Set Analyses:
Advanced Search

Advanced Search

 
Search By
Section (entire)
for


 
or upload a file of gene symbols


Category   Symbol Source: HGNC EntrezGene Ensembl GeneCards RNA genes CroW21
GIFtS

KIAA0430 Gene

protein-coding   GIFtS: 45
GCID: GC16M015596

KIAA0430

  Search for KIAA0430
at  

(According to 1HGNC, 2Entrez Gene,
3UniProtKB/Swiss-Prot, 4UniProtKB/TrEMBL, 5OMIM, 6GeneLoc, 7Ensembl, 8DME, 9miRBase, 10fRNAdb, 12H-InvDB, 13NCBI, 14NONCODE, and/or 15RNAdb)
About This Section

Aliases
KIAA04301 2     Regulatory Subunit 341
Limkain B11 2     PPP1R342
Meiosis Arrest Female 11 2     limkain-b12
LKAP2 3     Meiosis Arrest Female Protein 12
MARF12 3     Protein Phosphatase 1, Regulatory Subunit 342
Protein Phosphatase 11     Limkain-b13

External Ids:    HGNC: 295621   Entrez Gene: 96652   Ensembl: ENSG000001667837   OMIM: 6145935   UniProtKB: Q9Y4F33   

Export aliases for KIAA0430 gene to outside databases

Previous GC identifer: GC16M015083


(According to Entrez Gene, Tocris Bioscience, Wikipedia's Gene Wiki, PharmGKB,
UniProtKB/Swiss-Prot, and/or UniProtKB/TrEMBL)
About This Section

Entrez Gene summary for KIAA0430 Gene:
This gene encodes a putative peroxisomal protein that appears to be conserved across Euteleostomi. In humans, it
may be autoantigenic. (provided by RefSeq, Jul 2010)

GeneCards Summary for KIAA0430 Gene: 
KIAA0430 (KIAA0430) is a protein-coding gene. GO annotations related to this gene include molecular_function and nucleotide binding.

UniProtKB/Swiss-Prot: MARF1_HUMAN, Q9Y4F3
Function: Essential regulator of oogenesis required for female meiotic progression. Acts by down-regulating RNA
transcripts, either at transcriptional of post-transcriptional level (By similarity)

Gene Wiki entry for KIAA0430 Gene


(According to GeneLoc and/or HGNC, and/or
Entrez Gene (NCBI build 37),
and/or miRBase,
Genomic Views according to UCSC (hg19) and Ensembl (release 73), Regulatory elements and Epigenetics data according to QIAGEN, SABiosciences, and/or SwitchGear Genomics)
About This Section
RefSeq DNA sequence:
NC_000016.9  NT_010393.16  NC_018927.2  
Regulatory elements:
   SABiosciences Regulatory transcription factor binding sites in the KIAA0430 gene promoter:
         Elk-1   ISGF-3   p300   Lmo2   NF-kappaB   C/EBPalpha   AREB6   NF-kappaB1   TGIF   NF-Y   
         Other transcription factors

SwitchGear Promoter luciferase reporter plasmidKIAA0430 promoter sequence
   Search SABiosciences Chromatin IP Primers for KIAA0430

Epigenetics:
QIAGEN PyroMark CpG Assay predesigned Pyrosequencing DNA Methylation assays in human, mouse, rat KIAA0430


Genomic Location:
Genomic View: UCSC Golden Path with GeneCards custom track

Entrez Gene cytogenetic band: 16p13.11   Ensembl cytogenetic band:  16p13.11   HGNC cytogenetic band: 16p13.11

KIAA0430 Gene in genomic location: bands according to Ensembl, locations according to (and/or Entrez Gene and/or Ensembl if different)
KIAA0430 gene location

GeneLoc information about chromosome 16         GeneLoc Exon Structure

GeneLoc location for GC16M015596:  view genomic region     (about GC identifiers)

Start:
15,688,226 bp from pter      End:
15,737,023 bp from pter
Size:
48,798 bases      Orientation:
minus strand

(According to UniProtKB, HORDE, neXtProt, Ensembl, and/or Reactome, Modification sites according to PhosphoSitePlus, Specific Peptides from DME, Protein expression images according to data from SPIRE 1MOPED, 2PaxDb, and 3MAXQB RefSeq according to NCBI, PDB rendering according to OCA and/or Proteopedia, Recombinant Proteins from EMD Millipore, R&D Systems, GenScript, Enzo Life Sciences, OriGene, Novus Biologicals, Sino Biological, ProSpec, and/or Cloud-Clone Corp.,
Biochemical Assays by EMD Millipore, R&D Systems, OriGene, GenScript, Cell Signaling Technology, Enzo Life Sciences, and/or Cloud-Clone Corp., Ontologies according to Gene Ontology Consortium 01 Oct 2013 and Entrez Gene, Antibodies by EMD Millipore, R&D Systems, GenScript, Cell Signaling Technology, OriGene, Novus Biologicals, Thermo Fisher Scientific, LSBio, Abcam, and/or Cloud-Clone Corp.)
About This Section

UniProtKB/Swiss-Prot: MARF1_HUMAN, Q9Y4F3 (See protein sequence)
Recommended Name: Meiosis arrest female protein 1  
Size: 1742 amino acids; 192859 Da
Subunit: Interacts with LIMK2
Subcellular location: Peroxisome
Sequence caution: Sequence=AAC31662.1; Type=Erroneous gene model prediction; Sequence=AAH64914.2;
Type=Miscellaneous discrepancy; Note=Contaminating sequence. Potential poly-A sequence; Sequence=EAW53920.1;
Type=Erroneous gene model prediction;
2 PDB 3D structures from and Proteopedia for KIAA0430:
2DGX (3D)        2DIU (3D)    
Secondary accessions: A8MSK2 B2RNX2 B4DYY9 B7ZMG1 B7ZMG2 F8VV09 Q6P1R6 Q8WYR2 Q9Y4J9
Alternative splicing: 5 isoforms:  Q9Y4F3-1   Q9Y4F3-3   Q9Y4F3-4   Q9Y4F3-5   Q9Y4F3-6   (May be due to an intron retention)

Explore the universe of human proteins at neXtProt for KIAA0430: NX_Q9Y4F3

Explore proteomics data for KIAA0430 at MOPED 

Post-translational modifications:

  • View modification sites using PhosphoSitePlus
  • View neXtProt modification sites for NX_Q9Y4F3

  • KIAA0430 Protein expression data from MOPED1, PaxDb2 and MAXQB3 :    About this image 

    KIAA0430 Protein Expression
    REFSEQ proteins (3 alternative transcripts): 
    NP_001171927.1  NP_001171928.1  NP_055462.2  

    ENSEMBL proteins: 
     ENSP00000379654   ENSP00000439819   ENSP00000449376   ENSP00000450309   ENSP00000473601  
     ENSP00000449050   ENSP00000449329   ENSP00000448495   ENSP00000341939  

    Human Recombinant Protein Products for KIAA0430: 
    Browse Purified and Recombinant Proteins at EMD Millipore
    Browse R&D Systems for human recombinant proteins
    Browse recombinant and purified proteins available from Enzo Life Sciences
    Browse OriGene full length recombinant human proteins expressed in human HEK293 cells
    Browse OriGene Protein Over-expression Lysates
    OriGene Custom MassSpec 
    OriGene Custom Protein Services for KIAA0430
    GenScript Custom Purified and Recombinant Proteins Services for KIAA0430
    Novus Biologicals KIAA0430 Lysate
    Browse Sino Biological Recombinant Proteins
    Browse Sino Biological Cell Lysates 
    Browse ProSpec Recombinant Proteins
    Browse Proteins at Cloud-Clone Corp. 

    Gene Ontology (GO): 1 cellular component term (GO ID links to tree view):    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0005777peroxisome IDA15932519

    KIAA0430 for ontologies           About GeneDecksing



    KIAA0430 Antibody Products: 
    Browse EMD Millipore's Extensive Line of Mono- and Polyclonal Antibodies
    Browse R&D Systems for Antibodies
    Browse OriGene Antibodies
    OriGene Custom Antibody Services for KIAA0430
    GenScript Custom Superior Antibodies Services for KIAA0430
    Novus Biologicals KIAA0430 Antibodies
    Abcam antibodies for KIAA0430
    Browse Antibodies at Cloud-Clone Corp. 
    Search ThermoFisher Antibodies for KIAA0430
    Search LSBio for Antibodies for KIAA0430 

    Assay Products for KIAA0430: 
    Browse Kits and Assays available from EMD Millipore
    OriGene Custom Assay Services for KIAA0430
    Browse R&D Systems for biochemical assays
    GenScript Custom Assay Services for KIAA0430
    Browse Enzo Life Sciences for kits & assays
    Browse ELISAs at Cloud-Clone Corp. 
    Browse CLIAs at Cloud-Clone Corp.


    (According to HGNC, IUPHAR, InterPro, ProtoNet, UniProtKB, and/or BLOCKS, Sets of similar genes according to GeneDecks)
    About This Section
    HGNC Gene Families: 
    PPP1R: Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits

    5/6 InterPro protein domains (see all 6):
     IPR025605 OST-HTH/LOTUS_dom
     IPR024768 Limkain-b1
     IPR021139 NYN_limkain-b1
     IPR024582 Limkain_b1_cons_dom
     IPR000504 RRM_dom

    Graphical View of Domain Structure for InterPro Entry Q9Y4F3

    ProtoNet protein and cluster: Q9Y4F3

    UniProtKB/Swiss-Prot: MARF1_HUMAN, Q9Y4F3
    Similarity: Contains 8 HTH OST-type domains
    Similarity: Contains 1 NYN domain
    Similarity: Contains 1 RRM (RNA recognition motif) domain


    KIAA0430 for domains           About GeneDecksing


    (According to 1UniProtKB, Genatlas, LifeMap Discovery™, IUBMB, and/or 2DME, Human phenotypes from GenomeRNAi, Animal models from MGI Mar 06 2013, inGenious Targeting Laboratory, genOway,
    bound targets from SABiosciences, miRNA Gene Targets from miRTarBase, shRNA from OriGene, RNAi from EMD Millipore, siRNAs from OriGene, QIAGEN, microRNA from QIAGEN, Gene Editing from DNA2.0, Sirion Biotech, Clones from EMD Millipore, OriGene, SwitchGear Genomics, GenScript, Sino Biological, DNA2.0, Vector BioLabs, and Sirion Biotech, Cell Lines from GenScript, LifeMap BioReagents, In Situ Hybridization Assays from Advanced Cell Diagnostics, Ontologies according to Gene Ontology Consortium 01 Oct 2013 via Entrez Gene.)
    About This Section

    Molecular Function:

         UniProtKB/Swiss-Prot Summary: MARF1_HUMAN, Q9Y4F3
    Function: Essential regulator of oogenesis required for female meiotic progression. Acts by down-regulating RNA
    transcripts, either at transcriptional of post-transcriptional level (By similarity)

         Gene Ontology (GO): 4 molecular function terms (GO ID links to tree view):    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0000166nucleotide binding IEA--
    GO:0003674molecular_function ND--
    GO:0003676nucleic acid binding ----
    GO:0003723RNA binding IEA--
         
    KIAA0430 for ontologies           About GeneDecksing


    Phenotypes:
         2 GenomeRNAi human phenotypes for KIAA0430:
     Increased S DNA content  Increased number of mitotic ce 

         1 MGI mutant phenotype (inferred from 2 alleles(MGI details for Marf1):
     reproductive system 

    KIAA0430 for phenotypes           About GeneDecksing

    Animal Models:
       inGenious Targeting Laboratory - Custom generated mouse model solutions for KIAA0430 
       inGenious Targeting Laboratory - Custom generated inducible mouse model solutions for KIAA0430

       genOway customized KO model: permanent, tissue-specific or time-controlled inactivation for KIAA0430 
       genOway customized Knockin model: humanization, point mutation, expression monitoring, etc. for KIAA0430 

    miRNA
    Products:
        
    QIAGEN Custom miScript Target Protector blocks miRNA-binding site of human, mouse, rat KIAA0430
    8/15 QIAGEN miScript miRNA Assays for microRNAs that regulate KIAA0430 (see all 15):
    hsa-miR-549 hsa-miR-448 hsa-miR-224 hsa-miR-429 hsa-miR-561 hsa-miR-1324 hsa-miR-133b hsa-miR-491-3p
    SwitchGear 3'UTR luciferase reporter plasmidKIAA0430 3' UTR sequence
    Inhib. RNA
    Products:
        
    Browse for Gene Knock-down Tools from EMD Millipore
    OriGene RNAi products in human, mouse, rat for KIAA0430
    QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat KIAA0430

    Gene Editing
    Products:
    DNA2.0 Custom Protein Engineering Service for KIAA0430
    Sirion Biotech Customized adenovirus for overexpression of KIAA0430

    Clone
    Products:
         
    Browse Clones for the Expression of Recombinant Proteins Available from EMD Millipore
    OriGene clones in human, mouse for KIAA0430 (see all 11)
    OriGene ORF clones in mouse, rat for KIAA0430
    OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
    GenScript: all cDNA clones in your preferred vector (see all 3): KIAA0430 (NM_001184999)
    Browse Sino Biological Human cDNA Clones
    DNA2.0 Custom Codon Optimized Gene Synthesis Service for KIAA0430
    Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat KIAA0430

    Cell Line
    Products:
         
    GenScript Custom overexpressing Cell Line Services for KIAA0430
    Search LifeMap BioReagents cell lines for KIAA0430
    In Situ Assay
    Products:
       

     
    Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for KIAA0430


    (Pathways according to EMD Millipore, R&D Systems, Cell Signaling Technology, KEGG, PharmGKB, BioSystems, Sino Biological, Reactome, Tocris Bioscience, GeneGo (Thomson Reuters), QIAGEN, and/or UniProtKB, Sets of similar genes according to GeneDecks, Interaction Networks according to SABiosciences, and/or STRING, Interactions according to 1UniProtKB, 2MINT, 3I2D, and/or 4STRING, with links to IntAct and Ensembl, Ontologies according to Gene Ontology Consortium 01 Oct 2013 via Entrez Gene).
    About This Section



    Interactions:

        Search SABiosciences Gene Network CentralTM Interacting Genes and Proteins Networks for KIAA0430

    STRING Interaction Network Preview (showing 4 interactants - click image to see more details)

    5 Interacting proteins for KIAA0430 (Q9Y4F33 ENSP000003796544) via UniProtKB, MINT, STRING, and/or I2D
    InteractantInteraction Details
    GeneCardExternal ID(s)
    TERF2Q155543, ENSP000002549424I2D: score=1 STRING: ENSP00000254942
    GRB2P629933I2D: score=2 
    PPP1CAENSP000003260314STRING: ENSP00000326031
    ELAVL1ENSP000003852694STRING: ENSP00000385269
    UBCENSP000003448184STRING: ENSP00000344818
    About this table

    Gene Ontology (GO): 5 biological process terms (GO ID links to tree view):    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0007143female meiosis ISS--
    GO:0010468regulation of gene expression ISS--
    GO:0010923negative regulation of phosphatase activity IDA19389623
    GO:0030154cell differentiation IEA--
    GO:0048477oogenesis ISS--

    KIAA0430 for ontologies           About GeneDecksing



    (Chemical Compounds according to UniProtKB, Enzo Life Sciences, EMD Millipore, Tocris Bioscience HMDB, BitterDB, and/or Novoseek, Ligands according to IUPHAR, and Drugs according to DrugBank, Enzo Life Sciences, and/or PharmGKB, with drugs/clinical trials/news search links to CenterWatch)
    About This Section
    Browse Small Molecules at EMD Millipore
    Browse drugs & compounds from Enzo Life Sciences

    Browse Tocris compounds for KIAA0430 (MARF1)

    Search CenterWatch for drugs/clinical trials and news about KIAA0430 / MARF1

    (Secondary structures according to fRNAdb,
    GenBank/EMBL/DDBJ Accessions according to
    Unigene (Build 236 Homo sapiens; Apr 25 2013) or GenBank,
    RefSeq according to Entrez Gene,
    DOTS (version 10), and/or AceView, transcript ids from Ensembl with links to UCSC,
    Conferences by KenesGroup, exon structure from GeneLoc, alternative splicing isoforms according to ASD and/or ECgene,
    RNAi Products from EMD Millipore,
    siRNAs from OriGene, QIAGEN, shRNA from OriGene, microRNA from QIAGEN,
    Tagged/untagged cDNA clones from OriGene, SwitchGear Genomics, GenScript, DNA2.0, Vector BioLabs, Sirion Biotech, Primers from OriGene, SABiosciences, and/or QIAGEN )
    About This Section

    REFSEQ mRNAs for KIAA0430 gene (4 alternative transcripts): 
    NM_019081.2  NM_001184998.1  NM_001184999.1  NM_014647.3  

    Unigene Cluster for KIAA0430:

    KIAA0430
    Hs.173524  [show with all ESTs]
    Unigene Representative Sequence: NM_014647
    17 Ensembl transcripts including schematic representations, and UCSC links where relevant:
    ENST00000396368(uc002ddq.3 uc002ddr.3 uc010uzv.2 uc010uzw.2)
    ENST00000540441 ENST00000552771 ENST00000548025 ENST00000551742 ENST00000602337
    ENST00000551878 ENST00000552553 ENST00000551579 ENST00000549337 ENST00000547936
    ENST00000552535 ENST00000546864 ENST00000551678 ENST00000548216(uc010uzx.2)
    ENST00000549219 ENST00000344181
    miRNA
    Products:
         
    QIAGEN Custom miScript Target Protector blocks miRNA-binding site of human, mouse, rat KIAA0430
    8/15 QIAGEN miScript miRNA Assays for microRNAs that regulate KIAA0430 (see all 15):
    hsa-miR-549 hsa-miR-448 hsa-miR-224 hsa-miR-429 hsa-miR-561 hsa-miR-1324 hsa-miR-133b hsa-miR-491-3p
    SwitchGear 3'UTR luciferase reporter plasmidKIAA0430 3' UTR sequence
    Inhib. RNA
    Products:
         
    Browse for Gene Knock-down Tools from EMD Millipore
    OriGene RNAi products in human, mouse, rat for KIAA0430
    QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat KIAA0430
    Clone
    Products:
         
    OriGene clones in human, mouse for KIAA0430 (see all 11)
    OriGene ORF clones in mouse, rat for KIAA0430
    OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
    GenScript: all cDNA clones in your preferred vector (see all 3): KIAA0430 (NM_001184999)
    DNA2.0 Custom Codon Optimized Gene Synthesis Service for KIAA0430
    Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat KIAA0430
    Primer
    Products:
        
    OriGene qSTAR qPCR primer pairs in human, mouse for KIAA0430
    SABiosciences RT2 qPCR Primer Assay in human, mouse, rat KIAA0430
      QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat KIAA0430
      QIAGEN QuantiFast Probe-based Assays in human, mouse, rat KIAA0430

    Additional mRNA sequence: 

    AB007890.3 AB012134.1 AK095840.1 AK302667.1 BC041135.1 BC064914.1 BC127740.1 BC137165.1 
    BC137170.1 BC139919.1 BC141831.1 BC144514.1 BC144515.1 

    18 DOTS entries:

    DT.100789349  DT.91650930  DT.99996282  DT.102841925  DT.91660434  DT.120692811  DT.100789347  DT.99958185 
    DT.115700  DT.91646734  DT.100849154  DT.120691899  DT.40288072  DT.100789350  DT.120691946  DT.120692782 
    DT.101984703  DT.91730123 

    24/234 AceView cDNA sequences (see all 234):

    BQ642407 BM824633 AI141883 BE328710 BU179077 BU509021 AI953913 BU607280 
    AA134255 AU121452 AA811738 BU620090 BM453952 BM795066 CA392497 AB012134 
    AI695046 BQ029920 CB137928 BX093887 AA865755 AI610832 AI955157 BE763124 

    GeneLoc Exon Structure

    5/11 Alternative Splicing Database (ASD) splice patterns (SP) for KIAA0430 (see all 11)    About this scheme

    ExUns: 1 ^ 2a · 2b ^ 3 ^ 4a · 4b · 4c ^ 5 ^ 6 ^ 7 ^ 8 ^ 9 ^ 10a · 10b ^ 11 ^ 12 ^ 13 ^ 14a · 14b · 14c ^ 15a · 15b ^ 16 ^ 17a · 17b ^ 18 ^
    SP1:                                                                                                                                -                           
    SP2:                                                                                                                                                            
    SP3:                                                        -                                                                                                   
    SP4:                                                                                                                                                            
    SP5:                                                                                                                                                            

    ExUns: 19 ^ 20 ^ 21 ^ 22 ^ 23 ^ 24a · 24b ^ 25a · 25b · 25c ^ 26 ^ 27a · 27b · 27c ^ 28a · 28b
    SP1:                    -                       -     -                 -                           
    SP2:                                                                                                
    SP3:                                                                                                
    SP4:                                                                                                
    SP5:                                                                                                


    ECgene alternative splicing isoforms for KIAA0430

    (RNA expression data according to H-InvDB, NONCODE, miRBase, and RNAdb, Expression images according to data from BioGPS, Illumina Human BodyMap, and CGAP SAGE, Sets of similar genes according to GeneDecks, in vivo and in vitro expression data from LifeMap Discovery™, plus additional links to Genevestigator, and/or SOURCE, and/or BioGPS, and/or UniProtKB,
    PCR Arrays from SABiosciences, Primers from OriGene, SABiosciences, and/or QIAGEN, In Situ Hybridization Assays from Advanced Cell Diagnostics)
    About This Section

    KIAA0430 expression in normal human tissues (normalized intensities)
    See probesets specificity/sensitivity at GeneAnnot
    About this imageBioGPS <intensity>2/3
    CGAP TAG: TAAAGAGTGG
    KIAA0430 Expression
    About this image


    See KIAA0430 Protein Expression from SPIRE MOPED and PaxDB
    Genevestigator expression for KIAA0430

    SOURCE GeneReport for Unigene cluster: Hs.173524
        SABiosciences Custom PCR Arrays for KIAA0430
    Primer
    Products:
    OriGene qSTAR qPCR primer pairs in human, mouse for KIAA0430
    SABiosciences RT2 qPCR Primer Assay in human, mouse, rat KIAA0430
    QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat KIAA0430
    QIAGEN QuantiFast Probe-based Assays in human, mouse, rat KIAA0430
    In Situ
    Assay Products:
     

     
    Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for KIAA0430

    (Orthologs according to 1,2HomoloGene (2older version, for species not in 1newer version), 3euGenes, 4SGD , 5MGI Mar 06 2013, with possible further links to Flybase and/or WormBase, and/or 6Ensembl pan taxonomic compara , Gene Trees according to Ensembl and TreeFam)
    About This Section

    This gene was present in the common ancestor of animals.

    Orthologs for KIAA0430 gene from 6/14 species (see all 14)    About this table
    Organism Taxonomic
    classification
    Gene Description Human
    Similarity
    Orthology
    Type
    Details
    mouse
    (Mus musculus)
    Mammalia Marf11 , 5 RIKEN cDNA 4921513D23 gene5
    meiosis arrest female 11
    85.25(n)1
    86.52(a)1
      16 (9.69 cM)5
    2239891  NM_001081154.21  NP_001074623.11 
     141091665 
    chicken
    (Gallus gallus)
    Aves MARF11 KIAA0430 76.43(n)
    79.5(a)
      416595  XM_414895.3  XP_414895.3 
    lizard
    (Anolis carolinensis)
    Reptilia KIAA04306
    KIAA04306
    KIAA0430
    75(a)
    45(a)
    possible ortholog
    1 ↔ 1
    AAWZ02038395(964-11788)
    GL343580.1(164099-213780)
    African clawed frog
    (Xenopus laevis)
    Amphibia Xl.49302 Xenopus laevis transcribed sequence with weak similarity more 75.41(n)    BG513834.1 
    zebrafish
    (Danio rerio)
    Actinopterygii Dr.103642 Transcribed sequence with weak similarity to protein more 72.26(n)    CK140063.1 
    fruit fly
    (Drosophila melanogaster)
    Insecta CG170186
    --
    22(a)
    1 ↔ 1
    2L(22311931-22368796)


    ENSEMBL Gene Tree for KIAA0430 (if available)
    TreeFam Gene Tree for KIAA0430 (if available)

    (Paralogs according to 1HomoloGene,
    2Ensembl, and 3SIMAP, Pseudogenes according to 4Pseudogene.org Build 68)
    About This Section
      --

    (SNPs/Variants according to the 1NCBI SNP Database, 2Ensembl, 3PupaSUITE, 4UniProtKB, and DNA2.0, Linkage Disequilibrium by HapMap, Structural Variations(CNVs/InDels/Inversions) from the Database of Genomic Variants, Mutations from the Human Gene Mutation Database (HGMD) and the Locus Specific Mutation Databases (LSDB), Blood group antigen gene mutations by BGMUT, Resequencing Primers from QIAGEN, Cancer Mutation PCR Arrays and Assays and Copy Number PCR Arrays from SABiosciences)
    About This Section

    10/1160 SNPs in KIAA0430 are shown (see all 1160)    About this table     
    Genomic DataTranscription Related DataAllele Frequencies
    SNP IDValidClinical
    significance
    Chr 16 posSequence#AA
    Chg
    TypeMore#Allele
    freq
    PopTotal
    sample
    More
    ----------
    rs1402406051,2
    C--15120857(+) AACAC-/CACACAC 3 -- int10--------
    rs712931631,2
    C--15696480(+) AAGAA-/AGGAAAGAAGGAGGGAG
    GCAGAG
    /GGAG/GGCAGAG
    GGAGG
    3 -- int11NA 2
    rs612821231,2
    C--15696492(+) AAGGA-/G/GGCAGAGAGGAAAGAAGGA
    /GGGAGGCAGAGAGGAAAGAAGGA
    AGAGG
    3 -- int11NA 2
    rs283704381,2
    C,F--15696504(+) GAAAGG/AAAAGG 3 -- int1 trp31Minor allele frequency- A:0.50WA 2
    rs113581171,2
    C--15704423(+) AAAAG-/AAAAAA 3 -- int1 trp30--------
    rs2016592851,2
    C--15708649(+) AAAAA-/AGACAG 3 -- int10--------
    rs1116429961,2
    C,F--15708799(+) ATCATG/ACCTGA 3 -- int12Minor allele frequency- A:0.06WA 120
    rs613807671,2
    C--15720879(+) AGAGA-/AG/GA 
            
    AAGAA
    3 -- int10--------
    rs124473981,2
    C,F,H--15721162(+) GCTGGT/CGGCAG 3 -- ds500123Minor allele frequency- C:0.35NS EA NA WA CSA 2345
    rs1894628141,2
    --15721186(+) ATGGCA/GGTCTC 3 -- ds50010--------

    HapMap Linkage Disequilibrium report for KIAA0430 (15688226 - 15737023 bp)

    Structural Variations
         Database of Genomic Variants (DGV) 7 variations for KIAA0430:    About this table     
    Variant IDTypeSubtypePubMed ID
    esv2714015CNV Deletion23290073
    nsv435664CNV Deletion17901297
    nsv469626CNV Loss16826518
    nsv819327CNV Loss19587683
    nsv833147CNV Loss17160897
    nsv457428CNV Gain19166990
    dgv2610n71CNV Gain21882294

    SABiosciences Cancer Mutation PCR Assays
    SeqTarget long-range PCR primers for resequencing KIAA0430
    DNA2.0 Custom Variant and Variant Library Synthesis for KIAA0430

    (in which this Gene is Involved, According to MalaCards, OMIM, UniProtKB, the University of Copenhagen DISEASES database, Conferences by KenesGroup, Genatlas, GeneTests, GAD, HuGE Navigator, and/or TGDB.)
    About This Section

    KIAA0430 for disorders           About MalaCards
    OMIM gene information: 614593    OMIM disorders: --


    KIAA0430 for disorders           About GeneDecksing


    Export disorders for KIAA0430 gene to outside databases

    (in PubMed. Associations of this gene to articles via 1Entrez Gene, 2UniProtKB/Swiss-Prot, 3HGNC, 4GAD, 5PharmGKB, 6HMDB, 7DrugBank, 8UniProtKB/TrEMBL, 9 Novoseek, and/or 10fRNAdb)
    About This Section

    PubMed articles for KIAA0430 gene, integrated from 9 sources (see all 22):
    (articles sorted by number of sources associating them with KIAA0430)
        Utopia: connect your pdf to the dynamic
    world of online information

    1. Limkain b1, a novel human autoantigen localized to a subset of ABCD3 and PXF marked peroxisomes. (PubMed id 15932519)1, 2, 3, 9 Dunster K.... Sentry J.W. (2005)
    2. Genome duplications and other features in 12 Mb of DNA sequence from human chromosome 16p and 16q. (PubMed id 10493829)1, 2, 3 Loftus B.J.... Adams M.D. (1999)
    3. Prediction of the coding sequences of unidentified human genes. VIII. 78 new cDNA clones from brain which code for large proteins in vitro. (PubMed id 9455477)1, 2, 3 Ishikawa K....Ohara O. (1997)
    4. Meiosis arrest female 1 (MARF1) has nuage-like functio n in mammalian oocytes. (PubMed id 23090997)1, 3 Su Y.Q....Eppig J.J. (2012)
    5. MARF1 regulates essential oogenic processes in mice. (PubMed id 22442484)1, 3 Su Y.Q....Eppig J.J. (2012)
    6. The sequence and analysis of duplication-rich human chromosome 16. (PubMed id 15616553)1, 2 Martin J.... Pennacchio L.A. (2004)
    7. The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). (PubMed id 15489334)1, 2 Gerhard D.S....Malek J. (2004)
    8. Complete sequencing and characterization of 21,243 full-length human cDNAs. (PubMed id 14702039)1, 2 Ota T.... Sugano S. (2004)
    9. Methods for quantification of in vivo changes in prote in ubiquitination following proteasome and deubiquitinase inhibition. (PubMed id 22505724)1 Udeshi N.D....Carr S.A. (2012)
    10. Systematic and quantitative assessment of the ubiquiti n-modified proteome. (PubMed id 21906983)1 Kim W....Gygi S.P. (2011)

    (in PubMed, OMIM, and NCBI Bookshelf)
    About This Section
     ANDOR
    Aliases
    Free Text  

      Query String
    PubMed
    OMIM
    NCBI Bookshelf
      (Note: In FireFox, select the above section and copy using Ctrl-C)

    (According to Entrez Gene, HGNC, AceView, euGenes, Ensembl, miRBase, ECgene, Kegg, and/or H-InvDB)
    About This Section
    Entrez Gene: 9665 HGNC: 29562 AceView: LKAP Ensembl:ENSG00000166783 euGenes: HUgn9665
    ECgene: KIAA0430 H-InvDB: KIAA0430

    (According to HUGE)
    About This Section
    HUGE: KIAA0430

    (According to PharmGKB, ATLAS, HORDE, IMGT, LEIDEN, UniProtKB/Swiss-Prot, and/or UniProtKB/TrEMBL,
    Wikipedia and/or GeneReviews via UniProtKB/Swiss-Prot)
    About This Section
    NameDescription
    PharmGKB entry for KIAA0430 Pharmacogenomics, SNPs, Pathways

    (Patent information from GeneIP,
    Licensable technologies from WIS Yeda, Salk, Tufts,
    IP news from LifeMap Sciences, Inc.)
    About This Section
    Patent Information for KIAA0430 gene:
    Search GeneIP for patents involving KIAA0430

    GeneCards and IP:
    Japan Patent Office Licenses GeneCards     European Patent Office Licenses GeneCards     Improving the IP Search



    (Antibodies, recombinant proteins, and assays from EMD Millipore, R&D Systems, OriGene, QIAGEN, GenScript, Cell Signaling Technology, SABiosciences, Novus Biologicals, Sino Biological, Enzo Life Sciences, Abcam, ProSpec, Cloud-Clone Corp., Thermo Fisher Scientific, LSBio, Gene Editing from DNA2.0 and Sirion Biotech, Clones from EMD Millipore, OriGene, GenScript, Sino Biological, DNA2.0, SwitchGear Genomics, Vector BioLabs, Sirion Biotech, Cell lines from GenScript, and LifeMap BioReagents, PCR Arrays from SABiosciences, Drugs and/or compounds from EMD Millipore, Tocris Bioscience, and/or Enzo Life Sciences, In Situ Hybridization Assays from
    Advanced Cell Diagnostics, Animal models from inGenious Targeting Laboratory, genOway)
    About This Section

     
     EMD Millipore Custom Antibody & Bulk Services
     EMD Millipore Preclinical / Clinical Development Services
     EMD Millipore Immunoassay Services
     EMD Millipore Target Screening & Profiling Services

      
     Browse Antibodies   Browse Cell Culture Products  
     Browse ELISAs   Browse Flow Cytometry Kits  
     Browse Primer Pairs   Browse Kinase Activity Assays/Reagents  
     Browse ELISpot Kits/Development Modules   Browse TFB/Immunoprecipitation Assays  
     Browse Apoptosis Detection Kits/Reagents   Browse Ubiquitin Proteasome Pathway (UPP) Assay Kits/Reagents  
     Browse DNA Damage/Repair Kits/Reagents   Browse Multiplex/Array Assay Kits/Reagents  
     Browse Cell Selection/Detection Kits/Reagents   Browse Secondary Antibodies/Controls/Staining Reagents  
     Browse Protease Activity Assays and Reagents   Browse Recombinant/Natural Proteins  
     Browse Stem Cell Products   Browse Tocris Biochemicals & Compounds  
     Browse cDNA Clones   Browse Proteome Profiler Antibody Arrays  
     Browse OriGene Antibodies   OriGene RNAi products in human, mouse, rat for KIAA0430  
     Browse OriGene qPCR primer pairs and template standards   Browse OriGene Protein Over-expression Lysates  
     OriGene Custom Mass Spec   OriGene clones in human, mouse for KIAA0430  
     OriGene qSTAR qPCR primer pairs in human, mouse for KIAA0430   Browse OriGene full length recombinant human proteins expressed in human HEK293 cells  
     OriGene ORF clones in mouse, rat for KIAA0430   OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling  
     OriGene Custom Antibody Services for KIAA0430   OriGene Custom Protein Services for KIAA0430  

     
     
     QIAGEN Custom miScript Target Protector blocks miRNA-binding site of in human, mouse, rat KIAA0430
     QIAGEN SeqTarget long-range PCR primers for resequencing KIAA0430
     QIAGEN PyroMark CpG Assay predesigned Pyrosequencing DNA Methylation assays in human, mouse, rat KIAA0430
     QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat KIAA0430
     QIAGEN QuantiFast Probe-based Assays in human, mouse, rat KIAA0430
     QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat KIAA0430
     GenScript Custom Purified and Recombinant Proteins Services for KIAA0430 GenScript cDNA clones with any tag delivered in your preferred vector for KIAA0430
     GenScript Custom Assay Services for KIAA0430 GenScript Custom Superior Antibodies Services for KIAA0430
     GenScript Custom overexpressing Cell Line Services for KIAA0430 CloneReady with Over 120,000 Genes
     Gene Synthesis: Any Gene in Any Vector Vector-based siRNA and miRNA, Ready for Transfection
     Gene Mutant Library, Variants up to 10^11 Plasmid Preparation
     Custom Peptide Services
     Search for Antibodies & Assays

     Regulatory tfbs in KIAA0430 promoter
     Search Chromatin IP Primers for KIAA0430
     RT2 qPCR Primer Assay in human, mouse, rat KIAA0430
     Search GNC Networks for KIAA0430
     SABiosciences Custom PCR Arrays for KIAA0430
     Search Tocris compounds for KIAA0430 (MARF1)
     Browse Sino Biological Proteins and Antibodies
     Browse Sino Biological Cell Lysates
     Browse Sino Biological cDNA Clones
     4000+ Proteins
     Search Sino Biological for antibodies, proteins & pathways
     Protein Production Services
     Transfection Reagents
     Protein A/G/L resins
     Isotyping reagents
     Search www.enzolifesciences.com for proteins, assays, substrates, inhibitors & antibodies
     Novus Tissue Slides
     KIAA0430 antibodies
     KIAA0430 lysates
     Antibodies for KIAA0430
     See all of Abcam's Antibodies, Kits and Proteins for KIAA0430
     Custom Antibody / Protein Production Service
     Bulk Purchasing
     Advantages of Rabbit Monoclonal antibodies
     Abcam protocols and scientific support
     Browse ProSpec Recombinant Proteins




     Browse Proteins at Cloud-Clone Corp.
     Browse Antibodies at Cloud-Clone Corp.
     Browse ELISAs at Cloud-Clone Corp.
     Browse CLIAs at Cloud-Clone Corp.
     Search LifeMap BioReagents cell lines for KIAA0430
     Gene Synthesis
     Protein Engineering
     Variant Library Synthesis
     Codon Optimization
     Protein Production and Purification
     Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for KIAA0430
     SwitchGear 3'UTR luciferase reporter plasmids for KIAA0430
     SwitchGear Promoter luciferase reporter plasmids for KIAA0430
     Search ThermoFisher Antibodies for KIAA0430
     Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat KIAA0430
     inGenious Targeting Laboratory - Custom generated mouse model solutions for KIAA0430
     inGenious Targeting Laboratory - Custom generated inducible mouse model solutions for KIAA0430
    Customized:
     lentivirus for stable overexpression
     lentivirus expression plasmids for stable overexpression
     adenovirus for overexpression of KIAA0430
     Search LSBio for Antibodies for KIAA0430
    Customized transgenic rodents for:
     Humanization
     Biomarker expression
     Off-target effect monitoring
     Translational medicine
     Tissue-specific gene expresssion
     Time-controlled gene expresssion
           
    GeneCards Homepage - Last full update: 23 Oct 2013 - Incrementals: 3 Nov 2013 , 7 Nov 2013 , 23 Jan 2014

    View Random Gene

    Category
    (GIFtS: 73)
    transforming growth factor, beta 1
    GIFtS Group
    The GeneCards human gene database gene index: 1 3 5 6 A B C D E F G H I J K L M N O P Q R S T U V W X Y Z 


    Developed at the Crown Human Genome Center, Department of Molecular Genetics, the Weizmann Institute of Science

    Hot genes      Disease genes      KIAA0430 gene at Home site.
    hostname: 356977-web1.xennexinc.com index build: 106 solr: 1.4