Set Analyses:
Advanced Search

Advanced Search

 
Search By
Section (entire)
for


 



KIAA1549 Gene

protein-coding   GIFtS: 49
GCID: GC07M138516

KIAA1549

  See KIAA1549-related diseases
at  

(According to 1HGNC, 2Entrez Gene,
3UniProtKB/Swiss-Prot, 4UniProtKB/TrEMBL, 5OMIM, 6GeneLoc, 7Ensembl, 8DME, 9miRBase, 10fRNAdb, 12H-InvDB, 13NCBI, 14NONCODE, and/or 15RNAdb)
About This Section

TryGeneCards Plus

Aliases
KIAA15491 2
UPF0606 Protein KIAA15492

External Ids:    HGNC: 222191   Entrez Gene: 576702   Ensembl: ENSG000001227787   OMIM: 6133445   UniProtKB: Q9HCM33   

Export aliases for KIAA1549 gene to outside databases

Previous GC identifers: GC07M136862 GC07M137922 GC07M137936 GC07M137979 GC07M138172 GC07M138166 GC07M132827


(According to Entrez Gene, GeneCards, Tocris Bioscience, Wikipedia's Gene Wiki, PharmGKB,
UniProtKB/Swiss-Prot, and/or UniProtKB/TrEMBL)
About This Section

TryGeneCards Plus

Entrez Gene summary for KIAA1549 Gene:
The protein encoded by this gene belongs to the UPF0606 family. This gene has been found to be fused to the BRAF
oncogene in many cases of pilocytic astrocytoma. The fusion results from 2Mb tandem duplications at 7q34.
Alternative splicing results in multiple transcript variants. (provided by RefSeq, Oct 2012)

GeneCards Summary for KIAA1549 Gene:
KIAA1549 (KIAA1549) is a protein-coding gene. Diseases associated with KIAA1549 include pilocytic astrocytoma, and astrocytoma. An important paralog of this gene is KIAA1549L.




(According to GeneLoc and/or HGNC, and/or
Entrez Gene (NCBI build 37),
and/or miRBase,
Genomic Views according to UCSC (hg19) and Ensembl (release 75), Regulatory elements and Epigenetics data according to QIAGEN, and/or SwitchGear Genomics)
About This Section

TryGeneCards Plus
RefSeq DNA sequence at NCBI GenBank:
NC_000007.13  NT_007933.16  NC_018918.2  
Regulatory elements:
   Regulatory transcription factor binding sites in the KIAA1549 gene promoter:
         c-Fos   AP-1   Bach2   Fra-1   FosB   Tal-1beta   E47   Ik-2   ZIC2/Zic2   c-Jun   
         Other transcription factors

Browse SwitchGear Promoter luciferase reporter plasmids
   Search Chromatin IP Primers for KIAA1549

Epigenetics:
DNA Methylation CpG Assay Predesigned for Pyrosequencing in human, mouse, rat KIAA1549


Genomic Location:
Genomic View: UCSC Golden Path with GeneCards custom track

Entrez Gene cytogenetic band: 7q34   Ensembl cytogenetic band:  7q34   HGNC cytogenetic band: 7q34

KIAA1549 Gene in genomic location: bands according to Ensembl, locations according to (and/or Entrez Gene and/or Ensembl if different)
KIAA1549 gene location

GeneLoc information about chromosome 7         GeneLoc Exon Structure

GeneLoc location for GC07M138516:  view genomic region     (about GC identifiers)

Start:
138,516,126 bp from pter      End:
138,666,064 bp from pter
Size:
149,939 bases      Orientation:
minus strand

1 alternative location:
Chr7-,CRA_TCAG 137,860,328-138,010,282     

(According to 1UniProtKB, HORDE, 2neXtProt, Ensembl, and/or Reactome, Modification sites according to PhosphoSitePlus, Specific Peptides from DME, RefSeq according to NCBI, PDB rendering according to OCA and/or Proteopedia, Recombinant Proteins from EMD Millipore, R&D Systems, GenScript, Enzo Life Sciences, OriGene, Novus Biologicals, Sino Biological, ProSpec, Cloud-Clone Corp., eBioscience, and/or antibodies-online,
Biochemical Assays by EMD Millipore, R&D Systems, OriGene, GenScript, Cell Signaling Technology, Enzo Life Sciences, Cloud-Clone Corp., eBioscience, and/or antibodies-online, Antibodies by EMD Millipore, R&D Systems, Cell Signaling Technology, OriGene, Novus Biologicals, Thermo Fisher Scientific, Abcam, Cloud-Clone Corp, antibodies-online, and/or others.)
About This Section

TryGeneCards Plus

UniProtKB/Swiss-Prot: K1549_HUMAN, Q9HCM3 (See protein sequence)
Recommended Name: UPF0606 protein KIAA1549  
Size: 1950 amino acids; 210755 Da
Sequence caution: Sequence=AAH38232.1; Type=Erroneous initiation; Note=Translation N-terminally shortened;
Secondary accessions: B6HY55 B6HY56 B6HY58 B6HY60 B6HY61 B6HY62 B6HY63 B6HY64 B6HY65 B6HY66
Q5BJD6 Q8IY15 Q9H0M3
Alternative promoter usage, Alternative splicing: 4 isoforms:  Q9HCM3-1   Q9HCM3-2   Q9HCM3-3   Q9HCM3-4   (Produced by alternative promoter usage)

Explore the universe of human proteins at neXtProt for KIAA1549: NX_Q9HCM3

Explore proteomics data for KIAA1549 at MOPED

Post-translational modifications: 

  • Modification sites at neXtProt
  • Modification sites at PhosphoSitePlus

  • See KIAA1549 Protein Expression from SPIRE MOPED, PaxDB, and MaxQB

    REFSEQ proteins (2 alternative transcripts): 
    NP_001158137.1  NP_065961.2  

    ENSEMBL proteins: 
     ENSP00000406661   ENSP00000416040   ENSP00000242365  

    KIAA1549 Human Recombinant Protein Products:

    Browse Purified and Recombinant Proteins at EMD Millipore
    Browse R&D Systems for human recombinant proteins
    Browse recombinant and purified proteins available from Enzo Life Sciences
    Browse OriGene full length recombinant human proteins expressed in human HEK293 cells
    Browse OriGene Protein Over-expression Lysates
    OriGene Custom MassSpec
    OriGene Custom Protein Services for KIAA1549
    GenScript Custom Purified and Recombinant Proteins Services for KIAA1549
    Browse Sino Biological Recombinant Proteins
    Browse Sino Biological Cell Lysates
    Browse ProSpec Recombinant Proteins
    Browse Proteins at Cloud-Clone Corp.

     
    Search eBioscience for Proteins for KIAA1549 

     
    Search antibodies-online for proteins for KIAA1549 

     
    antibodies-online peptides for KIAA1549

    KIAA1549 Antibody Products:

    Browse EMD Millipore's Extensive Line of Mono- and Polyclonal Antibodies
    Browse R&D Systems for Antibodies
    Browse OriGene Antibodies
    OriGene Custom Antibody Services for KIAA1549
    Novus Biologicals KIAA1549 Antibody
    Abcam antibodies for KIAA1549
    Browse Antibodies at Cloud-Clone Corp.
    Search ThermoFisher Antibodies for KIAA1549
    antibodies-online antibodies for KIAA1549 (2 products) 

    KIAA1549 Assay Products:

    Browse Kits and Assays available from EMD Millipore
    OriGene Custom Assay Services for KIAA1549
    Browse R&D Systems for biochemical assays
    GenScript Custom Assay Services for KIAA1549
    Browse Enzo Life Sciences for kits & assays
    Browse ELISAs at Cloud-Clone Corp.
    Browse CLIAs at Cloud-Clone Corp.
    Search eBioscience for ELISAs for KIAA1549 
    antibodies-online kits for KIAA1549 (4 products) 


    (According to HGNC, IUPHAR, InterPro, ProtoNet, UniProtKB, and/or BLOCKS, Sets of similar genes according to GeneDecks)
    About This Section

    TryGeneCards Plus
    1 InterPro protein domain:
     IPR024606 DUF3827

    Graphical View of Domain Structure for InterPro Entry Q9HCM3

    ProtoNet protein and cluster: Q9HCM3

    1 Blocks protein domain: IPB000792 Bacterial regulatory protein

    UniProtKB/Swiss-Prot: K1549_HUMAN, Q9HCM3
    Similarity: Belongs to the UPF0606 family


    Find genes that share domains with KIAA1549           About GenesLikeMe


    (According to 1UniProtKB, Genatlas, LifeMap Discovery™, IUBMB, and/or 2DME, Human phenotypes from GenomeRNAi, Animal models from MGI Mar 06 2013, genOway,
    transcription factor targeting from QIAGEN and/or HOMER, miRNA Gene Targets from miRTarBase, shRNA from OriGene, siRNAs from OriGene, QIAGEN, microRNA from QIAGEN, SwitchGear Genomics, Gene Editing from DNA2.0, Clones from OriGene, GenScript, Sino Biological, DNA2.0, Vector BioLabs and/or Addgene, Cell Lines from GenScript, ESI BIO, In Situ Hybridization Assays from Advanced Cell Diagnostics, Flow cytometry from eBioscience, Ontologies according to Gene Ontology Consortium 01 Apr 2014 via Entrez Gene.)
    About This Section

    TryGeneCards Plus

    Phenotypes:
         1 MGI phenotypic allele for D630045J12Rik (no phenotypes)

    Find genes that share phenotypes with KIAA1549           About GenesLikeMe

    Animal Models:
       genOway: Develop your customized and physiologically relevant rodent model for KIAA1549

    miRNA
    Products:
        
    miRTarBase miRNAs that target KIAA1549:
    hsa-mir-148a-3p (MIRT026005), hsa-mir-29c-3p (MIRT020402), hsa-let-7b-5p (MIRT052142), hsa-mir-92a-3p (MIRT049354), hsa-mir-130b-3p (MIRT020302)

    Block miRNA regulation of human, mouse, rat KIAA1549 using miScript Target Protectors
    Selected qRT-PCR Assays for microRNAs that regulate KIAA1549 (see all 130):
    hsa-miR-376b hsa-miR-128 hsa-miR-376a* hsa-miR-520b hsa-miR-186* hsa-miR-587 hsa-let-7e hsa-miR-3927
    Browse SwitchGear 3'UTR luciferase reporter plasmids
    Inhib. RNA
    Products:
        
    OriGene RNAi products in human, mouse, rat for KIAA1549
    Predesigned siRNA for gene silencing in human, mouse, rat KIAA1549

    Gene Editing
    Products:
    DNA2.0 Custom Protein Engineering Service for KIAA1549

    Clone
    Products:
         
    OriGene clones in human, mouse for KIAA1549 (see all 12)
    OriGene ORF clones in mouse, rat for KIAA1549
    OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
    GenScript: all cDNA clones in your preferred vector (see all 2): KIAA1549 (NM_020910)
    Browse Sino Biological Human cDNA Clones
    DNA2.0 Custom Codon Optimized Gene Synthesis Service for KIAA1549
    Search Vector BioLabs for ready-to-use adenovirus/AAV for human, mouse, rat KIAA1549

    Cell Line
    Products:
         
    GenScript Custom overexpressing Cell Line Services for KIAA1549
    Browse ESI BIO Cell Lines and PureStem Progenitors for KIAA1549 
    In Situ Assay
    Products:
       

     
    Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for KIAA1549


    (According to UniProtKB, COMPARTMENTS Subcellular localization database, Ontologies according to Gene Ontology Consortium 01 Apr 2014 via Entrez Gene.)
    About This Section

    TryGeneCards Plus

    Subcellular locations from UniProtKB/Swiss-Prot
    K1549_HUMAN, Q9HCM3: Membrane; Multi-pass membrane protein (Potential)
    Subcellular locations from COMPARTMENTS: 

    CompartmentConfidence
    plasma membrane2
    cytosol1
    endoplasmic reticulum1
    golgi apparatus1
    mitochondrion1
    nucleus1
    peroxisome1

    Gene Ontology (GO): 1 cellular component term:    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0016021integral component of membrane IEA--

    Find genes that share ontologies with KIAA1549           About GenesLikeMe


    (SuperPaths according to PathCards, Pathways according to R&D Systems, Cell Signaling Technology, KEGG, PharmGKB, BioSystems, Sino Biological, Reactome, Tocris Bioscience, GeneGo (Thomson Reuters), QIAGEN, and/or UniProtKB, Sets of similar genes according to GeneDecks, Interaction Networks according to QIAGEN, and/or STRING, Interactions according to 1UniProtKB, 2MINT, 3I2D, and/or 4STRING, with links to IntAct and Ensembl, Ontologies according to Gene Ontology Consortium 01 Apr 2014 via Entrez Gene).
    About This Section

    TryGeneCards Plus



        Custom Pathway & Disease-focused RT2 Profiler PCR Arrays for KIAA1549
    Interactions:

        Search GeneGlobe Interaction Network for KIAA1549

    STRING Interaction Network Preview (showing 5 interactants - click image to see 9)

    Selected Interacting proteins for KIAA1549 (Q9HCM32, 3 ENSP000002423654) via UniProtKB, MINT, STRING, and/or I2D (see all 16)
    InteractantInteraction Details
    GeneCardExternal ID(s)
    SOD2P041793, ENSP000003371274I2D: score=3 STRING: ENSP00000337127
    MYO5BQ9ULV03, ENSP000002850394I2D: score=2 STRING: ENSP00000285039
    GNEQ9Y2233, ENSP000003798394I2D: score=1 STRING: ENSP00000379839
    CADPSQ9ULU83, ENSP000003732154I2D: score=3 STRING: ENSP00000373215
    DSTQ030013, ENSP000003597904I2D: score=1 STRING: ENSP00000359790
    About this table

    (Chemical Compounds according to UniProtKB, Enzo Life Sciences, EMD Millipore, Tocris Bioscience, ApexBio, HMDB, BitterDB, and/or Novoseek, Ligands according to IUPHAR, and Drugs according to DrugBank, Enzo Life Sciences, and/or PharmGKB)
    About This Section

    TryGeneCards Plus
    Browse Small Molecules at EMD Millipore
       Browse drugs & compounds from Enzo Life Sciences
      Browse compounds at ApexBio 

    Browse Tocris compounds for KIAA1549 (K1549)



    (Secondary structures according to fRNAdb,
    GenBank/EMBL/DDBJ Accessions according to
    Unigene (Build 236 Homo sapiens; Apr 25 2013) or GenBank,
    RefSeq according to Entrez Gene,
    DOTS (version 10), and/or AceView, transcript ids from Ensembl with links to UCSC,
    exon structure from GeneLoc, alternative splicing isoforms according to ASD and/or ECgene,
    siRNAs from OriGene, QIAGEN, shRNA from OriGene, microRNA from QIAGEN, SwitchGear Genomics,
    Tagged/untagged cDNA clones from OriGene, GenScript, DNA2.0, Vector BioLabs, and/or Addgene, Primers from OriGene, and/or QIAGEN, Flow cytometry from eBioscience )
    About This Section

    TryGeneCards Plus

    REFSEQ mRNAs for KIAA1549 gene (2 alternative transcripts): 
    NM_001164665.1  NM_020910.2  

    Unigene Cluster for KIAA1549:

    KIAA1549
    Hs.605380  [show with all ESTs]
    Unigene Representative Sequence: NM_001164665
    3 Ensembl transcripts including schematic representations, and UCSC links where relevant:
    ENST00000440172(uc011kqj.2 uc011kql.2) ENST00000422774 ENST00000242365(uc011kqi.2 uc011kqk.2)

    miRNA
    Products:
         
    Block miRNA regulation of human, mouse, rat KIAA1549 using miScript Target Protectors
    Selected qRT-PCR Assays for microRNAs that regulate KIAA1549 (see all 130):
    hsa-miR-376b hsa-miR-128 hsa-miR-376a* hsa-miR-520b hsa-miR-186* hsa-miR-587 hsa-let-7e hsa-miR-3927
    Browse SwitchGear 3'UTR luciferase reporter plasmids
    Inhib. RNA
    Products:
         
    OriGene RNAi products in human, mouse, rat for KIAA1549
    Predesigned siRNA for gene silencing in human, mouse, rat KIAA1549
    Clone
    Products:
         
    OriGene clones in human, mouse for KIAA1549 (see all 12)
    OriGene ORF clones in mouse, rat for KIAA1549
    OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
    GenScript: all cDNA clones in your preferred vector (see all 2): KIAA1549 (NM_020910)
    DNA2.0 Custom Codon Optimized Gene Synthesis Service for KIAA1549
    Search Vector BioLabs for ready-to-use adenovirus/AAV for human, mouse, rat KIAA1549
    Primer
    Products:
        
    OriGene qSTAR qPCR primer pairs in human, mouse for KIAA1549
    Pre-validated RT2 qPCR Primer Assay in human, mouse, rat KIAA1549
      QuantiTect SYBR Green Assays in human, mouse, rat KIAA1549
      QuantiFast Probe-based Assays in human, mouse, rat KIAA1549

    Additional mRNA sequence: 

    AB046769.2 AK021793.1 AK096022.1 AL136736.1 AM989468.1 AM989469.1 AM989477.1 BC038232.1 
    BC069036.1 BC091523.1 CR533444.1 

    7 DOTS entries:

    DT.408090  DT.97763435  DT.100743999  DT.304344  DT.40239001  DT.91801736  DT.412400 

    Selected AceView cDNA sequences (see all 52):

    AL136736 BU178367 F10033 AI867021 BE856405 AB046769 AA508761 BM558831 
    AK097963 AA255487 BE383416 BM564901 BC038232 CF242846 CF242857 CR533444 
    BF311407 BU740601 BM011472 AI744024 BM992220 BF195765 CD656171 AW188608 

    GeneLoc Exon Structure

    2 Alternative Splicing Database (ASD) splice patterns (SP) for KIAA1549    About this scheme

    ExUns: 1 ^ 2 ^ 3 ^ 4 ^ 5a · 5b ^ 6 ^ 7 ^ 8 ^ 9 ^ 10 ^ 11 ^ 12 ^ 13 ^ 14 ^ 15 ^ 16 ^ 17 ^ 18 ^ 19a · 19b · 19c
    SP1:                                                                                                                    -               
    SP2:                                                                                                                                    


    ECgene alternative splicing isoforms for KIAA1549

    (RNA expression data according to H-InvDB, NONCODE, miRBase, and RNAdb, Expression images according to data from BioGPS, Illumina Human BodyMap, and CGAP SAGE, Sets of similar genes according to GeneDecks, in vivo and in vitro expression data from LifeMap Discovery™, Protein expression images according to data from SPIRE 1MOPED, 2PaxDb, and 3MaxQB, plus additional links to SOURCE, and/or BioGPS, and/or UniProtKB,
    PCR Arrays from QIAGEN, Primers from OriGene, and/or QIAGEN, In Situ Hybridization Assays from Advanced Cell Diagnostics)
    About This Section

    TryGeneCards Plus

    KIAA1549 expression in normal human tissues (normalized intensities)
    See probesets specificity/sensitivity at GeneAnnot
    About this imageBioGPS <intensity>2/3
    CGAP TAG: TTTACAATTT
    KIAA1549 Expression
    About this image


    KIAA1549 expression in embryonic tissues and stem cells    About this table
    Data from LifeMap, the Embryonic Development and Stem Cells Database
     selected tissues (see all 4) fully expand
     
     Lung (Respiratory System)    fully expand to see all 2 entries
             Chondrocytes Tracheal Cartilage
             Tracheal Cartilage
     
     Blood (Hematopoietic System)    fully expand to see all 2 entries
             Hematopoietic Stem Cells Hematopoietic Bone Marrow
     
     Cartilage (Muscoskeletal System)
             Tracheal Cartilage
     
     Brain (Nervous System)
             Cerebellum
    KIAA1549 Protein expression data from MOPED1, PaxDb2 and MaxQB3    About this image

    KIAA1549 Protein Expression

    SOURCE GeneReport for Unigene cluster: Hs.605380
        Custom PCR Arrays for KIAA1549
    Primer
    Products:
    OriGene qSTAR qPCR primer pairs in human, mouse for KIAA1549
    Pre-validated RT2 qPCR Primer Assay in human, mouse, rat KIAA1549
    QuantiTect SYBR Green Assays in human, mouse, rat KIAA1549
    QuantiFast Probe-based Assays in human, mouse, rat KIAA1549
    In Situ
    Assay Products:
     

     
    Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for KIAA1549

    (Orthologs according to 1,2HomoloGene (2older version, for species not in 1newer version), 3euGenes, 4SGD , 5MGI Mar 06 2013, with possible further links to Flybase and/or WormBase, and/or 6Ensembl pan taxonomic compara , Gene Trees according to Ensembl and TreeFam)
    About This Section

    TryGeneCards Plus

    This gene was present in the common ancestor of chordates.

    Orthologs for KIAA1549 gene from Selected species (see all 10)    About this table
    Organism Taxonomic
    classification
    Gene Description Human
    Similarity
    Orthology
    Type
    Details
    mouse
    (Mus musculus)
    Mammalia D630045J12Rik1 , 5 RIKEN cDNA D630045J12 gene1, 5 78.24(n)1
    73.29(a)1
      6 (17.68 cM)5
    3302861  NM_194061.21  NP_918950.21 
     381231745 
    chicken
    (Gallus gallus)
    Aves KIAA15491 KIAA1549 61.69(n)
    55.11(a)
      100857885  XM_003640411.2  XP_003640459.2 
    lizard
    (Anolis carolinensis)
    Reptilia KIAA15496
    KIAA1549
    46(a)
    1 ↔ 1
    5(16492623-16638547)
    zebrafish
    (Danio rerio)
    Actinopterygii si:dkeyp-27e10.31 si:dkeyp-27e10.3 57.97(n)
    53.35(a)
      100034386  XM_003198244.2  XP_003198292.2 


    ENSEMBL Gene Tree for KIAA1549 (if available)
    TreeFam Gene Tree for KIAA1549 (if available)

    (Paralogs according to 1HomoloGene,
    2Ensembl, and 3SIMAP, Pseudogenes according to 4Pseudogene.org Build 68)
    About This Section

    TryGeneCards Plus
    Paralogs for KIAA1549 gene
    KIAA1549L2  

    Find genes that share paralogs with KIAA1549           About GenesLikeMe



    (SNPs/Variants according to the 1NCBI SNP Database, 2Ensembl, 3PupaSUITE, 4UniProtKB, and DNA2.0, Linkage Disequilibrium by HapMap, Structural Variations(CNVs/InDels/Inversions) from the Database of Genomic Variants, Mutations from the Human Gene Mutation Database (HGMD), the Human Cytochrome P450 Allele Nomenclature Database, and the Locus Specific Mutation Databases (LSDB), Blood group antigen gene mutations by BGMUT, Resequencing Primers, Cancer Mutation PCR Arrays and Assays, and Copy Number PCR Arrays from QIAGEN)
    About This Section

    TryGeneCards Plus

    Selected SNPs for KIAA1549 (see all 3472)    About this table                                 

    Genomic DataTranscription Related DataAllele Frequencies
    SNP IDValidClinical
    significance
    Chr 7 posSequence#AA
    Chg
    TypeMore#Allele
    freq
    PopTotal
    sample
    More
    ----------
    rs114229121,2
    C--132840895(+) CTATTT/-CATCA 2 -- int11Minor allele frequency- -:0.50NA 2
    rs1124771181,2
    C,F--132866637(+) TGGCCC/TCCCCA 2 -- int11Minor allele frequency- T:0.50WA 2
    rs754300571,2
    C--132965091(-) GGGGAG/AAGGGG 1 -- int11Minor allele frequency- A:0.50NA 2
    rs1443204961,2
    C--137861138(+) TATTC-/CTTTTTT 2 -- ut310--------
    rs344780331,2
    C--137876880(+) ATATTT/-CTAAG 2 -- int11Minor allele frequency- -:0.50NA 2
    rs1378813111,2
    C--137932763(+) TGTGT-/GTGTGTGTGTGTGTGTGTGT
    GTGTGTGTGTGTGTGTGTGTGC
    GCGCG
    2 -- int10--------
    rs2018513311,2
    --137953146(+) TTTTT-/CTCTTT 2 -- int10--------
    rs711690701,2
    C--137989363(+) CCCCCT/-GGTTC 1 -- int11Minor allele frequency- -:0.00NA 2
    rs340960581,2
    C--137989701(+) GGCCACT/-GAGAG 1 -- int11Minor allele frequency- -:0.00CSA 2
    rs669382791,2
    C--137989702(+) GCCAG-/CTAGAGT 1 -- int10--------

    HapMap Linkage Disequilibrium report for KIAA1549 (138516126 - 138666064 bp)

    Structural Variations
         Database of Genomic Variants (DGV) 10 variations for KIAA1549:    About this table    
    Variant IDTypeSubtypePubMed ID
    esv2735227CNV Deletion23290073
    esv2665390CNV Deletion23128226
    esv2735212CNV Deletion23290073
    esv1717918CNV Insertion17803354
    esv2611670CNV Insertion19546169
    nsv5969CNV Loss18451855
    nsv831155CNV Loss17160897
    nsv831154CNV Gain17160897
    esv259637OTHER Complex20981092
    esv259833OTHER Complex20981092

    Human Gene Mutation Database (HGMD): KIAA1549
    Site Specific Mutation Identification with PCR Assays
    SeqTarget long-range PCR primers for resequencing KIAA1549
    DNA2.0 Custom Variant and Variant Library Synthesis for KIAA1549

    (in which this Gene is Involved, According to MalaCards, OMIM, UniProtKB, the University of Copenhagen DISEASES database, Genatlas, GeneTests, GAD, HuGE Navigator, and/or TGDB.)
    About This Section

    TryGeneCards Plus
    OMIM gene information: 613344    OMIM disorders: --

    UniProtKB/Swiss-Prot: K1549_HUMAN, Q9HCM3
  • Note=A chromosomal aberration involving KIAA1549 is found in pilocytic astrocytoma. A tandem duplication
    of 2 Mb at 7q34 leads to the expression of a KIAA1549-BRAF fusion protein with a constitutive kinase activity and
    inducing cell transformation

  • 3 diseases for KIAA1549:    
    About MalaCards
    pilocytic astrocytoma    astrocytoma    dysembryoplastic neuroepithelial tumor

    2 diseases from the University of Copenhagen DISEASES database for KIAA1549:
    Malignant glioma     Dysembryoplastic neuroepithelial tumor

    Find genes that share disorders with KIAA1549           About GenesLikeMe

    Genetic Association Database (GAD): KIAA1549
    Human Genome Epidemiology (HuGE) Navigator: KIAA1549 (1 document)

    Export disorders for KIAA1549 gene to outside databases

    (in PubMed. Associations of this gene to articles via 1Entrez Gene, 2UniProtKB/Swiss-Prot, 3HGNC, 4GAD, 5PharmGKB, 6HMDB, 7DrugBank, 8UniProtKB/TrEMBL, 9 Novoseek, and/or 10fRNAdb)
    About This Section

    TryGeneCards Plus

    PubMed articles for KIAA1549 gene, integrated from 10 sources (see all 19):
    (articles sorted by number of sources associating them with KIAA1549)
        Utopia: connect your pdf to the dynamic
    world of online information

    1. Personalized smoking cessation: interactions between nicotine dose, dependence and quit-success genotype score. (PubMed id 20379614)1, 4 Rose J.E....Uhl G.R. (Mol. Med. 2010)
    2. Tandem duplication producing a novel oncogenic BRAF fusion gene defines the majority of pilocytic astrocytomas. (PubMed id 18974108)1, 2 Jones D.T.W.... Collins V.P. (Cancer Res. 2008)
    3. Prediction of the coding sequences of unidentified human genes. XVIII. The complete sequences of 100 new cDNA clones from brain which code for large proteins in vitro. (PubMed id 10997877)1, 2 Nagase T.... Ohara O. (DNA Res. 2000)
    4. Protein interaction network of the mammalian Hippo pathway reveals mechanisms of kinase-phosphatase interactions. (PubMed id 24255178)1 Couzens A.L....Gingras A.C. (Sci Signal 2013)
    5. Absence of KIAA1549-BRAF fusion in rosette-forming glioneuronal tumors of the fourth ventricle (RGNT). (PubMed id 22814862)1 Gessi M....Pietsch T. (J. Neurooncol. 2012)
    6. KIAA1549-BRAF fusions and IDH mutations can coexist in diffuse gliomas of adults. (PubMed id 22591444)1 Badiali M....Giangaspero F. (Brain Pathol. 2012)
    7. BRAF alterations in primary glial and glioneuronal neoplasms of the central nervous system with identification of 2 novel KIAA1549:BRAF fusion variants. (PubMed id 22157620)1 Lin A....Bar E.E. (J. Neuropathol. Exp. Neurol. 2012)
    8. BRAF-KIAA1549 fusion transcripts are less frequent in pilocytic astrocytomas diagnosed in adults. (PubMed id 21696415)1 Hasselblatt M....Paulus W. (Neuropathol. Appl. Neurobiol. 2011)
    9. The BTB and CNC homology 1 (BACH1) target genes are involved in the oxidative stress response and in control of the cell cycle. (PubMed id 21555518)1 Warnatz H.J....Yaspo M.L. (J. Biol. Chem. 2011)
    10. Global identification of modular cullin-RING ligase substrates. (PubMed id 21963094)1 Emanuele M.J....Elledge S.J. (Cell 2011)

    (in PubMed, OMIM, and NCBI Bookshelf)
    About This Section

    TryGeneCards Plus
     ANDOR
    Aliases
    Free Text  

      Query String
    PubMed
    OMIM
    NCBI Bookshelf
      (Note: In FireFox, select the above section and copy using Ctrl-C)

    (According to Entrez Gene, HGNC, AceView, euGenes, Ensembl, miRBase, ECgene, Kegg, and/or H-InvDB)
    About This Section

    TryGeneCards Plus
    Entrez Gene: 57670 HGNC: 22219 AceView: KIAA1549 Ensembl:ENSG00000122778 euGenes: HUgn57670
    ECgene: KIAA1549 H-InvDB: KIAA1549

    (According to HUGE)
    About This Section

    TryGeneCards Plus
    HUGE: KIAA1549

    (According to PharmGKB, ATLAS, HORDE, IMGT, LEIDEN, UniProtKB/Swiss-Prot, UniProtKB/TrEMBL, and/or others, e.g. Wikipedia and GeneReviews, via UniProtKB/Swiss-Prot)
    About This Section

    TryGeneCards Plus
    NameDescription
    PharmGKB entry for KIAA1549 Pharmacogenomics, SNPs, Pathways

    (Patent information from GeneIP,
    Licensable technologies from WIS Yeda, Salk, Tufts,
    IP news from LifeMap Sciences, Inc.)
    About This Section

    TryGeneCards Plus
    Patent Information for KIAA1549 gene:
    Search GeneIP for patents involving KIAA1549

    GeneCards and IP:
    Japan Patent Office Licenses GeneCards     European Patent Office Licenses GeneCards     Improving the IP Search



    (Antibodies, recombinant proteins, and assays from EMD Millipore, R&D Systems, OriGene, QIAGEN, GenScript, Cell Signaling Technology, Novus Biologicals, Sino Biological, Enzo Life Sciences, Abcam, ProSpec, Cloud-Clone Corp., Thermo Fisher Scientific, eBioscience, antibodies-online, and/or others, Gene Editing from DNA2.0. Clones from OriGene, GenScript, Sino Biological, DNA2.0, SwitchGear Genomics, Vector BioLabs, Addgene, Cell lines from GenScript, and ESI BIO, Flow cytometery from eBioscience, PCR Arrays from QIAGEN, Drugs and/or compounds from EMD Millipore, Tocris Bioscience, Enzo Life Sciences, and/or ApexBio, In Situ Hybridization Assays from
    Advanced Cell Diagnostics, Animal models from genOway)
    About This Section

    TryGeneCards Plus

     
     EMD Millipore genomic analysis products

      
     Browse Antibodies   Browse Cell Culture Products  
     Browse ELISAs   Browse Flow Cytometry Kits  
     Browse Primer Pairs   Browse Enzyme Activity Assays/Reagents  
     Browse ELISpot/FluoroSpot Kits/Development Modules   Browse TFB/Immunoprecipitation Assays  
     Browse Apoptosis Detection Kits/Reagents   Browse Ubiquitin Proteasome Pathway (UPP) Assay Kits/Reagents  
     Browse DNA Damage/Repair Kits/Reagents   Browse Luminex Assays  
     Browse Cell Selection/Detection Kits/Reagents   Browse Secondary Antibodies/Controls/Staining Reagents  
     Browse Recombinant/Natural Proteins   Browse Stem Cell Products  
     Browse cDNA Clones   Browse Proteome Profiler Antibody Arrays  
     Browse OriGene Antibodies   OriGene RNAi products in human, mouse, rat for KIAA1549  
     Browse OriGene qPCR primer pairs and template standards   Browse OriGene Protein Over-expression Lysates  
     OriGene Custom Mass Spec   OriGene clones in human, mouse for KIAA1549  
     OriGene qSTAR qPCR primer pairs in human, mouse for KIAA1549   Browse OriGene full length recombinant human proteins expressed in human HEK293 cells  
     OriGene ORF clones in mouse, rat for KIAA1549   OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling  
     OriGene Custom Antibody Services for KIAA1549   OriGene Custom Protein Services for KIAA1549  

     
     
     Block miRNA regulation of human, mouse, rat KIAA1549 using miScript Target Protectors SeqTarget long-range PCR primers for resequencing KIAA1549
     DNA Methylation CpG Assay Predesigned for Pyrosequencing in human, mouse, rat KIAA1549 Predesigned siRNA for gene silencing in human, mouse, rat KIAA1549
     QuantiFast Probe-based Assays in human, mouse, rat KIAA1549 QuantiTect SYBR Green Assays in human, mouse, rat KIAA1549
     Custom PCR Arrays for KIAA1549 Search Chromatin IP Primers for KIAA1549
     Pre-validated RT2 qPCR Primer Assay in human, mouse, rat KIAA1549  Search GeneGlobe Interaction Network for KIAA1549
     Regulatory tfbs in KIAA1549 promoter
     GenScript Custom Purified and Recombinant Proteins Services for KIAA1549 GenScript cDNA clones with any tag delivered in your preferred vector for KIAA1549
     GenScript Custom Assay Services for KIAA1549 GenScript Custom overexpressing Cell Line Services for KIAA1549
     CloneReady with Over 120,000 Genes  Gene Synthesis: Any Gene in Any Vector
     Vector-based siRNA and miRNA, Ready for Transfection Gene Mutant Library, Variants up to 10^11
     Plasmid Preparation Custom Peptide Services
     Search for Antibodies & Assays

     Search Tocris compounds for KIAA1549 (K1549)
     Browse Sino Biological Proteins
     Browse Sino Biological Cell Lysates
     Browse Sino Biological cDNA Clones
     4000+ Proteins
     Search Sino Biological for antibodies, proteins & pathways
     Protein Production Services
     Transfection Reagents
     Protein A/G/L resins
     Isotyping reagents
     Search www.enzolifesciences.com for proteins, assays, substrates, inhibitors & antibodies

     Novus Tissue Slides
     KIAA1549 antibodies
     Antibodies for KIAA1549
     See all of Abcam's Antibodies, Kits and Proteins for KIAA1549
     Custom Antibody / Protein Production Service
     Bulk Purchasing
     Advantages of Rabbit Monoclonal antibodies
     Abcam protocols and scientific support
     Browse ProSpec Recombinant Proteins
     Browse Proteins at Cloud-Clone Corp.
     Browse Antibodies at Cloud-Clone Corp.
     Browse ELISAs at Cloud-Clone Corp.
     Browse CLIAs at Cloud-Clone Corp.



     Browse ESI BIO Cell Lines and PureStem Progenitors for KIAA1549
     Gene Synthesis
     Protein Engineering
     Variant Library Synthesis
     Codon Optimization
     Protein Production and Purification
     Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for KIAA1549
     Browse SwitchGear 3'UTR luciferase reporter plasmids for KIAA1549
     Browse SwitchGear Promoter luciferase reporter plasmids for KIAA1549
     Search ThermoFisher Antibodies for KIAA1549
     Search Vector BioLabs for ready-to-use adenovirus/AAV for human, mouse, rat KIAA1549
     Browse compounds at ApexBio
     Search Addgene for plasmids for KIAA1549
      Search eBioscience for proteins for KIAA1549
      Search eBioscience for elisas for KIAA1549
      eBioscience FlowRNA Probe Sets
     genOway: Develop your customized and physiologically relevant rodent model for KIAA1549
     antibodies-online antibodies for KIAA1549 (2 products)
     antibodies-online kits for KIAA1549 (4 products)
     antibodies-online peptides for KIAA1549
      Search antibodies-online for proteins for KIAA1549
           
    GeneCards Homepage - Last full update: 7 May 2014 - Incrementals: 9 May 2014 , 2 Jun 2014 , 26 Jun 2014 , 30 Jun 2014 , 21 Aug 2014 , 8 Sep 2014 , 7 Oct 2014

    View Random Gene

    Category
    (GIFtS: )
    GIFtS Group
    The GeneCards human gene database gene index: 1 3 5 A B C D E F G H I J K L M N O P Q R S T U V W X Y Z 


    Developed at the Crown Human Genome Center, Department of Molecular Genetics, the Weizmann Institute of Science

    Hot genes      Disease genes      KIAA1549 gene at Home site.
    Version: 3.12.250 16 Nov 2014
    hostname: 356977-web1.xennexinc.com index build: 128 solr: 1.4