Set Analyses:
Advanced Search

Advanced Search

 
Search By
Section (entire)
for


 



KIAA0430 Gene

protein-coding   GIFtS: 47
GCID: GC16M015596

KIAA0430

  Search for KIAA0430
at  

(According to 1HGNC, 2Entrez Gene,
3UniProtKB/Swiss-Prot, 4UniProtKB/TrEMBL, 5OMIM, 6GeneLoc, 7Ensembl, 8DME, 9miRBase, 10fRNAdb, 12H-InvDB, 13NCBI, 14NONCODE, and/or 15RNAdb)
About This Section

TryGeneCards Plus

Aliases
KIAA04301 2     Regulatory Subunit 341
LKAP2 3 5     PPP1R342
MARF12 3 5     limkain-b12
Limkain B11 2     Meiosis Arrest Female Protein 12
Meiosis Arrest Female 11 2     Protein Phosphatase 1, Regulatory Subunit 342
Protein Phosphatase 11     Limkain-b13

External Ids:    HGNC: 295621   Entrez Gene: 96652   Ensembl: ENSG000001667837   OMIM: 6145935   UniProtKB: Q9Y4F33   

Export aliases for KIAA0430 gene to outside databases

Previous GC identifer: GC16M015083


(According to Entrez Gene, GeneCards, Tocris Bioscience, Wikipedia's Gene Wiki, PharmGKB,
UniProtKB/Swiss-Prot, and/or UniProtKB/TrEMBL)
About This Section

TryGeneCards Plus

Entrez Gene summary for KIAA0430 Gene:
This gene encodes a putative peroxisomal protein that appears to be conserved across Euteleostomi. In humans, it
may be autoantigenic. (provided by RefSeq, Jul 2010)

GeneCards Summary for KIAA0430 Gene:
KIAA0430 (KIAA0430) is a protein-coding gene. GO annotations related to this gene include RNA binding and nucleotide binding.

UniProtKB/Swiss-Prot: MARF1_HUMAN, Q9Y4F3
Function: Essential regulator of oogenesis required for female meiotic progression to repress transposable
elements and preventing their mobilization, which is essential for the germline integrity. Probably acts via some
RNA metabolic process, equivalent to the piRNA system in males, which mediates the repression of transposable
elements during meiosis by forming complexes composed of RNAs and governs the methylation and subsequent
repression of transposons. Also required to protect from DNA double-strand breaks (By similarity)

Gene Wiki entry for KIAA0430 Gene


(According to GeneLoc and/or HGNC, and/or
Entrez Gene (NCBI build 37),
and/or miRBase,
Genomic Views according to UCSC (hg19) and Ensembl (release 75), Regulatory elements and Epigenetics data according to QIAGEN, and/or SwitchGear Genomics)
About This Section

TryGeneCards Plus
RefSeq DNA sequence:
NC_000016.10  NT_010393.17  NT_187607.1  NC_018927.2  
Regulatory elements:
   Regulatory transcription factor binding sites in the KIAA0430 gene promoter:
         Elk-1   ISGF-3   p300   Lmo2   NF-kappaB   C/EBPalpha   AREB6   NF-kappaB1   TGIF   NF-Y   
         Other transcription factors

SwitchGear Promoter luciferase reporter plasmidKIAA0430 promoter sequence
   Search Chromatin IP Primers for KIAA0430

Epigenetics:
DNA Methylation CpG Assay Predesigned for Pyrosequencing in human, mouse, rat KIAA0430


Genomic Location:
Genomic View: UCSC Golden Path with GeneCards custom track

Entrez Gene cytogenetic band: 16p13.11   Ensembl cytogenetic band:  16p13.11   HGNC cytogenetic band: 16p13.11

KIAA0430 Gene in genomic location: bands according to Ensembl, locations according to (and/or Entrez Gene and/or Ensembl if different)
KIAA0430 gene location

GeneLoc information about chromosome 16         GeneLoc Exon Structure

GeneLoc location for GC16M015596:  view genomic region     (about GC identifiers)

Start:
15,688,226 bp from pter      End:
15,737,023 bp from pter
Size:
48,798 bases      Orientation:
minus strand

(According to 1UniProtKB, HORDE, 2neXtProt, Ensembl, and/or Reactome, Modification sites according to PhosphoSitePlus, Specific Peptides from DME, RefSeq according to NCBI, PDB rendering according to OCA and/or Proteopedia, Recombinant Proteins from EMD Millipore, R&D Systems, GenScript, Enzo Life Sciences, OriGene, Novus Biologicals, Sino Biological, ProSpec, and/or Cloud-Clone Corp.,
Biochemical Assays by EMD Millipore, R&D Systems, OriGene, GenScript, Cell Signaling Technology, Enzo Life Sciences, and/or Cloud-Clone Corp., Antibodies by EMD Millipore, R&D Systems, Cell Signaling Technology, OriGene, Novus Biologicals, Thermo Fisher Scientific, LSBio, Abcam, and/or Cloud-Clone Corp.)
About This Section

TryGeneCards Plus

UniProtKB/Swiss-Prot: MARF1_HUMAN, Q9Y4F3 (See protein sequence)
Recommended Name: Meiosis arrest female protein 1  
Size: 1742 amino acids; 192859 Da
Subunit: Interacts with LIMK2
Sequence caution: Sequence=AAC31662.1; Type=Erroneous gene model prediction; Sequence=AAH64914.2;
Type=Miscellaneous discrepancy; Note=Contaminating sequence. Potential poly-A sequence; Sequence=EAW53920.1;
Type=Erroneous gene model prediction;
2 PDB 3D structures from and Proteopedia for KIAA0430:
2DGX (3D)        2DIU (3D)    
Secondary accessions: A8MSK2 B2RNX2 B4DYY9 B7ZMG1 B7ZMG2 F8VV09 Q6P1R6 Q8WYR2 Q9Y4J9
Alternative splicing: 5 isoforms:  Q9Y4F3-1   Q9Y4F3-3   Q9Y4F3-4   Q9Y4F3-5   Q9Y4F3-6   (May be due to an intron retention)

Explore the universe of human proteins at neXtProt for KIAA0430: NX_Q9Y4F3

Explore proteomics data for KIAA0430 at MOPED

Post-translational modifications: 

  • Ubiquitination2 at Lys189, Lys277, Lys318, Lys542, Lys585
  • Glycosylation2 at Asn913
  • Modification sites at PhosphoSitePlus

  • See KIAA0430 Protein Expression from SPIRE MOPED, PaxDB, and MaxQB

    REFSEQ proteins (3 alternative transcripts): 
    NP_001171927.1  NP_001171928.1  NP_055462.2  

    ENSEMBL proteins: 
     ENSP00000379654   ENSP00000439819   ENSP00000449376   ENSP00000450309   ENSP00000473601  
     ENSP00000449050   ENSP00000449329   ENSP00000448495   ENSP00000341939  

    KIAA0430 Human Recombinant Protein Products:

    Browse Purified and Recombinant Proteins at EMD Millipore
    Browse R&D Systems for human recombinant proteins
    Browse recombinant and purified proteins available from Enzo Life Sciences
    Browse OriGene full length recombinant human proteins expressed in human HEK293 cells
    Browse OriGene Protein Over-expression Lysates
    OriGene Custom MassSpec
    OriGene Custom Protein Services for KIAA0430
    GenScript Custom Purified and Recombinant Proteins Services for KIAA0430
    Novus Biologicals KIAA0430 Lysate
    Browse Sino Biological Recombinant Proteins
    Browse Sino Biological Cell Lysates
    Browse ProSpec Recombinant Proteins
    Browse Proteins at Cloud-Clone Corp.

    KIAA0430 Antibody Products:

    Browse EMD Millipore's Extensive Line of Mono- and Polyclonal Antibodies
    Browse R&D Systems for Antibodies
    Browse OriGene Antibodies
    OriGene Custom Antibody Services for KIAA0430
    Novus Biologicals KIAA0430 Antibodies
    Abcam antibodies for KIAA0430
    Browse Antibodies at Cloud-Clone Corp.
    Search ThermoFisher Antibodies for KIAA0430
    Search LSBio for Antibodies for KIAA0430

    KIAA0430 Assay Products:

    Browse Kits and Assays available from EMD Millipore
    OriGene Custom Assay Services for KIAA0430
    Browse R&D Systems for biochemical assays
    GenScript Custom Assay Services for KIAA0430
    Browse Enzo Life Sciences for kits & assays
    Browse ELISAs at Cloud-Clone Corp.
    Browse CLIAs at Cloud-Clone Corp.


    (According to HGNC, IUPHAR, InterPro, ProtoNet, UniProtKB, and/or BLOCKS, Sets of similar genes according to GeneDecks)
    About This Section

    TryGeneCards Plus
    HGNC Gene Families:
    PPP1R: Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits

    Selected InterPro protein domains (see all 6):
     IPR021139 NYN_limkain-b1
     IPR024582 Limkain_b1_cons_dom
     IPR000504 RRM_dom
     IPR012677 Nucleotide-bd_a/b_plait
     IPR025605 OST-HTH/LOTUS_dom

    Graphical View of Domain Structure for InterPro Entry Q9Y4F3

    ProtoNet protein and cluster: Q9Y4F3

    UniProtKB/Swiss-Prot: MARF1_HUMAN, Q9Y4F3
    Similarity: Contains 8 HTH OST-type domains
    Similarity: Contains 1 NYN domain
    Similarity: Contains 1 RRM (RNA recognition motif) domain


    KIAA0430 for domains           About GeneDecksing


    (According to 1UniProtKB, Genatlas, LifeMap Discovery™, IUBMB, and/or 2DME, Human phenotypes from GenomeRNAi, Animal models from MGI Mar 06 2013, inGenious Targeting Laboratory, genOway,
    transcription factor targeting from QIAGEN and/or HOMER, miRNA Gene Targets from miRTarBase, shRNA from OriGene, siRNAs from OriGene, QIAGEN, microRNA from QIAGEN, SwitchGear Genomics, Gene Editing from DNA2.0, Clones from OriGene, GenScript, Sino Biological, DNA2.0, and Vector BioLabs, Cell Lines from GenScript, ESI BIO, In Situ Hybridization Assays from Advanced Cell Diagnostics, Ontologies according to Gene Ontology Consortium 01 Apr 2014 via Entrez Gene.)
    About This Section

    TryGeneCards Plus

    Molecular Function:

         UniProtKB/Swiss-Prot Summary: MARF1_HUMAN, Q9Y4F3
    Function: Essential regulator of oogenesis required for female meiotic progression to repress transposable
    elements and preventing their mobilization, which is essential for the germline integrity. Probably acts via some
    RNA metabolic process, equivalent to the piRNA system in males, which mediates the repression of transposable
    elements during meiosis by forming complexes composed of RNAs and governs the methylation and subsequent
    repression of transposons. Also required to protect from DNA double-strand breaks (By similarity)

         Gene Ontology (GO): 4 molecular function terms:    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0000166nucleotide binding IEA--
    GO:0003674molecular_function ND--
    GO:0003676nucleic acid binding ----
    GO:0003723RNA binding IEA--
         
    KIAA0430 for ontologies           About GeneDecksing


    Phenotypes:
         2 GenomeRNAi human phenotypes for KIAA0430:
     Increased S DNA content  Increased number of mitotic ce 

         1 MGI mutant phenotype (inferred from 2 alleles(MGI details for Marf1):
     reproductive system 

    KIAA0430 for phenotypes           About GeneDecksing

    Animal Models:
       inGenious Targeting Laboratory: Let us create your new Knockout/Knockin mouse model for KIAA0430
       inGenious Targeting Laboratory: Contact us about creating complex and humanized mouse models for KIAA0430

       genOway customized KO model: permanent, tissue-specific or time-controlled inactivation for KIAA0430
       genOway customized Knockin model: humanization, point mutation, expression monitoring, etc. for KIAA0430

    miRNA
    Products:
        
    miRTarBase miRNAs that target KIAA0430:
    hsa-mir-155-5p (MIRT020922), hsa-mir-335-5p (MIRT018607), hsa-mir-183-5p (MIRT047170)

    Block miRNA regulation of human, mouse, rat KIAA0430 using miScript Target Protectors
    Selected qRT-PCR Assays for microRNAs that regulate KIAA0430 (see all 15):
    hsa-miR-549 hsa-miR-448 hsa-miR-224 hsa-miR-429 hsa-miR-561 hsa-miR-1324 hsa-miR-133b hsa-miR-491-3p
    SwitchGear 3'UTR luciferase reporter plasmidKIAA0430 3' UTR sequence
    Inhib. RNA
    Products:
        
    OriGene RNAi products in human, mouse, rat for KIAA0430
    Predesigned siRNA for gene silencing in human, mouse, rat KIAA0430

    Gene Editing
    Products:
    DNA2.0 Custom Protein Engineering Service for KIAA0430

    Clone
    Products:
         
    OriGene clones in human, mouse for KIAA0430 (see all 11)
    OriGene ORF clones in mouse, rat for KIAA0430
    OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
    GenScript: all cDNA clones in your preferred vector (see all 3): KIAA0430 (NM_001184999)
    Browse Sino Biological Human cDNA Clones
    DNA2.0 Custom Codon Optimized Gene Synthesis Service for KIAA0430
    Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat KIAA0430

    Cell Line
    Products:
         
    GenScript Custom overexpressing Cell Line Services for KIAA0430
    Browse ESI BIO Cell Lines and PureStem Progenitors for KIAA0430 
    In Situ Assay
    Products:
       

     
    Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for KIAA0430


    (According to UniProtKB, COMPARTMENTS Subcellular localization database, Ontologies according to Gene Ontology Consortium 01 Apr 2014 via Entrez Gene.)
    About This Section

    TryGeneCards Plus

    Subcellular locations from UniProtKB/Swiss-Prot
    MARF1_HUMAN, Q9Y4F3: Peroxisome
    Subcellular locations from COMPARTMENTS: 

    CompartmentConfidence
    peroxisome5
    nucleus3
    cytosol2
    golgi apparatus1

    Gene Ontology (GO): 1 cellular component term:    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0005777peroxisome IDA15932519

    KIAA0430 for ontologies           About GeneDecksing


    (SuperPaths according to PathCards, Pathways according to R&D Systems, Cell Signaling Technology, KEGG, PharmGKB, BioSystems, Sino Biological, Reactome, Tocris Bioscience, GeneGo (Thomson Reuters), QIAGEN, and/or UniProtKB, Sets of similar genes according to GeneDecks, Interaction Networks according to QIAGEN, and/or STRING, Interactions according to 1UniProtKB, 2MINT, 3I2D, and/or 4STRING, with links to IntAct and Ensembl, Ontologies according to Gene Ontology Consortium 01 Apr 2014 via Entrez Gene).
    About This Section

    TryGeneCards Plus



        Custom Pathway & Disease-focused RT2 Profiler PCR Arrays for KIAA0430
    Interactions:

        Search GeneGlobe Interaction Network for KIAA0430

    STRING Interaction Network Preview (showing 5 interactants - click image to see 6)

    Selected Interacting proteins for KIAA0430 (Q9Y4F33 ENSP000003796544) via UniProtKB, MINT, STRING, and/or I2D (see all 7)
    InteractantInteraction Details
    GeneCardExternal ID(s)
    TERF2Q155543, ENSP000002549424I2D: score=1 STRING: ENSP00000254942
    GRB2P629933I2D: score=2 
    PPP1CAENSP000003260314STRING: ENSP00000326031
    ELAVL1ENSP000003852694STRING: ENSP00000385269
    EAF1ENSP000003800544STRING: ENSP00000380054
    About this table

    Gene Ontology (GO): Selected biological process terms (see all 6):    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0006302double-strand break repair IEA--
    GO:0007143female meiosis ISS--
    GO:0010468regulation of gene expression ISS--
    GO:0010923negative regulation of phosphatase activity IDA19389623
    GO:0030154cell differentiation IEA--

    KIAA0430 for ontologies           About GeneDecksing



    (Chemical Compounds according to UniProtKB, Enzo Life Sciences, EMD Millipore, Tocris Bioscience, ApexBio, HMDB, BitterDB, and/or Novoseek, Ligands according to IUPHAR, and Drugs according to DrugBank, Enzo Life Sciences, and/or PharmGKB)
    About This Section

    TryGeneCards Plus
    Browse Small Molecules at EMD Millipore
       Browse drugs & compounds from Enzo Life Sciences
      Browse compounds at ApexBio 

    Browse Tocris compounds for KIAA0430 (MARF1)



    (Secondary structures according to fRNAdb,
    GenBank/EMBL/DDBJ Accessions according to
    Unigene (Build 236 Homo sapiens; Apr 25 2013) or GenBank,
    RefSeq according to Entrez Gene,
    DOTS (version 10), and/or AceView, transcript ids from Ensembl with links to UCSC,
    Conferences by KenesGroup, exon structure from GeneLoc, alternative splicing isoforms according to ASD and/or ECgene,
    siRNAs from OriGene, QIAGEN, shRNA from OriGene, microRNA from QIAGEN, SwitchGear Genomics,
    Tagged/untagged cDNA clones from OriGene, GenScript, DNA2.0, Vector BioLabs, Primers from OriGene, and/or QIAGEN )
    About This Section

    TryGeneCards Plus

    REFSEQ mRNAs for KIAA0430 gene (4 alternative transcripts): 
    NM_019081.2  NM_001184998.1  NM_001184999.1  NM_014647.3  

    Unigene Cluster for KIAA0430:

    KIAA0430
    Hs.173524  [show with all ESTs]
    Unigene Representative Sequence: NM_014647
    17 Ensembl transcripts including schematic representations, and UCSC links where relevant:
    ENST00000396368(uc002ddq.3 uc002ddr.3 uc010uzv.2 uc010uzw.2)
    ENST00000540441 ENST00000552771 ENST00000548025 ENST00000551742 ENST00000602337
    ENST00000551878 ENST00000552553 ENST00000551579 ENST00000549337 ENST00000547936
    ENST00000552535 ENST00000546864 ENST00000551678 ENST00000548216(uc010uzx.2)
    ENST00000549219 ENST00000344181
    miRNA
    Products:
         
    Block miRNA regulation of human, mouse, rat KIAA0430 using miScript Target Protectors
    Selected qRT-PCR Assays for microRNAs that regulate KIAA0430 (see all 15):
    hsa-miR-549 hsa-miR-448 hsa-miR-224 hsa-miR-429 hsa-miR-561 hsa-miR-1324 hsa-miR-133b hsa-miR-491-3p
    SwitchGear 3'UTR luciferase reporter plasmidKIAA0430 3' UTR sequence
    Inhib. RNA
    Products:
         
    OriGene RNAi products in human, mouse, rat for KIAA0430
    Predesigned siRNA for gene silencing in human, mouse, rat KIAA0430
    Clone
    Products:
         
    OriGene clones in human, mouse for KIAA0430 (see all 11)
    OriGene ORF clones in mouse, rat for KIAA0430
    OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
    GenScript: all cDNA clones in your preferred vector (see all 3): KIAA0430 (NM_001184999)
    DNA2.0 Custom Codon Optimized Gene Synthesis Service for KIAA0430
    Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat KIAA0430
    Primer
    Products:
        
    OriGene qSTAR qPCR primer pairs in human, mouse for KIAA0430
    Pre-validated RT2 qPCR Primer Assay in human, mouse, rat KIAA0430
      QuantiTect SYBR Green Assays in human, mouse, rat KIAA0430
      QuantiFast Probe-based Assays in human, mouse, rat KIAA0430

    Additional mRNA sequence: 

    AB007890.3 AB012134.1 AK095840.1 AK302667.1 BC041135.1 BC064914.1 BC127740.1 BC137165.1 
    BC137170.1 BC139919.1 BC141831.1 BC144514.1 BC144515.1 

    18 DOTS entries:

    DT.100789349  DT.91650930  DT.99996282  DT.102841925  DT.91660434  DT.120692811  DT.100789347  DT.99958185 
    DT.115700  DT.91646734  DT.100849154  DT.120691899  DT.40288072  DT.100789350  DT.120691946  DT.120692782 
    DT.101984703  DT.91730123 

    Selected AceView cDNA sequences (see all 234):

    BX093887 BM824633 BU509021 CB215949 AI610832 AA742507 BE328710 BQ428127 
    AI381457 BX488442 CA397011 CB152660 BQ774860 BU620090 BQ055566 AA811738 
    AB012134 BQ015249 BM787509 AI863026 NM_019081 AI955157 AA810228 CK821911 

    GeneLoc Exon Structure

    Selected Alternative Splicing Database (ASD) splice patterns (SP) for KIAA0430 (see all 11)    About this scheme

    ExUns: 1 ^ 2a · 2b ^ 3 ^ 4a · 4b · 4c ^ 5 ^ 6 ^ 7 ^ 8 ^ 9 ^ 10a · 10b ^ 11 ^ 12 ^ 13 ^ 14a · 14b · 14c ^ 15a · 15b ^ 16 ^ 17a · 17b ^ 18 ^
    SP1:                                                                                                                                -                           
    SP2:                                                                                                                                                            
    SP3:                                                        -                                                                                                   
    SP4:                                                                                                                                                            
    SP5:                                                                                                                                                            

    ExUns: 19 ^ 20 ^ 21 ^ 22 ^ 23 ^ 24a · 24b ^ 25a · 25b · 25c ^ 26 ^ 27a · 27b · 27c ^ 28a · 28b
    SP1:                    -                       -     -                 -                           
    SP2:                                                                                                
    SP3:                                                                                                
    SP4:                                                                                                
    SP5:                                                                                                


    ECgene alternative splicing isoforms for KIAA0430

    (RNA expression data according to H-InvDB, NONCODE, miRBase, and RNAdb, Expression images according to data from BioGPS, Illumina Human BodyMap, and CGAP SAGE, Sets of similar genes according to GeneDecks, in vivo and in vitro expression data from LifeMap Discovery™, Protein expression images according to data from SPIRE 1MOPED, 2PaxDb, and 3MaxQB, plus additional links to SOURCE, and/or BioGPS, and/or UniProtKB,
    PCR Arrays from QIAGEN, Primers from OriGene, and/or QIAGEN, In Situ Hybridization Assays from Advanced Cell Diagnostics)
    About This Section

    TryGeneCards Plus

    KIAA0430 expression in normal human tissues (normalized intensities)
    See probesets specificity/sensitivity at GeneAnnot
    About this imageBioGPS <intensity>2/3
    CGAP TAG: TAAAGAGTGG
    KIAA0430 Expression
    About this image

    KIAA0430 Protein expression data from MOPED1, PaxDb2 and MaxQB3    About this image

    KIAA0430 Protein Expression

    SOURCE GeneReport for Unigene cluster: Hs.173524
        Custom PCR Arrays for KIAA0430
    Primer
    Products:
    OriGene qSTAR qPCR primer pairs in human, mouse for KIAA0430
    Pre-validated RT2 qPCR Primer Assay in human, mouse, rat KIAA0430
    QuantiTect SYBR Green Assays in human, mouse, rat KIAA0430
    QuantiFast Probe-based Assays in human, mouse, rat KIAA0430
    In Situ
    Assay Products:
     

     
    Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for KIAA0430

    (Orthologs according to 1,2HomoloGene (2older version, for species not in 1newer version), 3euGenes, 4SGD , 5MGI Mar 06 2013, with possible further links to Flybase and/or WormBase, and/or 6Ensembl pan taxonomic compara , Gene Trees according to Ensembl and TreeFam)
    About This Section

    TryGeneCards Plus

    This gene was present in the common ancestor of animals.

    Orthologs for KIAA0430 gene from Selected species (see all 13)    About this table
    Organism Taxonomic
    classification
    Gene Description Human
    Similarity
    Orthology
    Type
    Details
    mouse
    (Mus musculus)
    Mammalia Marf11 , 5 RIKEN cDNA 4921513D23 gene5
    meiosis arrest female 11
    85.22(n)1
    86.41(a)1
      16 (9.69 cM)5
    2239891  NM_001081154.21  NP_001074623.11 
     141091665 
    chicken
    (Gallus gallus)
    Aves KIAA04301 KIAA0430 76.35(n)
    79.39(a)
      416595  XM_414895.4  XP_414895.3 
    lizard
    (Anolis carolinensis)
    Reptilia KIAA04306
    KIAA0430
    45(a)
    1 ↔ 1
    GL343580.1(164099-213780)
    African clawed frog
    (Xenopus laevis)
    Amphibia Xl.49302 Xenopus laevis transcribed sequence with weak similarity more 75.41(n)    BG513834.1 
    zebrafish
    (Danio rerio)
    Actinopterygii Dr.103642 Transcribed sequence with weak similarity to protein more 72.26(n)    CK140063.1 
    fruit fly
    (Drosophila melanogaster)
    Insecta CG170186
    --
    23(a)
    1 ↔ 1
    2L(22311931-22368796)


    ENSEMBL Gene Tree for KIAA0430 (if available)
    TreeFam Gene Tree for KIAA0430 (if available)

    (Paralogs according to 1HomoloGene,
    2Ensembl, and 3SIMAP, Pseudogenes according to 4Pseudogene.org Build 68)
    About This Section

    TryGeneCards Plus
      --

    (SNPs/Variants according to the 1NCBI SNP Database, 2Ensembl, 3PupaSUITE, 4UniProtKB, and DNA2.0, Linkage Disequilibrium by HapMap, Structural Variations(CNVs/InDels/Inversions) from the Database of Genomic Variants, Mutations from the Human Gene Mutation Database (HGMD), the Human Cytochrome P450 Allele Nomenclature Database, and the Locus Specific Mutation Databases (LSDB), Blood group antigen gene mutations by BGMUT, Resequencing Primers, Cancer Mutation PCR Arrays and Assays, and Copy Number PCR Arrays from QIAGEN)
    About This Section

    TryGeneCards Plus

    Selected SNPs for KIAA0430 (see all 1160)    About this table    
    Genomic DataTranscription Related DataAllele Frequencies
    SNP IDValidClinical
    significance
    Chr 16 posSequence#AA
    Chg
    TypeMore#Allele
    freq
    PopTotal
    sample
    More
    ----------
    rs1402406051,2
    C--15120857(+) AACAC-/CACACAC 3 -- int10--------
    rs712931631,2
    C--15696480(+) AAGAA-/AGGAAAGAAGGAGGGAG
    GCAGAG
    /GGAG/GGCAGAG
    GGAGG
    3 -- int11NA 2
    rs612821231,2
    C--15696492(+) AAGGA-/G/GGCAGAGAGGAAAGAAGGA
    /GGGAGGCAGAGAGGAAAGAAGGA
    AGAGG
    3 -- int11NA 2
    rs283704381,2
    C,F--15696504(+) GAAAGG/AAAAGG 3 -- int1 trp31Minor allele frequency- A:0.50WA 2
    rs113581171,2
    C--15704423(+) AAAAG-/AAAAAA 3 -- int1 trp30--------
    rs2016592851,2
    C--15708649(+) AAAAA-/AGACAG 3 -- int10--------
    rs1116429961,2
    C,F--15708799(+) ATCATG/ACCTGA 3 -- int12Minor allele frequency- A:0.06WA 120
    rs613807671,2
    C--15720879(+) AGAGA-/AG/GA 
            
    AAGAA
    3 -- int10--------
    rs124473981,2
    C,F,H--15721162(+) GCTGGT/CGGCAG 3 -- ds500123Minor allele frequency- C:0.35NS EA NA WA CSA 2345
    rs1894628141,2
    --15721186(+) ATGGCA/GGTCTC 3 -- ds50010--------

    HapMap Linkage Disequilibrium report for KIAA0430 (15688226 - 15737023 bp)

    Structural Variations
         Database of Genomic Variants (DGV) 7 variations for KIAA0430:    About this table    
    Variant IDTypeSubtypePubMed ID
    esv2714015CNV Deletion23290073
    nsv435664CNV Deletion17901297
    nsv469626CNV Loss16826518
    nsv819327CNV Loss19587683
    nsv833147CNV Loss17160897
    nsv457428CNV Gain19166990
    dgv2610n71CNV Gain21882294

    Site Specific Mutation Identification with PCR Assays
    SeqTarget long-range PCR primers for resequencing KIAA0430
    DNA2.0 Custom Variant and Variant Library Synthesis for KIAA0430

    (in which this Gene is Involved, According to MalaCards, OMIM, UniProtKB, the University of Copenhagen DISEASES database, Conferences by KenesGroup, Genatlas, GeneTests, GAD, HuGE Navigator, and/or TGDB.)
    About This Section

    TryGeneCards Plus
    OMIM gene information: 614593    OMIM disorders: --


    KIAA0430 for disorders           About GeneDecksing


    Export disorders for KIAA0430 gene to outside databases

    (in PubMed. Associations of this gene to articles via 1Entrez Gene, 2UniProtKB/Swiss-Prot, 3HGNC, 4GAD, 5PharmGKB, 6HMDB, 7DrugBank, 8UniProtKB/TrEMBL, 9 Novoseek, and/or 10fRNAdb)
    About This Section

    TryGeneCards Plus

    PubMed articles for KIAA0430 gene, integrated from 10 sources (see all 22):
    (articles sorted by number of sources associating them with KIAA0430)
        Utopia: connect your pdf to the dynamic
    world of online information

    1. Limkain b1, a novel human autoantigen localized to a subset of ABCD3 and PXF marked peroxisomes. (PubMed id 15932519)1, 2, 3, 9 Dunster K.... Sentry J.W. (Clin. Exp. Immunol. 2005)
    2. Genome duplications and other features in 12 Mb of DNA sequence from human chromosome 16p and 16q. (PubMed id 10493829)1, 2, 3 Loftus B.J.... Adams M.D. (Genomics 1999)
    3. Prediction of the coding sequences of unidentified human genes. VIII. 78 new cDNA clones from brain which code for large proteins in vitro. (PubMed id 9455477)1, 2, 3 Ishikawa K.... Ohara O. (DNA Res. 1997)
    4. Meiosis arrest female 1 (MARF1) has nuage-like function in mammalian oocytes. (PubMed id 23090997)1, 3 Su Y.Q....Eppig J.J. (Proc. Natl. Acad. Sci. U.S.A. 2012)
    5. MARF1 regulates essential oogenic processes in mice. (PubMed id 22442484)1, 3 Su Y.Q....Eppig J.J. (Science 2012)
    6. The sequence and analysis of duplication-rich human chromosome 16. (PubMed id 15616553)1, 2 Martin J.... Pennacchio L.A. (Nature 2004)
    7. The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). (PubMed id 15489334)1, 2 Gerhard D.S.... Malek J. (Genome Res. 2004)
    8. Complete sequencing and characterization of 21,243 full-length human cDNAs. (PubMed id 14702039)1, 2 Ota T.... Sugano S. (Nat. Genet. 2004)
    9. Methods for quantification of in vivo changes in protein ubiquitination following proteasome and deubiquitinase inhibition. (PubMed id 22505724)1 Udeshi N.D....Carr S.A. (amp 2012)
    10. Systematic and quantitative assessment of the ubiquitin-modified proteome. (PubMed id 21906983)1 Kim W....Gygi S.P. (Mol. Cell 2011)

    (in PubMed, OMIM, and NCBI Bookshelf)
    About This Section

    TryGeneCards Plus
     ANDOR
    Aliases
    Free Text  

      Query String
    PubMed
    OMIM
    NCBI Bookshelf
      (Note: In FireFox, select the above section and copy using Ctrl-C)

    (According to Entrez Gene, HGNC, AceView, euGenes, Ensembl, miRBase, ECgene, Kegg, and/or H-InvDB)
    About This Section

    TryGeneCards Plus
    Entrez Gene: 9665 HGNC: 29562 AceView: LKAP Ensembl:ENSG00000166783 euGenes: HUgn9665
    ECgene: KIAA0430 H-InvDB: KIAA0430

    (According to HUGE)
    About This Section

    TryGeneCards Plus
    HUGE: KIAA0430

    (According to PharmGKB, ATLAS, HORDE, IMGT, LEIDEN, UniProtKB/Swiss-Prot, UniProtKB/TrEMBL, and/or others, e.g. Wikipedia and GeneReviews, via UniProtKB/Swiss-Prot)
    About This Section

    TryGeneCards Plus
    NameDescription
    PharmGKB entry for KIAA0430 Pharmacogenomics, SNPs, Pathways

    (Patent information from GeneIP,
    Licensable technologies from WIS Yeda, Salk, Tufts,
    IP news from LifeMap Sciences, Inc.)
    About This Section

    TryGeneCards Plus
    Patent Information for KIAA0430 gene:
    Search GeneIP for patents involving KIAA0430

    GeneCards and IP:
    Japan Patent Office Licenses GeneCards     European Patent Office Licenses GeneCards     Improving the IP Search



    (Antibodies, recombinant proteins, and assays from EMD Millipore, R&D Systems, OriGene, QIAGEN, GenScript, Cell Signaling Technology, Novus Biologicals, Sino Biological, Enzo Life Sciences, Abcam, ProSpec, Cloud-Clone Corp., Thermo Fisher Scientific, LSBio, Gene Editing from DNA2.0. Clones from OriGene, GenScript, Sino Biological, DNA2.0, SwitchGear Genomics, Vector BioLabs, Cell lines from GenScript, and ESI BIO, PCR Arrays from QIAGEN, Drugs and/or compounds from EMD Millipore, Tocris Bioscience, Enzo Life Sciences, and/or ApexBio, In Situ Hybridization Assays from
    Advanced Cell Diagnostics, Animal models from inGenious Targeting Laboratory, genOway)
    About This Section

    TryGeneCards Plus

     
     EMD Millipore genomic analysis products

      
     Browse Antibodies   Browse Cell Culture Products  
     Browse ELISAs   Browse Flow Cytometry Kits  
     Browse Primer Pairs   Browse Enzyme Activity Assays/Reagents  
     Browse ELISpot/FluoroSpot Kits/Development Modules   Browse TFB/Immunoprecipitation Assays  
     Browse Apoptosis Detection Kits/Reagents   Browse Ubiquitin Proteasome Pathway (UPP) Assay Kits/Reagents  
     Browse DNA Damage/Repair Kits/Reagents   Browse Luminex Assays  
     Browse Cell Selection/Detection Kits/Reagents   Browse Secondary Antibodies/Controls/Staining Reagents  
     Browse Recombinant/Natural Proteins   Browse Stem Cell Products  
     Browse cDNA Clones   Browse Proteome Profiler Antibody Arrays  
     Browse OriGene Antibodies   OriGene RNAi products in human, mouse, rat for KIAA0430  
     Browse OriGene qPCR primer pairs and template standards   Browse OriGene Protein Over-expression Lysates  
     OriGene Custom Mass Spec   OriGene clones in human, mouse for KIAA0430  
     OriGene qSTAR qPCR primer pairs in human, mouse for KIAA0430   Browse OriGene full length recombinant human proteins expressed in human HEK293 cells  
     OriGene ORF clones in mouse, rat for KIAA0430   OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling  
     OriGene Custom Antibody Services for KIAA0430   OriGene Custom Protein Services for KIAA0430  

     
     
     Block miRNA regulation of human, mouse, rat KIAA0430 using miScript Target Protectors SeqTarget long-range PCR primers for resequencing KIAA0430
     DNA Methylation CpG Assay Predesigned for Pyrosequencing in human, mouse, rat KIAA0430 Predesigned siRNA for gene silencing in human, mouse, rat KIAA0430
     QuantiFast Probe-based Assays in human, mouse, rat KIAA0430 QuantiTect SYBR Green Assays in human, mouse, rat KIAA0430
     Custom PCR Arrays for KIAA0430 Search Chromatin IP Primers for KIAA0430
     Pre-validated RT2 qPCR Primer Assay in human, mouse, rat KIAA0430  Search GeneGlobe Interaction Network for KIAA0430
     Regulatory tfbs in KIAA0430 promoter
     GenScript Custom Purified and Recombinant Proteins Services for KIAA0430 GenScript cDNA clones with any tag delivered in your preferred vector for KIAA0430
     GenScript Custom Assay Services for KIAA0430 GenScript Custom overexpressing Cell Line Services for KIAA0430
     CloneReady with Over 120,000 Genes  Gene Synthesis: Any Gene in Any Vector
     Vector-based siRNA and miRNA, Ready for Transfection Gene Mutant Library, Variants up to 10^11
     Plasmid Preparation Custom Peptide Services
     Search for Antibodies & Assays

     Search Tocris compounds for KIAA0430 (MARF1)
     Browse Sino Biological Proteins
     Browse Sino Biological Cell Lysates
     Browse Sino Biological cDNA Clones
     4000+ Proteins
     Search Sino Biological for antibodies, proteins & pathways
     Protein Production Services
     Transfection Reagents
     Protein A/G/L resins
     Isotyping reagents
     Search www.enzolifesciences.com for proteins, assays, substrates, inhibitors & antibodies

     Novus Tissue Slides
     KIAA0430 antibodies
     KIAA0430 lysates
     Antibodies for KIAA0430
     See all of Abcam's Antibodies, Kits and Proteins for KIAA0430
     Custom Antibody / Protein Production Service
     Bulk Purchasing
     Advantages of Rabbit Monoclonal antibodies
     Abcam protocols and scientific support
     Browse ProSpec Recombinant Proteins
     Browse Proteins at Cloud-Clone Corp.
     Browse Antibodies at Cloud-Clone Corp.
     Browse ELISAs at Cloud-Clone Corp.
     Browse CLIAs at Cloud-Clone Corp.



     Browse ESI BIO Cell Lines and PureStem Progenitors for KIAA0430
     Gene Synthesis
     Protein Engineering
     Variant Library Synthesis
     Codon Optimization
     Protein Production and Purification
     Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for KIAA0430
     SwitchGear 3'UTR luciferase reporter plasmids for KIAA0430
     SwitchGear Promoter luciferase reporter plasmids for KIAA0430
     Search ThermoFisher Antibodies for KIAA0430
     Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat KIAA0430
     inGenious Targeting Laboratory: Let us create your new Knockout/Knockin mouse model for KIAA0430
     inGenious Targeting Laboratory: Contact us about creating complex and humanized mouse models for KIAA0430
     Search LSBio for Antibodies for KIAA0430
    Customized transgenic rodents for:
     Humanization
     Biomarker expression
     Off-target effect monitoring
     Translational medicine
     Tissue-specific gene expresssion
     Time-controlled gene expresssion
     Browse compounds at ApexBio
           
    GeneCards Homepage - Last full update: 7 May 2014 - Incrementals: 9 May 2014 , 2 Jun 2014 , 26 Jun 2014 , 30 Jun 2014

    View Random Gene

    Category
    (GIFtS: )
    GIFtS Group
    The GeneCards human gene database gene index: 1 3 5 A B C D E F G H I J K L M N O P Q R S T U V W X Y Z 


    Developed at the Crown Human Genome Center, Department of Molecular Genetics, the Weizmann Institute of Science

    Hot genes      Disease genes      KIAA0430 gene at Home site.
    Version: 3.12.142 28 July 2014
    hostname: 356977-web1.xennexinc.com index build: 126 solr: 1.4