like protein KIR3DX1
    Protein Accession:
    Secondary Accessions:
    • B7WNL0
    • Q8N0S4

    Protein attributes for KIR3DX1 Gene

    352 amino acids
    Molecular mass:
    38777 Da
    Quaternary structure:
    No Data Available
    • Sequence=BAB15757.1; Type=Miscellaneous discrepancy; Note=Unlikely isoform. Aberrant splice sites and probable target of nonsense-mediated mRNA decay.; Evidence={ECO:0000305};

neXtProt entry for KIR3DX1 Gene

Proteomics data for KIR3DX1 Gene at MOPED

Post-translational modifications for KIR3DX1 Gene

  • Glycosylation at Asn 78
  • Modification sites at PhosphoSitePlus

Other Protein References for KIR3DX1 Gene

No data available for DME Specific Peptides for KIR3DX1 Gene

Domains & Families for KIR3DX1 Gene

Gene Families for KIR3DX1 Gene

Protein Domains for KIR3DX1 Gene


Suggested Antigen Peptide Sequences for KIR3DX1 Gene

GenScript: Design optimal peptide antigens:

Graphical View of Domain Structure for InterPro Entry



  • Contains 2 Ig-like C2-type (immunoglobulin-like) domains.
  • Contains 2 Ig-like C2-type (immunoglobulin-like) domains.
genes like me logo Genes that share domains with KIR3DX1: view

Function for KIR3DX1 Gene

Gene Ontology (GO) - Molecular Function for KIR3DX1 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005515 protein binding --
genes like me logo Genes that share ontologies with KIR3DX1: view

Phenotypes for KIR3DX1 Gene

genes like me logo Genes that share phenotypes with KIR3DX1: view

No data available for Molecular function , Enzyme Numbers (IUBMB) , Animal Models , Transcription Factor Targets and HOMER Transcription for KIR3DX1 Gene

Localization for KIR3DX1 Gene

Subcellular locations from UniProtKB/Swiss-Prot for KIR3DX1 Gene


Subcellular locations from

Jensen Localization Image for KIR3DX1 Gene COMPARTMENTS Subcellular localization image for KIR3DX1 gene
Compartment Confidence
extracellular 3

Gene Ontology (GO) - Cellular Components for KIR3DX1 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005576 extracellular region IEA --
genes like me logo Genes that share ontologies with KIR3DX1: view

Pathways & Interactions for KIR3DX1 Gene

SuperPathways for KIR3DX1 Gene

No Data Available

Interacting Proteins for KIR3DX1 Gene

Gene Ontology (GO) - Biological Process for KIR3DX1 Gene


No data available for Pathways by source and SIGNOR curated interactions for KIR3DX1 Gene

Drugs & Compounds for KIR3DX1 Gene

No Compound Related Data Available

Transcripts for KIR3DX1 Gene

mRNA/cDNA for KIR3DX1 Gene

(2) REFSEQ mRNAs :
(8) Additional mRNA sequences :
(5) Selected AceView cDNA sequences:
(8) Ensembl transcripts including schematic representations, and UCSC links where relevant :

Unigene Clusters for KIR3DX1 Gene

Killer cell immunoglobulin-like receptor, three domains, X1:
Representative Sequences:

Alternative Splicing Database (ASD) splice patterns (SP) for KIR3DX1 Gene

No ASD Table

Relevant External Links for KIR3DX1 Gene

GeneLoc Exon Structure for
ECgene alternative splicing isoforms for

Expression for KIR3DX1 Gene

mRNA expression in normal human tissues for KIR3DX1 Gene

mRNA differential expression in normal tissues according to GTEx for KIR3DX1 Gene

This gene is overexpressed in Whole Blood (x26.9).

SOURCE GeneReport for Unigene cluster for KIR3DX1 Gene Hs.288520

mRNA Expression by UniProt/SwissProt for KIR3DX1 Gene

Tissue specificity: Expressed in NK-cells.
genes like me logo Genes that share expression patterns with KIR3DX1: view

Primer Products

  • QuantiTect SYBR Green Assays in human,mouse,rat
  • Pre-validated RT² qPCR Primer Assay in human,mouse,rat
  • QuantiFast Probe-based Assays in human,mouse,rat

In Situ Assay Products

No data available for mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , Protein differential expression in normal tissues , Protein expression and Protein tissue co-expression partners for KIR3DX1 Gene

Orthologs for KIR3DX1 Gene

This gene was present in the common ancestor of chordates.

Orthologs for KIR3DX1 Gene

Organism Taxonomy Gene Similarity Type Details
(Bos Taurus)
Mammalia -- 36
  • 32 (a)
-- 36
  • 33 (a)
-- 36
  • 36 (a)
-- 36
  • 34 (a)
-- 36
  • 37 (a)
-- 36
  • 43 (a)
-- 36
  • 38 (a)
-- 36
  • 36 (a)
-- 36
  • 43 (a)
KIR2DS1 36
  • 37 (a)
KIR3DL1 36
  • 39 (a)
(Canis familiaris)
Mammalia -- 36
  • 25 (a)
(Monodelphis domestica)
Mammalia -- 36
  • 30 (a)
(Ornithorhynchus anatinus)
Mammalia -- 36
  • 15 (a)
-- 36
  • 12 (a)
(Pan troglodytes)
Mammalia KIR3DX1 36
  • 66 (a)
(Anolis carolinensis)
Reptilia -- 36
  • 14 (a)
Species with no ortholog for KIR3DX1:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • chicken (Gallus gallus)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • fruit fly (Drosophila melanogaster)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • mouse (Mus musculus)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rat (Rattus norvegicus)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea squirt (Ciona intestinalis)
  • sea squirt (Ciona savignyi)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • tropical clawed frog (Silurana tropicalis)
  • wheat (Triticum aestivum)
  • worm (Caenorhabditis elegans)
  • zebrafish (Danio rerio)

Evolution for KIR3DX1 Gene

Gene Tree for KIR3DX1 (if available)
Gene Tree for KIR3DX1 (if available)

Paralogs for KIR3DX1 Gene

genes like me logo Genes that share paralogs with KIR3DX1: view

Variants for KIR3DX1 Gene

Sequence variations from dbSNP and Humsavar for KIR3DX1 Gene

SNP ID Clin Chr 19 pos Sequence Context AA Info Type MAF
rs10553990 -- 1(+) ATTTT(-/TC)TCTCT intron-variant
rs11363725 -- 1(+) TTTTT(-/T)GAGAT intron-variant
rs55837810 -- 1(+) CTCCC(C/T)CACAA nc-transcript-variant
rs58287783 -- 1(+) AACTT(A/T)AGAAG nc-transcript-variant
rs61552288 -- 1(+) TCCCC(-/CACAACTTTAGAAGGTACTTTGTAATATTC)TCCCC splice-donor-variant

Structural Variations from Database of Genomic Variants (DGV) for KIR3DX1 Gene

Variant ID Type Subtype PubMed ID
dgv1119e1 CNV Complex 17122850
esv2667609 CNV Deletion 23128226
esv2718872 CNV Deletion 23290073
dgv4005n71 CNV Loss 21882294
nsv522872 CNV Loss 19592680
dgv435n27 CNV Loss 19166990
nsv470158 CNV Loss 18288195
nsv518262 CNV Gain 19592680
nsv828638 CNV Loss 20364138

Variation tolerance for KIR3DX1 Gene

Gene Damage Index Score: 3.19; 52.04% of all genes are more intolerant (likely to be disease-causing)

Relevant External Links for KIR3DX1 Gene

HapMap Linkage Disequilibrium report

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for KIR3DX1 Gene

Disorders for KIR3DX1 Gene

Relevant External Links for KIR3DX1

Human Genome Epidemiology (HuGE) Navigator
Atlas of Genetics and Cytogenetics in Oncology and Haematology:
genes like me logo Genes that share disorders with KIR3DX1: view

No data available for MalaCards , UniProtKB/Swiss-Prot and Genatlas for KIR3DX1 Gene

Publications for KIR3DX1 Gene

  1. Human chromosome 19 and related regions in mouse: conservative and lineage-specific evolution. (PMID: 11441184) Dehal P. … Stubbs L. (Science 2001) 2 67
  2. A proteome-scale map of the human interactome network. (PMID: 25416956) Rolland T. … Vidal M. (Cell 2014) 67
  3. New genetic associations detected in a host response study to hepatitis B vaccine. (PMID: 20237496) Davila S. … Seielstad M. (Genes Immun. 2010) 67
  4. Expanding the substantial interactome of NEMO using protein microarrays. (PMID: 20098747) Fenner B.J. … Prehn J.H. (PLoS ONE 2010) 67
  5. Dynamics of cullin-RING ubiquitin ligase network revealed by systematic quantitative proteomics. (PMID: 21145461) Bennett E.J. … Harper J.W. (Cell 2010) 67

Products for KIR3DX1 Gene

Sources for KIR3DX1 Gene

Back to Top
